ID: 1077180494

View in Genome Browser
Species Human (GRCh38)
Location 11:1210434-1210456
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077180494_1077180495 4 Left 1077180494 11:1210434-1210456 CCACATCTCTATATTTCTGTGTG No data
Right 1077180495 11:1210461-1210483 TTTAATTCCTCTAGTGCCACTGG No data
1077180494_1077180500 29 Left 1077180494 11:1210434-1210456 CCACATCTCTATATTTCTGTGTG No data
Right 1077180500 11:1210486-1210508 TAGGATCTCCCCGACCAAGTTGG No data
1077180494_1077180497 10 Left 1077180494 11:1210434-1210456 CCACATCTCTATATTTCTGTGTG No data
Right 1077180497 11:1210467-1210489 TCCTCTAGTGCCACTGGGTTAGG No data
1077180494_1077180496 5 Left 1077180494 11:1210434-1210456 CCACATCTCTATATTTCTGTGTG No data
Right 1077180496 11:1210462-1210484 TTAATTCCTCTAGTGCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077180494 Original CRISPR CACACAGAAATATAGAGATG TGG (reversed) Intergenic