ID: 1077181815

View in Genome Browser
Species Human (GRCh38)
Location 11:1220300-1220322
Sequence TGAGGGTCCCAGCTCTGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077181810_1077181815 10 Left 1077181810 11:1220267-1220289 CCACAGGCACTGAGCGGGGACAG No data
Right 1077181815 11:1220300-1220322 TGAGGGTCCCAGCTCTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077181815 Original CRISPR TGAGGGTCCCAGCTCTGCCA TGG Intergenic
No off target data available for this crispr