ID: 1077180496 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:1210462-1210484 |
| Sequence | TTAATTCCTCTAGTGCCACT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 6 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1077180491_1077180496 | 19 | Left | 1077180491 | 11:1210420-1210442 | CCTGATTTCCCACTCCACATCTC | No data | ||
| Right | 1077180496 | 11:1210462-1210484 | TTAATTCCTCTAGTGCCACTGGG | No data | ||||
| 1077180493_1077180496 | 10 | Left | 1077180493 | 11:1210429-1210451 | CCACTCCACATCTCTATATTTCT | No data | ||
| Right | 1077180496 | 11:1210462-1210484 | TTAATTCCTCTAGTGCCACTGGG | No data | ||||
| 1077180492_1077180496 | 11 | Left | 1077180492 | 11:1210428-1210450 | CCCACTCCACATCTCTATATTTC | No data | ||
| Right | 1077180496 | 11:1210462-1210484 | TTAATTCCTCTAGTGCCACTGGG | No data | ||||
| 1077180489_1077180496 | 21 | Left | 1077180489 | 11:1210418-1210440 | CCCCTGATTTCCCACTCCACATC | No data | ||
| Right | 1077180496 | 11:1210462-1210484 | TTAATTCCTCTAGTGCCACTGGG | No data | ||||
| 1077180494_1077180496 | 5 | Left | 1077180494 | 11:1210434-1210456 | CCACATCTCTATATTTCTGTGTG | No data | ||
| Right | 1077180496 | 11:1210462-1210484 | TTAATTCCTCTAGTGCCACTGGG | No data | ||||
| 1077180490_1077180496 | 20 | Left | 1077180490 | 11:1210419-1210441 | CCCTGATTTCCCACTCCACATCT | No data | ||
| Right | 1077180496 | 11:1210462-1210484 | TTAATTCCTCTAGTGCCACTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1077180496 | Original CRISPR | TTAATTCCTCTAGTGCCACT GGG | Intergenic | ||