ID: 1077184231

View in Genome Browser
Species Human (GRCh38)
Location 11:1229183-1229205
Sequence ACTCCTGGTGCTGCATGTTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077184231_1077184234 -5 Left 1077184231 11:1229183-1229205 CCTCAACATGCAGCACCAGGAGT 0: 1
1: 0
2: 0
3: 17
4: 154
Right 1077184234 11:1229201-1229223 GGAGTGTGGCTCACCCTGCACGG 0: 1
1: 0
2: 0
3: 17
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077184231 Original CRISPR ACTCCTGGTGCTGCATGTTG AGG (reversed) Exonic
900600670 1:3501461-3501483 CCTCCTGGGGCTGCAGGCTGCGG + Intronic
900659448 1:3775367-3775389 TCTCCTGGGGCTGCATGCTGTGG - Exonic
900862143 1:5241405-5241427 ACTCCTGTTGCTACTAGTTGGGG + Intergenic
901822672 1:11840239-11840261 TCTCCTGGTGCTGCCTGGGGAGG + Exonic
902806006 1:18861778-18861800 CCTCCTGGTGCTGCAGGAAGAGG + Intronic
902806324 1:18863434-18863456 CCTCCTGGTGCTGCAGGAAGAGG + Intronic
905388989 1:37624295-37624317 CCTCCTGCTGCTGCCTGTTATGG + Intronic
907081340 1:51625596-51625618 AGTCTTGGTGCTGGACGTTGCGG - Intronic
908877965 1:68699398-68699420 CCTCCAGGTTCTCCATGTTGTGG + Intergenic
915723508 1:158001499-158001521 ACTGCTGGTGGTGCAAGGTGTGG + Intronic
916147617 1:161754526-161754548 ACTCATGGTTCTGCATGGTTGGG + Intronic
916895791 1:169160461-169160483 ACTCCTGGTACTAGATGTTTTGG + Intronic
919686539 1:200488373-200488395 ACTCATGCTAATGCATGTTGAGG + Intergenic
922795814 1:228338919-228338941 GCTCCAGGTGCTGCAGGTGGTGG - Exonic
923678970 1:236103780-236103802 ACTTCTGTTTCTGCATGATGTGG - Intergenic
924541544 1:244985482-244985504 AGGCCTGGTGCTAGATGTTGGGG + Intronic
1063963115 10:11323693-11323715 ACTACTGGTCCTGGCTGTTGGGG - Intronic
1067217895 10:44317555-44317577 AGTCCTGGTGCAGCCTGGTGTGG + Intergenic
1069414778 10:68188658-68188680 TCTCCTGGGGCTGCATGCTCAGG + Intronic
1070654862 10:78264387-78264409 ACTTATGGTGCAGCATGTTGGGG + Intergenic
1075976625 10:126701702-126701724 TCTCCTGGTGATGAGTGTTGTGG - Intergenic
1076461288 10:130649169-130649191 ACTCCTGGTTCTGCACCGTGTGG + Intergenic
1076490066 10:130853266-130853288 ATTCATGGAGCTGTATGTTGGGG + Intergenic
1077184231 11:1229183-1229205 ACTCCTGGTGCTGCATGTTGAGG - Exonic
1081237050 11:40658916-40658938 ACTGCTGGGGCTGCATGCTCTGG + Intronic
1081495066 11:43600446-43600468 ATTCATGGTGTTGAATGTTGCGG + Intronic
1083294223 11:61706613-61706635 ACTCCTGTCTCTGGATGTTGTGG - Intronic
1083418683 11:62541467-62541489 CCTCCTGGTTCCGAATGTTGGGG - Intronic
1084774929 11:71368910-71368932 ACTCCTGGGGCAGCACGTGGCGG + Intergenic
1084970357 11:72768160-72768182 TCTCCTGGTCCAGCATGGTGAGG - Intronic
1085037890 11:73310598-73310620 CCTCCTGTTGCAGCATTTTGCGG + Exonic
1093379372 12:18473136-18473158 TATCCTGGGGGTGCATGTTGAGG + Intronic
1093947560 12:25126967-25126989 ATTCCTGTTGTTGCATGCTGAGG - Intronic
1097226525 12:57479602-57479624 ACTCCTGGTGGTGTCTGGTGAGG + Intronic
1099356433 12:81641578-81641600 ACACCTGGTCCAGCCTGTTGGGG + Intronic
1099941337 12:89192851-89192873 TCTCCTGGTGCTACAAGCTGGGG - Intergenic
1100885681 12:99067235-99067257 ACTGCTGGTGCCCAATGTTGAGG - Intronic
1104518395 12:129449618-129449640 ACTCCTGGTGTTGTATGATTTGG - Intronic
1104998278 12:132672743-132672765 ACTCCTGCTCTTGCTTGTTGGGG + Exonic
1108186832 13:47896257-47896279 CCTCCTGGAGCTGCATGGAGTGG - Intergenic
1110418577 13:75279036-75279058 TATCTTGGTGCTCCATGTTGTGG - Intergenic
1112263862 13:97904278-97904300 ACTCCTGGTGTTGAAGGATGAGG - Intergenic
1113090762 13:106615629-106615651 ACTCCTGGTGCTGAAGATGGTGG + Intergenic
1113583536 13:111447188-111447210 ACTCCTGTTGCTTCATGTGTTGG + Intergenic
1113802904 13:113095733-113095755 CCTCCTGGTGCTGCGTGTGGTGG - Intronic
1114665440 14:24374844-24374866 ACTCCTGTAGCTCCATCTTGGGG - Intronic
1122455863 14:101850665-101850687 ACTCCAGGTGGTGCAGGATGAGG + Intronic
1122802124 14:104236682-104236704 ACTCCTGGTGCTGCCCTGTGTGG - Intergenic
1124402193 15:29358509-29358531 ACTTCTGGTGCTGGTTGGTGGGG + Intronic
1125590712 15:40853179-40853201 ACCCCTGGTGCTGAAGGATGTGG + Exonic
1130067925 15:80620440-80620462 TCTCTTGCTGCTGCATTTTGTGG + Intergenic
1130658876 15:85814251-85814273 ATTCCTGGATCTGCATGATGTGG + Intergenic
1132582048 16:689295-689317 ACAGCTGGTCCTGCTTGTTGCGG + Exonic
1135810412 16:25581620-25581642 ACTCCTGGGGCTGGGTGTGGTGG + Intergenic
1136380968 16:29895406-29895428 GCTCCTGGTGCTGGCTGGTGGGG - Exonic
1138704623 16:58902174-58902196 GCTCCAGGTGCTGCAGGTTTTGG + Intergenic
1140604023 16:76512670-76512692 ACTCCTGCTGTTCCATCTTGTGG - Intronic
1143612053 17:8024361-8024383 GCTTTTGGTGCTGCCTGTTGTGG - Intergenic
1143741506 17:8957573-8957595 ATTCCAGGTGCTGCATTTGGAGG - Intronic
1146161187 17:30560161-30560183 TCTCCGGGTGCTGAATGATGGGG + Exonic
1147242398 17:39099115-39099137 ACTCCAGGTGCTGTGTGCTGAGG - Intronic
1147856147 17:43481873-43481895 ACTACTGCTGCTACATGTTATGG + Intergenic
1150152442 17:62821543-62821565 CCTCCTCGTGCTGCATGAGGTGG + Intergenic
1151348023 17:73515277-73515299 ACCCCTGGTGCTACAGGTTGGGG - Intronic
1151624441 17:75267835-75267857 ACTCCTGCTGCAGCCGGTTGAGG + Exonic
1154173705 18:12068118-12068140 ACTCCTGGTGGTGCGTCTTCTGG - Intergenic
1154343842 18:13526260-13526282 ACTCCTTGCACTGCATGTGGTGG + Intronic
1154951353 18:21213296-21213318 TCTCGTGGTGCTGCACGTGGTGG - Intergenic
1156103417 18:33626659-33626681 AGACCTGGTGCTGCCTGTTAAGG - Intronic
1156820887 18:41371575-41371597 AATCCTGCTGCTGCCTGTTAGGG + Intergenic
1157187700 18:45554483-45554505 ACTCCTGGGGCTGCAAGGTGGGG + Intronic
1158866717 18:61644536-61644558 AATCCAGGTGCTGCATGTTTGGG - Intergenic
1161408568 19:4103572-4103594 AGTCCTGGAGCAGCATGGTGGGG - Intronic
1163313844 19:16529807-16529829 ACTCCTCGTGCTGCGTCTTGAGG + Exonic
1164576527 19:29408461-29408483 ATCCCTGGTGCTCCATGCTGTGG + Intergenic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1167603415 19:50467363-50467385 ACTCCTGGTTCTGGAAGTAGAGG - Intronic
925666830 2:6265998-6266020 ACTCCTGCTGCTGCGGGTGGAGG + Intergenic
926025814 2:9543602-9543624 GCTCCTGTTGCTGTATTTTGAGG - Intronic
929659101 2:43765621-43765643 ACTCCTTGTCCTCCATGCTGTGG + Exonic
930683593 2:54284320-54284342 ATGCCTGGGGCTGTATGTTGAGG - Intronic
935921386 2:108019200-108019222 ACACCTGGTGCTGCTAGGTGGGG - Intergenic
937505190 2:122529016-122529038 ATTCCTGGTGCTGCTAGTTATGG + Intergenic
940661300 2:156548386-156548408 ACTCCTTATTTTGCATGTTGAGG + Intronic
943576021 2:189632177-189632199 AGTCCTTGTGCTACATGTTAGGG - Intergenic
1169488155 20:6050861-6050883 AGTCCAGCTGCTGCAGGTTGGGG + Exonic
1170569788 20:17626314-17626336 TCTCCTGGTGGTGTTTGTTGGGG - Intronic
1171127273 20:22613483-22613505 TCTTCTGGTGTTGCATGTTGTGG - Intergenic
1173064444 20:39697046-39697068 ATTCTTGATGCTGGATGTTGGGG + Intergenic
1175006092 20:55684909-55684931 ACTCCTGCTTCTGCGTGATGTGG + Intergenic
1175435935 20:58948201-58948223 GCTTTTGGTGCTGCCTGTTGTGG - Intergenic
1175974876 20:62705757-62705779 ACTCCCAATGCTGCCTGTTGAGG - Intergenic
1183020821 22:35024514-35024536 ACTCCTGGTGCCACACGTTGGGG + Intergenic
1184196178 22:42930326-42930348 CCTGGTGCTGCTGCATGTTGTGG - Intronic
1184296117 22:43526603-43526625 AGTCCTGGTGCTGCCTGCAGGGG + Intergenic
950421585 3:12902827-12902849 ACTTCTGGTATTGCATGTTCTGG - Intronic
950543270 3:13624846-13624868 CCTCCTGGTGCTGCACCTTGTGG - Intronic
953673526 3:44982312-44982334 ACCCCTGGTCCTGGCTGTTGGGG + Intronic
954384856 3:50238612-50238634 CCTCCTGGTGGTTCTTGTTGGGG + Intronic
960703291 3:120458099-120458121 TCTCCTGGTGCTGCCTCTTCAGG - Intergenic
961175575 3:124832332-124832354 AATTCTGGTGCTGCCTTTTGTGG + Intronic
961520157 3:127462637-127462659 ACTCCTGCTGCTGAATGTGCAGG + Intergenic
963772709 3:149405100-149405122 AGGCCTGGTGCTGGCTGTTGGGG - Intergenic
968501633 4:952919-952941 GCTCCTGGGGCCGCATGTGGGGG - Intronic
968513520 4:1005437-1005459 ACTCCTGGACCTGGGTGTTGTGG + Intergenic
968636968 4:1685503-1685525 ACCCCTGGGGCTGGATGCTGGGG + Intergenic
969225767 4:5797329-5797351 ACCCTTGGTGCTGCAGGGTGCGG + Intronic
970917348 4:21351472-21351494 ACTCATGGTTCTGCATGTCTAGG - Intronic
973694988 4:53481897-53481919 GCTCCTGGTGCTGAATGCAGTGG - Intronic
973817909 4:54635205-54635227 ACTCCTTGTGATGCATGATTTGG + Intergenic
976091373 4:81461388-81461410 ACTCCTCATGCTGCATGTGAAGG - Intronic
980389830 4:132128830-132128852 ACTCCTGGTGCGGCATTTGTTGG + Intergenic
980550269 4:134327048-134327070 CCTCCTGTAGCTCCATGTTGAGG - Intergenic
980668474 4:135971629-135971651 AATCCTGGTGGTACATGTTCTGG + Intergenic
982084328 4:151818273-151818295 TCTCCTGGTGCTGCAGGGAGTGG + Intergenic
983727783 4:170951201-170951223 ACTCTTGGTGGTGGGTGTTGGGG - Intergenic
985558570 5:570073-570095 ACCCCTGGGGCTGCATGCTGGGG + Intergenic
985814084 5:2113654-2113676 ACTCCTGGTGCTATATTTTGTGG + Intergenic
988824578 5:34922360-34922382 ACTCCTAGTGTTTCATGTTAAGG + Intronic
994812491 5:104539301-104539323 TCTCCTGGTTCTGCGAGTTGGGG + Intergenic
995032636 5:107496654-107496676 ACAGCTGGTGCTGTCTGTTGGGG + Intronic
999218959 5:149959503-149959525 ACTCCTGATGCTGCCCCTTGTGG - Intergenic
1000635895 5:163643396-163643418 ACCCCTGGTACTGCATGTGAAGG + Intergenic
1000711836 5:164589677-164589699 ATTCCTGGTGTTACATGTAGAGG + Intergenic
1000998508 5:167982627-167982649 CCTCCAGGAGCTGCATGATGTGG - Intronic
1002278371 5:178117227-178117249 ACTCCTGTTGCTGCTTCTTGGGG - Intronic
1002338226 5:178495068-178495090 CCTCCTGGGCCTGCAGGTTGAGG + Intronic
1002875870 6:1208294-1208316 ACTCATAGTGCTGCATGTTTGGG - Intergenic
1003958816 6:11190735-11190757 ACTCCGGGTGCTGCCTGTACTGG + Exonic
1005867678 6:29948427-29948449 ACCCCTGGTGCTGGAGGTGGCGG + Intergenic
1007420269 6:41715023-41715045 ACTCCTGGTGCTCCATGGAGCGG - Intronic
1008815787 6:55563971-55563993 ACTGCACGTGCTGAATGTTGAGG - Intronic
1011327952 6:86171879-86171901 ACTCCTAGTGCTGCTTATAGGGG - Intergenic
1016527151 6:145014706-145014728 TCACCTGGTGCTGCATATTCTGG - Intergenic
1017574410 6:155786354-155786376 ACTCCTGGGGCTGCAGTTTTGGG + Intergenic
1017820210 6:158043815-158043837 GCACCCGGTGCTGCCTGTTGTGG + Intronic
1024319451 7:48050300-48050322 ACTGCTTGTCCTGCATGTAGGGG + Intronic
1029386587 7:100247510-100247532 ATTGCTGCTGCTGCCTGTTGTGG + Intronic
1029424588 7:100488005-100488027 CCTCCTGGGGCTGTAAGTTGAGG + Intronic
1029989244 7:104947848-104947870 ACTCCTGGTGCTTCATTCTCAGG - Intergenic
1030072458 7:105709733-105709755 ACTCCTGGTGCTTCCTCATGTGG + Intronic
1030741699 7:113117512-113117534 GCTTTTGGTGCTGCCTGTTGTGG - Exonic
1032326474 7:130933696-130933718 GCTCCTGGTTCAGCATTTTGGGG - Intergenic
1033681843 7:143602886-143602908 ACTCCTGCCGCTGCTGGTTGCGG - Intergenic
1033703046 7:143859027-143859049 ACTCCTGCCGCTGCTGGTTGCGG + Exonic
1034900386 7:154904802-154904824 ACTCCTGGTGCTGCATTCTTTGG - Intergenic
1035643354 8:1200184-1200206 ACACCCGGTGCTGCACGGTGGGG - Intergenic
1035869295 8:3119784-3119806 AGAACTGGTGCTGCATGGTGTGG - Intronic
1038288154 8:26224916-26224938 GCTCCTGGGGCTGGATGTTGTGG + Intergenic
1039701099 8:39962677-39962699 AGTCCTGGTGCTCCATTGTGAGG - Intronic
1040832130 8:51689074-51689096 ACTCCTGGGGCTGCCTGTATGGG + Intronic
1040880393 8:52198876-52198898 AGTTCTGGTGTTGCATGTGGAGG - Intronic
1041596202 8:59656371-59656393 ACTGCTGGTGCTGGGTGCTGTGG + Intergenic
1041600526 8:59712097-59712119 ACTCCAGCTGCTGCATTTTCAGG - Intergenic
1044216628 8:89619517-89619539 ACCCTTGGTGCTGGAAGTTGGGG - Intergenic
1051880359 9:21833668-21833690 ACTCACGATTCTGCATGTTGGGG + Intronic
1052086560 9:24273897-24273919 ATTCTTGTTGCTCCATGTTGTGG + Intergenic
1053157945 9:35792993-35793015 ACACCTGGTGCTGCACACTGAGG - Exonic
1054896206 9:70314239-70314261 ACTCCTGATGCTCCAGATTGGGG + Intronic
1055688527 9:78804805-78804827 AATCCTGGTCATGCATGTAGTGG + Intergenic
1057857986 9:98616938-98616960 ATTCATGGTTCTGCATTTTGAGG - Intronic
1061799122 9:133104519-133104541 ACTCCGCCTGCTGCATGGTGCGG + Intronic
1062101920 9:134732962-134732984 AGTCCTGCCGCTGCATGTGGTGG + Intronic
1187749709 X:22448651-22448673 ACTCCTGGGGCTCCAGGGTGGGG + Intergenic
1188591232 X:31838068-31838090 ATTCCGGGTGCTGCATTTTCAGG - Intronic
1191085161 X:56558851-56558873 ACTCCTGTTGATGCATTTGGGGG - Intergenic
1193240013 X:79157377-79157399 AGTCCTGGTGCTGAATTTTATGG + Intergenic
1193933190 X:87582331-87582353 GCTGCTGCTGCTGGATGTTGGGG - Intronic
1196626937 X:117887384-117887406 ACTCATGCTGCTGCATGGTCAGG - Intergenic
1196656092 X:118218730-118218752 ACTGCTGTGGCTGCATATTGGGG - Intergenic
1199554408 X:149090869-149090891 CCTCTTGGTTCAGCATGTTGGGG - Intergenic
1199848369 X:151707837-151707859 ACTCCTGCAGCCACATGTTGAGG + Intergenic