ID: 1077180496

View in Genome Browser
Species Human (GRCh38)
Location 11:1210462-1210484
Sequence TTAATTCCTCTAGTGCCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077180491_1077180496 19 Left 1077180491 11:1210420-1210442 CCTGATTTCCCACTCCACATCTC No data
Right 1077180496 11:1210462-1210484 TTAATTCCTCTAGTGCCACTGGG No data
1077180493_1077180496 10 Left 1077180493 11:1210429-1210451 CCACTCCACATCTCTATATTTCT No data
Right 1077180496 11:1210462-1210484 TTAATTCCTCTAGTGCCACTGGG No data
1077180492_1077180496 11 Left 1077180492 11:1210428-1210450 CCCACTCCACATCTCTATATTTC No data
Right 1077180496 11:1210462-1210484 TTAATTCCTCTAGTGCCACTGGG No data
1077180489_1077180496 21 Left 1077180489 11:1210418-1210440 CCCCTGATTTCCCACTCCACATC No data
Right 1077180496 11:1210462-1210484 TTAATTCCTCTAGTGCCACTGGG No data
1077180494_1077180496 5 Left 1077180494 11:1210434-1210456 CCACATCTCTATATTTCTGTGTG No data
Right 1077180496 11:1210462-1210484 TTAATTCCTCTAGTGCCACTGGG No data
1077180490_1077180496 20 Left 1077180490 11:1210419-1210441 CCCTGATTTCCCACTCCACATCT No data
Right 1077180496 11:1210462-1210484 TTAATTCCTCTAGTGCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077180496 Original CRISPR TTAATTCCTCTAGTGCCACT GGG Intergenic