ID: 1077180492 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:1210428-1210450 |
Sequence | GAAATATAGAGATGTGGAGT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1077180492_1077180496 | 11 | Left | 1077180492 | 11:1210428-1210450 | CCCACTCCACATCTCTATATTTC | No data | ||
Right | 1077180496 | 11:1210462-1210484 | TTAATTCCTCTAGTGCCACTGGG | No data | ||||
1077180492_1077180495 | 10 | Left | 1077180492 | 11:1210428-1210450 | CCCACTCCACATCTCTATATTTC | No data | ||
Right | 1077180495 | 11:1210461-1210483 | TTTAATTCCTCTAGTGCCACTGG | No data | ||||
1077180492_1077180497 | 16 | Left | 1077180492 | 11:1210428-1210450 | CCCACTCCACATCTCTATATTTC | No data | ||
Right | 1077180497 | 11:1210467-1210489 | TCCTCTAGTGCCACTGGGTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1077180492 | Original CRISPR | GAAATATAGAGATGTGGAGT GGG (reversed) | Intergenic | ||