ID: 1077186769

View in Genome Browser
Species Human (GRCh38)
Location 11:1238986-1239008
Sequence ACGCGGGCCTGTGTGTGTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077186762_1077186769 -2 Left 1077186762 11:1238965-1238987 CCTACGCCCAGGCCTGCCACGAC 0: 1
1: 0
2: 1
3: 10
4: 179
Right 1077186769 11:1238986-1239008 ACGCGGGCCTGTGTGTGTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 145
1077186766_1077186769 -9 Left 1077186766 11:1238972-1238994 CCAGGCCTGCCACGACGCGGGCC 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1077186769 11:1238986-1239008 ACGCGGGCCTGTGTGTGTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 145
1077186765_1077186769 -8 Left 1077186765 11:1238971-1238993 CCCAGGCCTGCCACGACGCGGGC 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1077186769 11:1238986-1239008 ACGCGGGCCTGTGTGTGTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077186769 Original CRISPR ACGCGGGCCTGTGTGTGTCC TGG Exonic
902630697 1:17702765-17702787 ACACAGGTCTGTGAGTGTCCTGG - Intergenic
903034116 1:20483996-20484018 ACGCGGGCCAGTGCGCGCCCTGG - Intronic
903668073 1:25019930-25019952 GTGCAGGCATGTGTGTGTCCGGG - Intergenic
903818009 1:26079313-26079335 GCCAGGGCCTGTGTTTGTCCCGG - Intergenic
905933764 1:41807624-41807646 ACGCAGGCCTGCGTGTCTCTGGG + Intronic
907399676 1:54217150-54217172 ACTCAGGCCTGTGTGGGGCCTGG - Intronic
910217760 1:84859563-84859585 TTGCGTGCCTGTGTGTGTGCTGG - Intronic
911144886 1:94542053-94542075 TCGCGGGCCTGGGTGAATCCGGG - Intergenic
911178446 1:94840780-94840802 ATGCAGGCCTGTGTGTCTTCTGG - Intronic
912262162 1:108121382-108121404 GCGCGGGCCTGGGAGTATCCTGG - Intergenic
915722154 1:157993527-157993549 GCGCGCGCGTGTGTGTGTGCAGG + Intronic
924305916 1:242689456-242689478 ACGCTGGCCTGTGAGTGCCGTGG - Intergenic
1063720544 10:8576436-8576458 ACTGTGCCCTGTGTGTGTCCTGG - Intergenic
1069829216 10:71272321-71272343 ATGCAGGGCTGTGTGTCTCCAGG - Intronic
1073451969 10:103615369-103615391 AGGAGTGCCTGTGTGTGTCTGGG + Intronic
1074163838 10:110857789-110857811 ACGTGTGCGTGTGTGTGTTCAGG - Intergenic
1075469576 10:122678083-122678105 AGTCAGCCCTGTGTGTGTCCTGG + Intergenic
1076342678 10:129760241-129760263 ACACGTGCCTGTGTGTGTGGGGG + Intronic
1076547057 10:131252481-131252503 ATGCAGGCCTGTGTTTGCCCAGG - Intronic
1076921829 10:133458356-133458378 AGTCGGGCCTCGGTGTGTCCTGG - Intergenic
1076943342 10:133625275-133625297 CCGGGGGCCTCTGTGTGCCCAGG - Exonic
1077173647 11:1179207-1179229 AAGTAGGCCTGTGTGTGTCCTGG + Intronic
1077186769 11:1238986-1239008 ACGCGGGCCTGTGTGTGTCCTGG + Exonic
1080609512 11:33891948-33891970 ACAAGGGCCTCTGGGTGTCCTGG - Exonic
1083586542 11:63863863-63863885 AGGCAGGACTGTGTGAGTCCAGG - Intronic
1085655392 11:78309974-78309996 GCGCGCGCCTGTGTGTGTGGTGG + Intronic
1085792478 11:79507954-79507976 AACCGGGCCTCTGTGTGTACTGG - Intergenic
1087046965 11:93850519-93850541 TCGCGGGCCGGGGTGTGTGCTGG + Exonic
1089405522 11:118194264-118194286 ACTCTCTCCTGTGTGTGTCCTGG - Exonic
1089778696 11:120857842-120857864 ACAGGGGGCTGTGTGTTTCCAGG - Intronic
1090791454 11:130093607-130093629 ACACAGGACTGTGTGTGTCCAGG + Intronic
1091288920 11:134426031-134426053 GAGCGGGCATGTGTGTGTGCAGG - Intergenic
1091918597 12:4286911-4286933 ACCCGGGCCTTTGTGGGCCCAGG + Intronic
1099190932 12:79561578-79561600 ACGCGGGCCAGCGTGAGTTCTGG + Intergenic
1099271293 12:80513603-80513625 ACCCGGGCTTGTTTGTGCCCAGG - Intronic
1102046257 12:109832197-109832219 GAGCGGGCCTGTGTGGGGCCCGG - Intronic
1104751684 12:131244273-131244295 ACAGGTGCCTGTGTGTGTCTGGG - Intergenic
1104780210 12:131414802-131414824 ACAGGTGCCTGTGTGTGTCTGGG + Intergenic
1107223223 13:38012294-38012316 ATGCTGGGCTGTGTGTGGCCAGG - Intergenic
1110893794 13:80723772-80723794 ATGTGTGTCTGTGTGTGTCCAGG + Intergenic
1111233681 13:85379406-85379428 ACGATGGCCTGTATGTGTTCAGG + Intergenic
1113707524 13:112444303-112444325 ACGGGGGCCTGTGTGGGGCAAGG - Intergenic
1113850571 13:113415229-113415251 ACGCGGACCTGCCCGTGTCCGGG + Intergenic
1118760540 14:68878264-68878286 CCACGGGCGTGTGTGTATCCGGG - Intronic
1118846570 14:69551854-69551876 ACCCTGGGCTGTGTGAGTCCAGG - Intergenic
1118866099 14:69704837-69704859 CTGTGGGTCTGTGTGTGTCCAGG + Intronic
1119474562 14:74919757-74919779 GGGCGGGCCTGTGGGTGTCGGGG + Intronic
1122721740 14:103726138-103726160 ACGCAGGCCGGTGTGTGCCACGG - Intronic
1125417305 15:39467116-39467138 GCCTGGGCCTCTGTGTGTCCTGG + Intergenic
1128552689 15:68608524-68608546 ACGCGTGCGTGTGTGTGTGTTGG + Intronic
1129478348 15:75803040-75803062 ACGTGGGGCCTTGTGTGTCCTGG + Intergenic
1131107778 15:89746480-89746502 AGGCGGGGCTGTGTGTGTAGAGG - Intergenic
1131126042 15:89857917-89857939 ACCTGGGCATGTGTGTGTTCCGG - Intronic
1132565176 16:619070-619092 ACTCGGCCATGTGTGTGTGCAGG + Intronic
1132747964 16:1444802-1444824 ACGTGGGCCTGGCTGTGTCCGGG - Intergenic
1132851719 16:2027730-2027752 ACGTGTGCCTGTGTGTGTGCAGG + Intronic
1132879809 16:2157100-2157122 TAGGGGGCCTGTGTGTGCCCAGG - Intronic
1136276056 16:29180124-29180146 ACGCGGGCCCGGGTGGGTCGTGG - Intergenic
1140068016 16:71626499-71626521 CCGCGTCCCTGTGTGTGTCCCGG - Exonic
1142277995 16:89133024-89133046 ACGCGGCCCTGGGTGGGCCCTGG + Intronic
1142414257 16:89932906-89932928 ATGAGGGCCTGTGCGTGTCCAGG + Intronic
1143483021 17:7238199-7238221 GCGTGTGCCTGTGTGTGTCTGGG - Intronic
1143586718 17:7854191-7854213 CCGCGCCCCAGTGTGTGTCCGGG + Exonic
1146367571 17:32240974-32240996 ACGCTTGCCTGGGTGTCTCCTGG + Intronic
1146703318 17:34980815-34980837 ACGCGGCCCCGTGGGGGTCCCGG - Intronic
1146913308 17:36661795-36661817 ACGCATGCATGTGTGTGTCTGGG - Intergenic
1147643503 17:42019901-42019923 ACGCGGGCCGCTGGGTGTTCTGG - Intronic
1147676768 17:42211999-42212021 ACAGTGGCCTGTCTGTGTCCTGG - Exonic
1148835126 17:50461900-50461922 ACGGGGGCATGTGTGTGTCAGGG + Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1151030760 17:70735310-70735332 ACGCTGGCCTGCATGTGACCTGG + Intergenic
1151163138 17:72182767-72182789 ACCAGGGCCTGTGTGTGAACAGG - Intergenic
1153984128 18:10338060-10338082 AGGCGTGCCAGTGTGTGCCCTGG + Intergenic
1155517796 18:26640573-26640595 ACACGTGTCTGTGTGTGTCCAGG + Intronic
1161422672 19:4184437-4184459 ACGAGTGCATGTGTGTGTCAGGG - Intronic
1162050113 19:8027827-8027849 AGGAAGGCCAGTGTGTGTCCAGG - Intronic
1162566265 19:11447059-11447081 AGGAGGGCCTGTGTGTGTTGGGG - Exonic
1164039601 19:21483362-21483384 TTGCGGGCCCATGTGTGTCCTGG + Intronic
1166014681 19:39971173-39971195 AAGCCGGCCTCTGTGTGGCCTGG - Exonic
1166203957 19:41256801-41256823 ACGTGGGCCTGTATTTATCCTGG - Intronic
1167045130 19:47045336-47045358 ACTCGGGCCTCGGTGTGGCCGGG - Exonic
1167240345 19:48339574-48339596 ACATGGGCTTGGGTGTGTCCAGG + Intronic
1167448842 19:49555740-49555762 ATGCAGGCCTGAGTGTGTGCGGG - Exonic
925303871 2:2835691-2835713 ACATGGGCCTCTGTGGGTCCTGG + Intergenic
925836020 2:7947710-7947732 ACCCTGGCCTGTGTGACTCCAGG - Intergenic
926131052 2:10303287-10303309 GTGCGCGCGTGTGTGTGTCCGGG + Intronic
927502023 2:23589376-23589398 AGGGCGGCCTGGGTGTGTCCAGG + Intronic
927868391 2:26607785-26607807 ACCTGGGCCAGCGTGTGTCCAGG + Intronic
931429154 2:62195939-62195961 GCGCGGGCCCGGGTGGGTCCTGG + Intergenic
931668676 2:64627639-64627661 ATGCGGGCATGTGTGTCTCCAGG + Intergenic
932581688 2:72996269-72996291 ACGCGGGGCTGTGCCTGTGCTGG - Intronic
937871335 2:126788305-126788327 ATGCTGCCCTGTGTGTGACCTGG - Intergenic
938434240 2:131272917-131272939 CCTGGGGCCTGTGCGTGTCCGGG + Intronic
938434562 2:131274907-131274929 CCTGGGGCCTGTGCGTGTCCGGG + Intronic
946607325 2:221419940-221419962 ATGCGTGCCTGTCTGTGTGCGGG - Exonic
949040929 2:241849707-241849729 AGGAGGGCCTGTGTGTTTCTGGG + Intergenic
1169145735 20:3251203-3251225 ATGCAGGCCTCTGTGTGACCAGG + Exonic
1170604157 20:17863491-17863513 ACATGGGCCTGTGTGTGTGGTGG - Intergenic
1171780719 20:29415438-29415460 CCGGGGGCCTCTGTGTGCCCAGG - Intergenic
1173863692 20:46300471-46300493 ACGCGCGCTTGTGTGTGTGATGG - Intronic
1176106399 20:63391611-63391633 ACATGGCCATGTGTGTGTCCTGG - Intergenic
1176151961 20:63596008-63596030 GCGCTGGCCAGTGGGTGTCCTGG + Intronic
1176229664 20:64025731-64025753 ACATGGGCCTGTGTGTTTCCAGG + Intronic
1179827475 21:43974747-43974769 ACATGGGGCTGTGTGTGTCAGGG + Intronic
1180972000 22:19820633-19820655 ACGGCGGCCAGTGTGTGACCTGG - Exonic
1181494608 22:23280914-23280936 TGTCAGGCCTGTGTGTGTCCTGG - Intronic
1182769764 22:32786260-32786282 ATGCAGGCCTGTGTGCCTCCAGG + Intronic
1182853297 22:33495116-33495138 AAGGAGGCCTCTGTGTGTCCGGG - Intronic
1182894663 22:33849243-33849265 AAGTGGGCCTGTGTGTCTGCTGG - Intronic
1184787427 22:46678552-46678574 CCGCGGGCCTGCGTGTCTGCTGG + Exonic
1184968323 22:47997261-47997283 GGGCTGGCCTGTGAGTGTCCTGG - Intergenic
1185107824 22:48884444-48884466 ACGCAGGCCAGTGTCTGACCAGG + Intergenic
950229119 3:11260562-11260584 ACGAAGGCCTGTGTGTTGCCAGG + Exonic
951078376 3:18424528-18424550 ACGCGGGGCTGTGAGCGTCTGGG + Exonic
954644290 3:52121485-52121507 ACGGGGGCATGTGTGTGTGTTGG + Intronic
957084290 3:75665834-75665856 CCGGGGGCCTCTGTGTGCCCAGG + Exonic
960417072 3:117397840-117397862 ACCCTGGCCTGTGAGTGTGCAGG - Intergenic
966411993 3:179653780-179653802 AAGAAGGGCTGTGTGTGTCCCGG - Intronic
967036815 3:185654260-185654282 ACACGGATCTGAGTGTGTCCAGG + Intronic
967867542 3:194202941-194202963 ACGTGGGCCTGTGTGAGTGTGGG - Intergenic
968518731 4:1025862-1025884 ACGTGTGTGTGTGTGTGTCCAGG - Exonic
968572302 4:1348235-1348257 GCAGGGCCCTGTGTGTGTCCTGG - Intronic
968611970 4:1561303-1561325 ACGTGCTCCGGTGTGTGTCCAGG - Intergenic
971301443 4:25445540-25445562 ACATGGACCTGTATGTGTCCTGG + Intergenic
972441964 4:39103082-39103104 ACTGGGGCCTGTGTATGCCCTGG + Intronic
973608522 4:52611235-52611257 TGGCGGGCCTGTGTGAGCCCAGG - Intronic
978903261 4:113978770-113978792 CCACAGGCCTGTGTCTGTCCTGG - Exonic
982582265 4:157194097-157194119 AAGTGGGCATGTGTGTGTTCAGG - Intergenic
984918073 4:184741244-184741266 TCGCGGGCCAGTGTGTGTTCCGG + Intergenic
985446698 4:190025737-190025759 CCGGGGGCCTCTGTGTGCCCAGG - Exonic
985588095 5:751261-751283 ATGCCTGCCTGTGTGTCTCCCGG - Intronic
985602765 5:843728-843750 ATGCCTGCCTGTGTGTCTCCCGG - Intronic
998388718 5:141773380-141773402 CCAGGGGCCAGTGTGTGTCCAGG + Intergenic
1000337304 5:160251474-160251496 CCGCTGGCCTCTGTGTGCCCAGG + Intergenic
1001543772 5:172557484-172557506 AGTCTGTCCTGTGTGTGTCCTGG + Intergenic
1003522344 6:6868836-6868858 CCTTGGGCCTGTGTGTGCCCGGG + Intergenic
1004348389 6:14869188-14869210 ACGATGGCCAGTCTGTGTCCAGG - Intergenic
1006449392 6:34097451-34097473 GCGCGCGCATGTGTGTATCCAGG + Intronic
1006813450 6:36835842-36835864 CCCAGGGTCTGTGTGTGTCCTGG - Intronic
1006874539 6:37283972-37283994 TCGGAGGGCTGTGTGTGTCCAGG - Intronic
1018086576 6:160306415-160306437 AGGCGAGCCTGGGAGTGTCCAGG - Intergenic
1020139943 7:5606655-5606677 AGGCCGGCCTGTGTGTGTCTTGG + Exonic
1022038063 7:26552707-26552729 GCGCGGGCGTGTGTGTGCACAGG - Intergenic
1029127030 7:98301681-98301703 ACGCGCGTCTGTGTGTGTGGTGG + Intronic
1029538192 7:101167983-101168005 ACGCGCGCGTGTGTGTGTGCTGG + Intergenic
1031483732 7:122305557-122305579 GCGCGCGTCTGTGTGTATCCTGG - Intronic
1033253366 7:139778344-139778366 ACGCGCGCGCGTGTGTGCCCAGG + Exonic
1035374151 7:158396117-158396139 CCGCTGCCCTGTGCGTGTCCCGG - Intronic
1035769736 8:2137510-2137532 CCACGGGTCTGTGTGTGTGCAGG + Intronic
1045535931 8:103027847-103027869 AGGCAGGTCTGTGTGTGTGCAGG - Intronic
1048224966 8:132576327-132576349 ACCCAGGTTTGTGTGTGTCCTGG + Intronic
1049356488 8:142191703-142191725 TGGAGGGCCTGGGTGTGTCCTGG + Intergenic
1049563231 8:143323894-143323916 ACGTGGGCCTGTGTGTGGGGTGG - Intronic
1056842662 9:90010983-90011005 ACGCTGGCCCGTGAGTGCCCCGG - Intergenic
1057282937 9:93725939-93725961 AATCAGACCTGTGTGTGTCCTGG - Intergenic
1058733069 9:107868754-107868776 ACGAGGGCCTCTGTGTATCTCGG + Intergenic
1059187492 9:112288254-112288276 TCCCAGGCCTGTGTGAGTCCTGG + Intronic
1188784608 X:34329888-34329910 ACGCATGCATGTGTGTGTGCAGG - Intergenic
1191224266 X:58025554-58025576 ACATGGGCCTGTGTGGCTCCTGG + Intergenic