ID: 1077180500

View in Genome Browser
Species Human (GRCh38)
Location 11:1210486-1210508
Sequence TAGGATCTCCCCGACCAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077180498_1077180500 -5 Left 1077180498 11:1210468-1210490 CCTCTAGTGCCACTGGGTTAGGA No data
Right 1077180500 11:1210486-1210508 TAGGATCTCCCCGACCAAGTTGG No data
1077180494_1077180500 29 Left 1077180494 11:1210434-1210456 CCACATCTCTATATTTCTGTGTG No data
Right 1077180500 11:1210486-1210508 TAGGATCTCCCCGACCAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077180500 Original CRISPR TAGGATCTCCCCGACCAAGT TGG Intergenic
No off target data available for this crispr