ID: 1077180493 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:1210429-1210451 |
| Sequence | AGAAATATAGAGATGTGGAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1077180493_1077180496 | 10 | Left | 1077180493 | 11:1210429-1210451 | CCACTCCACATCTCTATATTTCT | No data | ||
| Right | 1077180496 | 11:1210462-1210484 | TTAATTCCTCTAGTGCCACTGGG | No data | ||||
| 1077180493_1077180497 | 15 | Left | 1077180493 | 11:1210429-1210451 | CCACTCCACATCTCTATATTTCT | No data | ||
| Right | 1077180497 | 11:1210467-1210489 | TCCTCTAGTGCCACTGGGTTAGG | No data | ||||
| 1077180493_1077180495 | 9 | Left | 1077180493 | 11:1210429-1210451 | CCACTCCACATCTCTATATTTCT | No data | ||
| Right | 1077180495 | 11:1210461-1210483 | TTTAATTCCTCTAGTGCCACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1077180493 | Original CRISPR | AGAAATATAGAGATGTGGAG TGG (reversed) | Intergenic | ||