ID: 1077180493

View in Genome Browser
Species Human (GRCh38)
Location 11:1210429-1210451
Sequence AGAAATATAGAGATGTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077180493_1077180496 10 Left 1077180493 11:1210429-1210451 CCACTCCACATCTCTATATTTCT No data
Right 1077180496 11:1210462-1210484 TTAATTCCTCTAGTGCCACTGGG No data
1077180493_1077180497 15 Left 1077180493 11:1210429-1210451 CCACTCCACATCTCTATATTTCT No data
Right 1077180497 11:1210467-1210489 TCCTCTAGTGCCACTGGGTTAGG No data
1077180493_1077180495 9 Left 1077180493 11:1210429-1210451 CCACTCCACATCTCTATATTTCT No data
Right 1077180495 11:1210461-1210483 TTTAATTCCTCTAGTGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077180493 Original CRISPR AGAAATATAGAGATGTGGAG TGG (reversed) Intergenic