ID: 1077180491

View in Genome Browser
Species Human (GRCh38)
Location 11:1210420-1210442
Sequence GAGATGTGGAGTGGGAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077180491_1077180495 18 Left 1077180491 11:1210420-1210442 CCTGATTTCCCACTCCACATCTC No data
Right 1077180495 11:1210461-1210483 TTTAATTCCTCTAGTGCCACTGG No data
1077180491_1077180496 19 Left 1077180491 11:1210420-1210442 CCTGATTTCCCACTCCACATCTC No data
Right 1077180496 11:1210462-1210484 TTAATTCCTCTAGTGCCACTGGG No data
1077180491_1077180497 24 Left 1077180491 11:1210420-1210442 CCTGATTTCCCACTCCACATCTC No data
Right 1077180497 11:1210467-1210489 TCCTCTAGTGCCACTGGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077180491 Original CRISPR GAGATGTGGAGTGGGAAATC AGG (reversed) Intergenic