ID: 1077184868

View in Genome Browser
Species Human (GRCh38)
Location 11:1231496-1231518
Sequence GCAGCTGGTGCCACTCATGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 242}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077184859_1077184868 30 Left 1077184859 11:1231443-1231465 CCCTCGAGCTTCTTCATCGTGGT 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1077184868 11:1231496-1231518 GCAGCTGGTGCCACTCATGCAGG 0: 1
1: 0
2: 1
3: 18
4: 242
1077184866_1077184868 -2 Left 1077184866 11:1231475-1231497 CCTGGGGCTGCAGCTGCTGGTGC 0: 1
1: 0
2: 17
3: 149
4: 1086
Right 1077184868 11:1231496-1231518 GCAGCTGGTGCCACTCATGCAGG 0: 1
1: 0
2: 1
3: 18
4: 242
1077184860_1077184868 29 Left 1077184860 11:1231444-1231466 CCTCGAGCTTCTTCATCGTGGTG 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1077184868 11:1231496-1231518 GCAGCTGGTGCCACTCATGCAGG 0: 1
1: 0
2: 1
3: 18
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077184868 Original CRISPR GCAGCTGGTGCCACTCATGC AGG Exonic
900465972 1:2825606-2825628 GCAGCTGGTGCCACCCTCGGGGG + Intergenic
900517689 1:3090821-3090843 GCAGCAGCTGACACTCCTGCAGG + Intronic
900897983 1:5497209-5497231 GCAGCTTCTTCCACTGATGCAGG + Intergenic
901687242 1:10949712-10949734 GCAGCAGGTGGCACTCCCGCTGG + Exonic
901786073 1:11625890-11625912 GGAGCTGGTGCCAGTCCAGCTGG + Intergenic
902183736 1:14709795-14709817 GCACCTGGTGACACTCACACAGG - Intronic
902429550 1:16352443-16352465 GCAGCTGCTGCTGCTCAGGCCGG + Exonic
907077904 1:51594933-51594955 GCAGCTGCTGCCACTGCTGCTGG - Intronic
907637120 1:56146430-56146452 GAAGCTGGGGCCACTGATTCTGG - Intergenic
908569388 1:65392730-65392752 GCAGCTGGTCCCACCCAGGCTGG + Exonic
909593537 1:77379120-77379142 ACCGCTGGTTCCTCTCATGCTGG - Intronic
912438667 1:109681044-109681066 TCAGCTGGTGCAGCCCATGCAGG - Intronic
912441188 1:109699489-109699511 TCAGCTGGTGCAGCCCATGCAGG - Intronic
915512711 1:156395165-156395187 CCAGCTGGGCCCACTCATGGTGG - Intergenic
917212084 1:172641674-172641696 GCAGCTGGTCCCACTGCTCCAGG - Intergenic
917510197 1:175663272-175663294 GACGCTGGTGCCAGTCAGGCCGG + Intronic
920599777 1:207312426-207312448 CCAGCTGGTGCCACCCAGACTGG + Intergenic
921269184 1:213451907-213451929 GCAGCTGACGCCACCCAGGCTGG - Intergenic
922276275 1:224081856-224081878 GTAGCTGGTGCCTGACATGCTGG - Intergenic
922800148 1:228361414-228361436 GCAGCTGGTTCCCATCATGGAGG + Intronic
923663022 1:235975106-235975128 ACAGGCAGTGCCACTCATGCTGG - Intergenic
1066046833 10:31602631-31602653 TCAGATGGGGCCACACATGCTGG - Intergenic
1069788318 10:71003926-71003948 GCAGAAGGAGCCACTCATGTCGG - Intergenic
1071943568 10:90615208-90615230 CCAGCTGGTGCCAGGCATGGTGG + Intergenic
1073150811 10:101310407-101310429 GAAGCTGGTGCCCCAAATGCAGG - Intergenic
1075782075 10:125023563-125023585 CCAGGTGCTGCCACTCACGCGGG + Intronic
1075889542 10:125934895-125934917 GCAGCTGGTGCCTGCCCTGCAGG + Intronic
1076847614 10:133077004-133077026 GCAGCTGGTGCCACAGAGACGGG - Intronic
1077184868 11:1231496-1231518 GCAGCTGGTGCCACTCATGCAGG + Exonic
1078433211 11:11303303-11303325 GCTGCTGGTGCCAGTGCTGCTGG - Intronic
1079138582 11:17792387-17792409 TCAGCTGGTGCCACTCACCAGGG - Intronic
1083184135 11:61007787-61007809 GCAGCTAATGCCACTCTGGCCGG + Exonic
1083222919 11:61265104-61265126 GCAGCTGGTCCCACTCACCTCGG + Exonic
1083952370 11:65964002-65964024 GCAGCTGGAGCCAACGATGCTGG + Intronic
1084459183 11:69286788-69286810 GCACCTGATGCCACCCAGGCAGG - Intergenic
1084643889 11:70443172-70443194 TCAGCTGCTTCCACTCATGGGGG + Intergenic
1085407257 11:76270510-76270532 GCTGCTGGTGCCTCTCAGGCTGG + Intergenic
1089162869 11:116452903-116452925 GCAGCTGGAGCCACCCACCCCGG + Intergenic
1089181539 11:116586642-116586664 GCAGCAAGTTCCAGTCATGCTGG + Intergenic
1089572606 11:119420378-119420400 ACTGCTGGTGCCAGTCTTGCAGG - Exonic
1090798579 11:130156475-130156497 GCAGCTTGTGCCAGGCCTGCAGG - Intergenic
1093784891 12:23181484-23181506 GCAGCTGGTGCAACTTAGGAAGG + Intergenic
1096497602 12:52047447-52047469 ACAGCTGGGGCCACCAATGCAGG - Intronic
1096595515 12:52692563-52692585 GCAGCTTCTGCCACGCATCCTGG + Exonic
1098981720 12:76963257-76963279 GCAGCTCCTACCACTCATCCTGG + Intergenic
1100345207 12:93723391-93723413 CCAGCTGGTGCCACCCAGACTGG + Intronic
1101961468 12:109253966-109253988 TCAGATGGTGTCACTGATGCTGG - Intronic
1103627456 12:122230875-122230897 ACAGCTGCTGCTACTCCTGCAGG - Exonic
1104737192 12:131143015-131143037 TCAGCCGGTGCCACCCATCCAGG + Intergenic
1105226515 13:18439590-18439612 GCAGCTGGTGGCTATCATACTGG + Intergenic
1105886634 13:24648501-24648523 GCTGGTGATGCCACTCATGAGGG - Intergenic
1105970955 13:25428965-25428987 GCAGCTGGTGACACTGCTCCAGG + Intronic
1110804387 13:79737107-79737129 GGAGCTGTAGCCACTAATGCTGG + Intergenic
1114010968 14:18368093-18368115 GCAGCTGGTGGCTATCATACTGG + Intergenic
1114529876 14:23388998-23389020 GCAGCAGGTCGCAGTCATGCCGG + Exonic
1114535236 14:23418349-23418371 GCAGCAGGTCGCAGTCATGCCGG + Exonic
1118182578 14:63508016-63508038 GCATTAGGTGCCACTCAAGCTGG - Intronic
1118224879 14:63889604-63889626 GCAGCTGGAACCACAGATGCAGG + Intronic
1119115321 14:72015153-72015175 CCAGCTGCTTCCACTCATGGAGG + Intronic
1119518395 14:75266593-75266615 GCAGCTGCTGCCATGCATCCTGG - Intronic
1119928512 14:78520787-78520809 CCAACTGGTGCCCCTCATGATGG + Intronic
1121089432 14:91170938-91170960 GCAGCTGGGGCCTCTCTGGCAGG - Intronic
1122228168 14:100291696-100291718 CCAGCTGCTGCCACTCCTGCTGG - Exonic
1122341595 14:101031929-101031951 GCGGCTGGTATCACTCCTGCGGG - Intergenic
1124437913 15:29666274-29666296 GCTGCTGGTGACACCCCTGCTGG - Intergenic
1125748273 15:42012041-42012063 GCTACTGGAGCCACTCCTGCTGG + Intronic
1126664909 15:51067396-51067418 GCAGCTTGTGGGACTCATGGGGG + Intronic
1128935032 15:71738775-71738797 GTAGCTAGTGTCACTCATGTGGG - Intronic
1129164264 15:73767415-73767437 CCAGCTGTTGGCCCTCATGCTGG + Intergenic
1130259237 15:82342908-82342930 GCAGCTGCTTCCTCTAATGCAGG - Exonic
1130269439 15:82436257-82436279 GCAGCTGCTTCCTCTAATGCAGG + Exonic
1130282028 15:82526275-82526297 GCAGCTGCTTCCTCTAATGCAGG + Intergenic
1130473397 15:84242438-84242460 GCAGCTGCTTCCTCTAATGCAGG + Exonic
1130480811 15:84356502-84356524 GCAGCTGCTTCCTCTAATGCAGG + Intergenic
1130490901 15:84431257-84431279 GCAGCTGCTTCCTCTAATGCAGG - Intergenic
1130502485 15:84510056-84510078 GCAGCTGCTTCCTCTAATGCAGG - Intergenic
1130595674 15:85247016-85247038 GCAGCTGCTTCCTCTAATGCAGG + Intergenic
1130815766 15:87430726-87430748 CCAGCTGCTTCCACTCATGGTGG - Intergenic
1131451844 15:92547805-92547827 GCAGATGGAGCCACTAATTCAGG - Intergenic
1132398745 15:101491815-101491837 GCAGCTGGTGCCTCCCAAGACGG + Intronic
1132621823 16:871395-871417 GCAGCTGGCGCCTCTCTTCCTGG + Intronic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133056359 16:3147392-3147414 GCAGCCCGAGGCACTCATGCAGG + Exonic
1136996793 16:35196092-35196114 GCTGCTGGTGCCGCTCGGGCAGG - Intergenic
1137009554 16:35309370-35309392 GCTGCTGGTGCCACGCGGGCAGG - Intergenic
1137609187 16:49807707-49807729 GCAGCTGGTCCCACCAAGGCAGG + Intronic
1138382066 16:56609338-56609360 GCAGCTGCTGCGCCTGATGCTGG + Exonic
1138635776 16:58337245-58337267 GCAGGAGGTGCCACCCTTGCTGG + Intronic
1139894478 16:70277375-70277397 GCAGGTGGTGTCACTCGTGGTGG - Intronic
1140323511 16:73977455-73977477 GCAGCTGGTGGCAGCCATGCTGG - Intergenic
1143851624 17:9817215-9817237 GCAGCTGCTCCCACCCCTGCCGG + Intronic
1147441258 17:40448571-40448593 CCACCTGGTGCTACTCATCCTGG - Intronic
1147871395 17:43590097-43590119 GCAGCTGGTCCGACTCAGGGAGG - Intergenic
1149727760 17:58913753-58913775 CCAGCTGGTGCCACCCAGACAGG - Intronic
1152233381 17:79125901-79125923 ACAGCCTGTGCCACCCATGCAGG + Intronic
1152358489 17:79818437-79818459 ACAGCTGATGCCTCTGATGCAGG + Intergenic
1152776535 17:82205493-82205515 GCAGCTGGAGCCACGCAGGCTGG - Intronic
1153729270 18:7991580-7991602 GCAGCTGGTTCCTTTCATTCAGG - Intronic
1154526870 18:15299890-15299912 GCAGCTGGTGGCTATCATACTGG - Intergenic
1154937657 18:21077464-21077486 GCAGCTGGTGCTGCTCATAAAGG + Intronic
1156804816 18:41165220-41165242 GCAGGTGGTCCCATTCATGGTGG + Intergenic
1157677814 18:49580132-49580154 GCTGCTGGTGCCAATGAGGCAGG + Intronic
1158522647 18:58184431-58184453 GCACCTGGAGTCAATCATGCCGG + Intronic
1161685160 19:5698897-5698919 GCAACCGATTCCACTCATGCTGG - Intronic
1162031715 19:7920456-7920478 GCAGCTAGTGCGACTCCTGCAGG + Exonic
1163133067 19:15288644-15288666 GCAGCTGGTGCTACACAGGCTGG + Intronic
1163428131 19:17250329-17250351 GCAGCAGATGGCACTCATGGAGG - Exonic
1164869496 19:31631485-31631507 GCTGCTGGTGCCACTGAAGGGGG - Intergenic
1167203857 19:48086659-48086681 GCAGCTGGTGCTCCACCTGCTGG + Intronic
1168467349 19:56613850-56613872 CCAGCTGCTGCCACTCCTCCTGG - Intronic
925104341 2:1277739-1277761 GCAGCTGGTGACATGCAAGCTGG + Intronic
925518188 2:4708455-4708477 GCAGCTGGTGAAAGTCAAGCTGG + Intergenic
925977083 2:9149263-9149285 GCAACTGCTGCCACCCAGGCCGG + Intergenic
926203790 2:10820710-10820732 CCAGCTGGTGCCGCTGATACAGG - Intronic
927957950 2:27221304-27221326 GCTGCTGCAGCCACTCATGCAGG - Exonic
929958813 2:46480647-46480669 GCCGCTGGTTCTTCTCATGCAGG - Exonic
931090815 2:58884022-58884044 GCAGCTCCTGCCAGGCATGCAGG - Intergenic
931796041 2:65711122-65711144 CCAGCTGGTCACACTCATGTTGG + Intergenic
934996563 2:98967128-98967150 GCTGCTGCTGCCACTGCTGCTGG - Intergenic
938210068 2:129459737-129459759 ACAGCTGATGGCACTGATGCCGG - Intergenic
938525967 2:132131247-132131269 GCAGCTGGTGGCTATCATACTGG - Intergenic
938644415 2:133316340-133316362 GCAGATGGTGCTTCTCATGTTGG + Intronic
939755375 2:146103008-146103030 GCAGCTGGTGCCACCCATACCGG - Intergenic
943052552 2:182933709-182933731 GAAATTGGTGCCACTCAGGCTGG - Intronic
944808111 2:203302390-203302412 GCAGGTGGTGCCACCAAGGCTGG - Intronic
945116265 2:206410879-206410901 GCAGCTGGTCCCACCAGTGCGGG + Intergenic
946337668 2:219049413-219049435 GCAGCAGGTGTGACTCAGGCCGG + Intergenic
946389165 2:219405159-219405181 GCCGGTGCTGCCACTCAGGCTGG - Intergenic
946416146 2:219540715-219540737 GCAGTAGGTGCCACTCAGGATGG + Intronic
947840887 2:233207331-233207353 GCAGCTTGTGTCACTGAAGCTGG - Exonic
1169197207 20:3689670-3689692 GCAGCTGCTGGAACTGATGCAGG + Exonic
1170144655 20:13159790-13159812 TCACTTGGTGCCACTCATGATGG - Intronic
1170740180 20:19049329-19049351 GTAGCTGCTGCCACACATGGGGG - Intergenic
1172131569 20:32659536-32659558 GCACCTGGGTCCACTCATGTAGG - Intergenic
1172547392 20:35772304-35772326 GCAGCCGCCGCCACTCTTGCGGG - Intronic
1172696364 20:36825867-36825889 GCAGCTGGTGTCAGTGAGGCTGG - Intronic
1172871375 20:38137540-38137562 GCAGCTGGTGGCAGCCATGCTGG + Intronic
1174147691 20:48463553-48463575 GCAGCTGGTGCCCTTCATCTGGG + Intergenic
1175239053 20:57533354-57533376 GCAGCTGGGGAAACTCATACAGG + Intergenic
1175267103 20:57709654-57709676 GGAGCTGGGGCCCCGCATGCAGG + Exonic
1176268447 20:64222943-64222965 ACAGCCGGTGCCTCTCAGGCTGG - Intronic
1176386461 21:6140592-6140614 GCAGCTGCTGCCAGCCAGGCAGG + Intergenic
1176770566 21:13068615-13068637 GCAGCTGGTGGCTATCATACTGG + Intergenic
1178831078 21:36057034-36057056 ACAGCAGGGGCCACTCTTGCAGG - Intronic
1179021924 21:37648319-37648341 CCAGCAGGTGCCATTCATGAAGG - Intronic
1179737012 21:43397660-43397682 GCAGCTGCTGCCAGCCAGGCAGG - Intergenic
1179991864 21:44952513-44952535 GCAGCTGGGGCCAGACCTGCAGG - Intronic
1180435462 22:15298897-15298919 GCAGCTGGTGGCTATCATACTGG + Intergenic
1180517658 22:16162708-16162730 GCAGCTGGTGGCTATCATACTGG + Intergenic
1180732831 22:17994675-17994697 CCAGCTGGGGCCACTCCAGCCGG + Intronic
1182146818 22:28001710-28001732 CCAGTTGGTGCCGCTCCTGCAGG - Intronic
1182376371 22:29851434-29851456 GGAGCAGGTGCCAATCAAGCTGG + Intergenic
1183548690 22:38468776-38468798 GCCACCGGTGCCACACATGCAGG - Intronic
1183782377 22:40007182-40007204 GCAGCAGGAGCCCCTCCTGCGGG + Intronic
1185044657 22:48522986-48523008 GCAGCTGGAGCCCCCCATGGCGG + Intronic
1185371055 22:50461176-50461198 GCAGCTGGAGCCCGTCCTGCAGG + Exonic
949743506 3:7263408-7263430 GCTGCTGCTGCCACTGCTGCTGG - Intronic
953348292 3:42194679-42194701 GCAGCTGGTTCCACACGTGCTGG + Intronic
954224926 3:49175221-49175243 GCAGAAGGTGACACACATGCTGG - Intronic
955744852 3:62130138-62130160 GCAGATGGTTCCACTGAGGCTGG + Intronic
955893456 3:63674781-63674803 GCTGCTGGTGCCACTTTTTCAGG + Intronic
957931229 3:86880623-86880645 GAAGCTAGGGCCACTCATTCAGG + Intergenic
960965469 3:123101331-123101353 GATGCTGGTGCCACTGATTCAGG + Intronic
961531963 3:127545367-127545389 TCAGCGGGTGCCTCTCAGGCAGG + Intergenic
963108080 3:141663658-141663680 CCAGCTGGTGCCACTCAGATGGG - Intergenic
968747085 4:2365634-2365656 ACAGCTCGCCCCACTCATGCTGG + Intronic
969842099 4:9890233-9890255 GCAGCACCTGGCACTCATGCTGG + Intronic
969851936 4:9964281-9964303 CCAGCTGGTGCCAGTTCTGCTGG + Intronic
972219638 4:36939192-36939214 GGAGCTGGTACCACTCCTTCTGG + Intergenic
972738457 4:41867263-41867285 GCACGCGGTGCCACTCAGGCCGG - Intergenic
974079097 4:57194605-57194627 GGAACTGGAGCCACTCAAGCGGG - Intergenic
975217237 4:71769872-71769894 GGGGCTGGTGCCACTAATGCAGG + Intronic
977048419 4:92095539-92095561 GCAGCTGGCTCCACTGATGGTGG + Intergenic
979192114 4:117874472-117874494 GCAAATGATGGCACTCATGCTGG - Intergenic
979825658 4:125229626-125229648 GCAGCGGGTGGCACTCATCGGGG + Intergenic
980980556 4:139651137-139651159 GCAGCTGGTCTCCCTCAAGCTGG + Intergenic
981615452 4:146639358-146639380 GCCGCTGCTGCCACTGCTGCTGG - Exonic
982982905 4:162164036-162164058 GGAGCTGCTGCCACTCAACCCGG + Intergenic
985601978 5:840215-840237 GCACCTGGCACCACTCCTGCAGG + Intronic
986165499 5:5268825-5268847 GCAGCTGCAGCCCCTCAGGCAGG + Intronic
986311788 5:6556679-6556701 GCATCTGGTGGCATTCATGGGGG + Intergenic
987018997 5:13850686-13850708 GCAGCTGTTACCACACTTGCTGG - Exonic
987228028 5:15863853-15863875 ACAGCTGCTTCCACTCATGGTGG - Intronic
990123007 5:52479251-52479273 CCAGCTGGTGCCACCCAGACAGG - Intergenic
991482628 5:67098848-67098870 GCAGCTGGCCCCACTGTTGCTGG - Intronic
991482825 5:67101414-67101436 GCAGCTGATGCCATCCCTGCAGG + Intronic
991611467 5:68454036-68454058 CCAGCTGGTGCCACCCAGACTGG - Intergenic
995453867 5:112331784-112331806 CCAGCTGCTGTCACTCATGTTGG - Intronic
996451421 5:123629413-123629435 GCTGCTGCTGCCACTGCTGCTGG + Intergenic
999134585 5:149310039-149310061 GCAGCTCGTGCCTCTTGTGCCGG - Exonic
1001483691 5:172105192-172105214 GCAGCATGTTCCACACATGCTGG - Intronic
1001631507 5:173178864-173178886 GGAGCAGCTGCCACTCCTGCAGG - Intergenic
1002290860 5:178199815-178199837 GCAGCTGAGGCGACTCATGCTGG + Intergenic
1005959522 6:30685724-30685746 GCTGCTGCTGCCGCTCCTGCCGG + Exonic
1006799555 6:36751199-36751221 TAAGCTGGTGCCACCCATACTGG - Intronic
1007083847 6:39128724-39128746 TCAGCTGCTTCCACTCATGGTGG + Intergenic
1007407242 6:41642148-41642170 GCACCGGGTGCCACACATGCTGG - Intronic
1007844618 6:44742898-44742920 GCTGCTGGTTCTACTCATGAGGG + Intergenic
1008033131 6:46719374-46719396 CCAGCTGGTGCCAGTGATGCTGG - Intronic
1014230720 6:118899037-118899059 GCAGCAGGAGCCACTTTTGCAGG - Intronic
1014934092 6:127365994-127366016 GCAGCTGAGCCCACTCAAGCTGG - Intergenic
1017074181 6:150601874-150601896 GAAGCTGGTGCCCCTAATTCAGG - Intronic
1017881373 6:158564933-158564955 GCTGCTTGTTCAACTCATGCCGG - Intronic
1019777855 7:2923137-2923159 GCAGCTGGTGGCCCTCACGGAGG + Exonic
1020007841 7:4791835-4791857 GCAGCTGCTGCCAGTCCTGGAGG + Intronic
1020047942 7:5057333-5057355 CCAGCTGCTGCCACTCCTCCTGG - Exonic
1020057433 7:5127683-5127705 CCAGCTGCTGCCACTCTTTCCGG + Intergenic
1020170317 7:5839987-5840009 CCAGCTGCTGCCACTCTTTCCGG - Intergenic
1021355542 7:19650408-19650430 GGAGCTGGAGCCACTAATGCTGG - Intergenic
1023817448 7:43961715-43961737 GCAGCTGATCCCACTCATCGAGG - Intergenic
1025849760 7:65236414-65236436 ACAGCTGGTGCCACTACTGTGGG + Intergenic
1026922972 7:74170009-74170031 GCAGCTGGGGCCAGTCTTTCGGG - Intergenic
1027324884 7:77040068-77040090 GATGCTGGTGCCACTAATGTTGG + Intergenic
1028984130 7:96996759-96996781 GCAGCTTGGGCCACGCTTGCCGG - Intergenic
1029742073 7:102496589-102496611 GCAGCTGATCCCACTCATCGAGG - Exonic
1029760062 7:102595754-102595776 GCAGCTGATCCCACTCATCGAGG - Exonic
1032658427 7:133955997-133956019 GCAGCTGCTGCCACCCAAACTGG - Intronic
1032821569 7:135528865-135528887 CCAGGTGGTGCCAATGATGCTGG - Intergenic
1033477265 7:141702546-141702568 GCAGCTTCTGCCACACATCCAGG - Intergenic
1034191172 7:149214512-149214534 GCAGCAGGTGGCTCACATGCTGG + Intronic
1035443017 7:158919628-158919650 GCAGTTGGTGCCACTGTTCCAGG + Intronic
1037316753 8:17606554-17606576 GCAGCTGGTGCCAGTGAGTCTGG - Intronic
1037717333 8:21411530-21411552 CCAGCTGGTGCCATTGGTGCGGG - Intergenic
1039743125 8:40400101-40400123 GCCTCTGGTGCCATTCATGCCGG - Intergenic
1040385281 8:46911107-46911129 CCAGCTGGTGCCACCAGTGCTGG + Intergenic
1041176568 8:55203138-55203160 ACAGCTGGTGCCAGTTGTGCTGG - Intronic
1041707832 8:60865265-60865287 GCAGCTGTTGCCAGTCCTGGAGG - Exonic
1046628309 8:116598595-116598617 GCAGCTGGTGCTGCTCTTCCAGG - Intergenic
1046906539 8:119579761-119579783 GCAGCTGGTGCCTATCCTGAAGG - Intronic
1049636732 8:143692993-143693015 CCAGCAGGCCCCACTCATGCGGG - Intronic
1049711126 8:144063838-144063860 GCGGCTGGTGCAGCTCATCCAGG - Intergenic
1051273492 9:15377222-15377244 GCAGCTTGTGGCACTGATGGAGG - Intergenic
1051659068 9:19409093-19409115 GCAGCTGGTCCCACCAGTGCGGG - Exonic
1053384535 9:37676517-37676539 GCTGTTGGTGCCACTCCTACTGG + Intronic
1053537507 9:38939825-38939847 CAAGCTGCTTCCACTCATGCGGG - Intergenic
1054414734 9:64862202-64862224 GCAGCTGGTGGCTATCATACGGG - Intergenic
1054628628 9:67424105-67424127 CAAGCTGCTTCCACTCATGCGGG + Intergenic
1055651416 9:78410311-78410333 GCAGGTGGTGGCACTCATCGGGG - Intergenic
1056901733 9:90606266-90606288 CCAGCTGGTGCCACCCAGACTGG - Intergenic
1060247628 9:121959461-121959483 GCTGCTGGTGCCAGTCATGGAGG - Intronic
1060751856 9:126174734-126174756 GCTGCTGGAGCCACTCAGCCTGG + Intergenic
1061020595 9:128011912-128011934 GCAGCAGGGGTCACTGATGCGGG + Intergenic
1061123180 9:128656690-128656712 GCAGCCGGGGCCACTCAGCCAGG - Exonic
1061259371 9:129471395-129471417 GGAGCTGGTGCCAGCCTTGCTGG + Intergenic
1188567980 X:31548212-31548234 CCAGGTGATGACACTCATGCTGG - Intronic
1190104190 X:47547084-47547106 GCAGCTGAGGCCACTCCTGAAGG - Intergenic
1190758741 X:53422746-53422768 GCCCCTGGTCCCACTCCTGCCGG - Intronic
1191720581 X:64225250-64225272 GAAGCTGGTGCCTCTCCTGGTGG - Exonic
1191928773 X:66344964-66344986 GCAGTGGGTGCCACCCATGGGGG - Intergenic
1192167112 X:68833119-68833141 GCAGCTGCCCCCACCCATGCTGG - Intronic
1193071808 X:77314517-77314539 GCAGTGGGTGCAACTCATGGAGG + Intergenic
1194074120 X:89367603-89367625 GCAGCGGGTACCACCCAGGCGGG - Intergenic
1194379279 X:93174820-93174842 GCAGCTGCAGCCACTCTTTCAGG + Intergenic
1195348529 X:103975641-103975663 GCAACTGGGGCCACTTAGGCCGG + Intergenic
1195358913 X:104063199-104063221 GCAACTGGGGCCACTTAGGCCGG - Intergenic
1196270175 X:113700372-113700394 GCAGCTGGTGCCTGCCATGGAGG - Intergenic
1197159602 X:123308683-123308705 GCACCTGAAGCCAATCATGCAGG + Intronic
1197570694 X:128147279-128147301 GGAGCAGGTTGCACTCATGCTGG - Intergenic
1198085449 X:133278046-133278068 CCAGCTGATGCCACTGCTGCTGG - Intergenic
1199907674 X:152250943-152250965 GTAGCTGCTGCCAGTCTTGCAGG - Intronic
1200144715 X:153920675-153920697 ACCGCTGGTGCCACTGAGGCAGG - Exonic
1200729512 Y:6719130-6719152 GCAGCGGGTACCACCCAGGCGGG - Intergenic