ID: 1077180498

View in Genome Browser
Species Human (GRCh38)
Location 11:1210468-1210490
Sequence TCCTAACCCAGTGGCACTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077180498_1077180500 -5 Left 1077180498 11:1210468-1210490 CCTCTAGTGCCACTGGGTTAGGA No data
Right 1077180500 11:1210486-1210508 TAGGATCTCCCCGACCAAGTTGG No data
1077180498_1077180505 27 Left 1077180498 11:1210468-1210490 CCTCTAGTGCCACTGGGTTAGGA No data
Right 1077180505 11:1210518-1210540 AAAGTTGCCATCTCCTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077180498 Original CRISPR TCCTAACCCAGTGGCACTAG AGG (reversed) Intergenic
No off target data available for this crispr