ID: 1077187283

View in Genome Browser
Species Human (GRCh38)
Location 11:1240969-1240991
Sequence CCTGAGGCAGAGAGGGTACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 318}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077187271_1077187283 25 Left 1077187271 11:1240921-1240943 CCGCCCAGAGCCCGGCCTGGGAG 0: 1
1: 0
2: 3
3: 34
4: 385
Right 1077187283 11:1240969-1240991 CCTGAGGCAGAGAGGGTACCAGG 0: 1
1: 1
2: 1
3: 32
4: 318
1077187278_1077187283 10 Left 1077187278 11:1240936-1240958 CCTGGGAGGCGGAGACTTTGAGA 0: 1
1: 0
2: 1
3: 19
4: 302
Right 1077187283 11:1240969-1240991 CCTGAGGCAGAGAGGGTACCAGG 0: 1
1: 1
2: 1
3: 32
4: 318
1077187276_1077187283 15 Left 1077187276 11:1240931-1240953 CCCGGCCTGGGAGGCGGAGACTT 0: 1
1: 0
2: 0
3: 17
4: 258
Right 1077187283 11:1240969-1240991 CCTGAGGCAGAGAGGGTACCAGG 0: 1
1: 1
2: 1
3: 32
4: 318
1077187277_1077187283 14 Left 1077187277 11:1240932-1240954 CCGGCCTGGGAGGCGGAGACTTT 0: 1
1: 0
2: 4
3: 103
4: 1028
Right 1077187283 11:1240969-1240991 CCTGAGGCAGAGAGGGTACCAGG 0: 1
1: 1
2: 1
3: 32
4: 318
1077187274_1077187283 21 Left 1077187274 11:1240925-1240947 CCAGAGCCCGGCCTGGGAGGCGG 0: 1
1: 0
2: 3
3: 51
4: 389
Right 1077187283 11:1240969-1240991 CCTGAGGCAGAGAGGGTACCAGG 0: 1
1: 1
2: 1
3: 32
4: 318
1077187273_1077187283 22 Left 1077187273 11:1240924-1240946 CCCAGAGCCCGGCCTGGGAGGCG 0: 1
1: 0
2: 0
3: 21
4: 262
Right 1077187283 11:1240969-1240991 CCTGAGGCAGAGAGGGTACCAGG 0: 1
1: 1
2: 1
3: 32
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077187283 Original CRISPR CCTGAGGCAGAGAGGGTACC AGG Exonic
900423367 1:2565208-2565230 CCTGGGGCTGAGTGAGTACCGGG - Intronic
901326097 1:8366027-8366049 ACTGTGGCAGAGAGGGTGCGTGG - Intronic
901637986 1:10679278-10679300 CCTGAGGCAGACAGGTCTCCTGG + Intronic
902410223 1:16207841-16207863 CCTGAGGCCGTCAGGGTGCCTGG - Intronic
902788297 1:18747168-18747190 CCTGAGTCACAGAGGGTGTCAGG - Intronic
902818347 1:18928660-18928682 CCTGTGGAAGAGCGGGTACTGGG + Intronic
903020596 1:20391136-20391158 CCTGGGGCAGTGAGGGGGCCAGG - Intergenic
903842709 1:26255629-26255651 CCTGAGGCCAAGAAGGCACCGGG + Exonic
904287761 1:29462938-29462960 CAGGAGACAGAGAGGCTACCGGG - Intergenic
905305480 1:37015072-37015094 CTTGATGCAGAGATGGGACCAGG - Intronic
905548060 1:38815950-38815972 CCTGAGGCTTAGGAGGTACCAGG - Intergenic
905874431 1:41423122-41423144 TCTGTGGCAGAGGGGGTCCCTGG + Intergenic
907320585 1:53599722-53599744 CCTGGGGCAGAGATGGTATGTGG + Intronic
907491111 1:54809390-54809412 CCTTAGGGAGAGGGGATACCTGG + Intronic
908461184 1:64349719-64349741 CCTGGGGCAGAGATGGTGCCTGG + Intergenic
909571312 1:77114926-77114948 CCTGAGGCAGACAGAGTGCTAGG + Intronic
913558678 1:119996455-119996477 CCAAAGTCAGAGAGGGTACATGG + Intronic
913639165 1:120794016-120794038 CCAAAGTCAGAGAGGGTACATGG - Intergenic
914279285 1:146155942-146155964 CCAAAGTCAGAGAGGGTACATGG + Intronic
914540329 1:148606872-148606894 CCAAAGTCAGAGAGGGTACATGG + Intronic
914626315 1:149464342-149464364 CCAAAGTCAGAGAGGGTACATGG - Intergenic
916405391 1:164492992-164493014 CCTGAAGGTGAGAGGGTACATGG - Intergenic
919768816 1:201144225-201144247 CCTGATGCCGAGAGGCTCCCGGG + Intronic
920506956 1:206521923-206521945 CCTGGGGCCGAGAGGGTATCTGG + Intronic
921219401 1:212962450-212962472 CCTGAGGCAGAAAGGATTTCAGG + Intronic
921848282 1:219907008-219907030 TCTGAGGCAGATAGGAGACCTGG + Intronic
922316428 1:224446893-224446915 CCTGAGGGAGGGAGGGTAGATGG + Intronic
924126986 1:240865233-240865255 CCTGGGGCAGAGTGGGAAGCAGG - Intronic
924609502 1:245562178-245562200 GCTGAGGCAGAGAGGGACCTGGG + Intronic
924645525 1:245873859-245873881 CCAGTGGCAGAGCTGGTACCAGG - Intronic
1062863075 10:825260-825282 CCTAGTGCAGAGAGGGGACCTGG - Exonic
1062961982 10:1579063-1579085 ACTGAGGCAGTGTGGGCACCTGG - Intronic
1065261273 10:23926053-23926075 ACTGAGGCAGAGACTGCACCTGG + Intronic
1065537910 10:26732604-26732626 ACTGAGACACAGACGGTACCAGG - Intronic
1065741795 10:28803530-28803552 TCTGATGCAGAGAGGGGTCCTGG - Intergenic
1065796230 10:29310968-29310990 CCTGAGGATGAGAGGGAAGCAGG - Exonic
1067219341 10:44332585-44332607 ATTCAGGCAGAGAGGGGACCAGG + Intergenic
1067232574 10:44422465-44422487 CCTGAGGCACAGAAGTCACCTGG - Intergenic
1067558513 10:47288462-47288484 CCTGAGTCAGAGGGGCTCCCAGG + Intergenic
1067700798 10:48570490-48570512 CCTGGGGCAGAGAGGGTCTGAGG + Intronic
1069868589 10:71519391-71519413 CCTGATGGAGGGAGGGTACAGGG + Intronic
1071486039 10:86103415-86103437 GCTGAGGCTGAGAGGGTGGCAGG - Intronic
1071797315 10:89020643-89020665 CCTGAGGCAGAACAGGAACCAGG - Intergenic
1072439076 10:95438149-95438171 ACTGAGGCAGAGAGGATTCCAGG + Intronic
1074184239 10:111087172-111087194 CCTGAGGGAGTGAGGGCTCCTGG - Intergenic
1074446078 10:113522054-113522076 TCTGATGCAGAGAGAGAACCGGG + Intergenic
1075002003 10:118805482-118805504 CCTAAGGGAGAGAGGCCACCAGG + Intergenic
1076778691 10:132711886-132711908 CCAGAGGCTCAGAGGGTACCAGG - Intronic
1076986693 11:241806-241828 CCTGGGGCAGAGAGGACAGCAGG - Intronic
1077187283 11:1240969-1240991 CCTGAGGCAGAGAGGGTACCAGG + Exonic
1077423243 11:2462750-2462772 CCACAGGCAAAGAGGGTGCCGGG + Intronic
1078338604 11:10483336-10483358 CCAGAGGCAGCCAGGGTCCCAGG - Intronic
1080288209 11:30640756-30640778 CCTGAGACAGAGAGGGTTAAAGG + Intergenic
1080549635 11:33361259-33361281 TCTGAGGCAGAAAAGGTACAAGG - Intergenic
1081688384 11:45058356-45058378 CCTGGGGCAGAGAGGTAACTTGG + Intergenic
1083489795 11:63007868-63007890 CCTGAGGCTCAGAGGGTAAGTGG + Intronic
1083901196 11:65644338-65644360 CCTATGGCTGAGAGGGTACCAGG + Intronic
1084209481 11:67614472-67614494 CCGGAGGCAGTGAGGGTGACTGG - Intergenic
1084330462 11:68426976-68426998 GCTGAGGCAGAGAGGGCCACGGG - Intronic
1084870882 11:72097914-72097936 CCTGAGACAGAGAGGGGCCGGGG + Exonic
1085025348 11:73233211-73233233 CCTGAGCCTGTGAGGCTACCAGG - Intronic
1085308152 11:75500107-75500129 CCAGGGGCAGGGAGGGTGCCTGG - Intronic
1087354914 11:97080563-97080585 CCTGATCCAGAGAGAGTAGCTGG + Intergenic
1087550605 11:99642755-99642777 CCAGAGGCTGAGAGGGTAGAGGG - Intronic
1088921168 11:114260657-114260679 CCTGAGGCAGAGCTGGGCCCTGG + Intronic
1089066354 11:115665133-115665155 TCTGAGGCAAAGAGGGAATCAGG + Intergenic
1089444979 11:118544768-118544790 CCTCTGGCAGAGAGGGCAGCAGG + Exonic
1089529245 11:119116003-119116025 GCTGAGGCAGAGAGGGGCACGGG - Intronic
1089617296 11:119702059-119702081 GCTGGGGCAGACAGGGTCCCAGG + Intronic
1089670224 11:120051689-120051711 GGTGAGGCAGAGAGGGAACAGGG - Intergenic
1089974062 11:122717315-122717337 TCAGGGGCAGAGAGGGAACCTGG - Intronic
1090037946 11:123264910-123264932 CCTGCGCCAGAGATGATACCAGG + Intergenic
1090702373 11:129308343-129308365 CCTGAGACAGTGAGAATACCAGG + Intergenic
1090791615 11:130094829-130094851 GCCGAGGCAGAGAGAGTAACTGG + Intronic
1091590362 12:1839094-1839116 CCTGCCTCAGAGAGGGCACCAGG - Intronic
1091980433 12:4860111-4860133 CCTGAGGAAGAGAGGGTATCAGG + Intergenic
1094389036 12:29928948-29928970 CTGGAGGCAGAGTGGGCACCTGG - Intergenic
1096072133 12:48781328-48781350 CCTGAGGCAGGGTGGGCAACAGG + Intronic
1096772563 12:53945382-53945404 CCGGAGGCAGAGAGGCTCCATGG + Exonic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1100618509 12:96249937-96249959 CCTTAGGCAGTGAGGGTGCCTGG + Intronic
1102228810 12:111248276-111248298 ACTGAGGCACAGAGTGTTCCAGG + Intronic
1102458547 12:113086338-113086360 CCTGAGGCAGAGTGGGTCTGGGG + Intronic
1102705409 12:114876172-114876194 CCTGAGGCAGAGATGGAGCCGGG + Intergenic
1103318905 12:120078994-120079016 CCCGAGGCAGACAAGGCACCAGG - Intronic
1103344187 12:120238393-120238415 CATGCAGCAGAGAGGGTTCCAGG + Intronic
1103348074 12:120264689-120264711 CCTGACGCAGAGAGGGTGGAGGG + Intronic
1103557862 12:121776630-121776652 CGGGAGGCAGAGAGGCCACCAGG + Exonic
1103878679 12:124149232-124149254 CCTGAGCCAGAGAGTGTAAGGGG + Intronic
1104724275 12:131066472-131066494 CCTGCGGTAGGGAGGGTACAGGG - Intronic
1104994983 12:132648751-132648773 CCTGGGGCAGAGCGAGTGCCGGG - Intronic
1105365329 13:19758916-19758938 ACTGGGGCAGGGAGGGTACTAGG - Intronic
1105853338 13:24355081-24355103 CCACAGGCAGAGAGAGAACCTGG - Intergenic
1107577592 13:41744026-41744048 CCTGAGGGAGAAAGGGAAGCAGG - Intronic
1108303944 13:49111749-49111771 CCTGAGGCAGAAATTGTACATGG - Intronic
1111825087 13:93257678-93257700 ACTGAGGCAGAGAGGAAACTGGG + Intronic
1111998931 13:95192316-95192338 CCTGCGGCTGAGAGGGTGCTGGG - Intronic
1112239115 13:97663660-97663682 CTTCAGGCAGAGAGGGTAATGGG + Intergenic
1112900254 13:104349894-104349916 CCTGAGTCAGTGTGGGTAGCAGG - Intergenic
1113839003 13:113347937-113347959 TCTGAGGCCGAGAGCGGACCCGG + Intronic
1113955554 13:114098481-114098503 CCTGAGGCAGAGACGTGAACAGG + Intronic
1115264669 14:31488588-31488610 GTTGAGGCAGAGTGGGTGCCTGG - Intergenic
1116040260 14:39677798-39677820 GCTGAGTCACAGAGGGCACCAGG - Intergenic
1116418281 14:44704730-44704752 CCTGGGGCAGAGAGGGCCTCTGG + Intergenic
1116861632 14:50000321-50000343 CCTGAGGCAGTGAGTGTTCGGGG + Intronic
1118310061 14:64685571-64685593 CATGAGGCATGGAGGGTGCCAGG + Intergenic
1118915002 14:70095413-70095435 ACTGAGGCACAGAAGGAACCTGG - Intronic
1121449118 14:93996546-93996568 CCTGAGCCAGAGTGGGGGCCAGG - Intergenic
1121455487 14:94036188-94036210 GATGAGGCTGAGAGGCTACCAGG + Intronic
1122812314 14:104295163-104295185 CCGGAGGGAGACAGGGTGCCAGG + Intergenic
1122842095 14:104470977-104470999 CCACAGGCAGAGAGAGAACCTGG - Intergenic
1123714724 15:23019334-23019356 CCTGAGGCAGAGAGTGTGCACGG + Exonic
1124368550 15:29090555-29090577 CCTGGGGCTGACAGGGTGCCAGG + Intronic
1128506340 15:68275660-68275682 ACTGAGGTAGAGAGGGCACGAGG + Intergenic
1128786917 15:70404354-70404376 CCTGAGGCACAGATGGATCCAGG - Intergenic
1129522452 15:76194448-76194470 CCTGAGGGACACAGGGAACCAGG - Intronic
1130148250 15:81292005-81292027 CCTGTGGCAGGGAGGGGAGCAGG + Intronic
1130652746 15:85771573-85771595 GCTTAGGCAGAGAGGGCACAGGG + Intronic
1131716222 15:95113723-95113745 ACTGAGGCTGAGTTGGTACCCGG - Intergenic
1132947032 16:2537667-2537689 ACTGAGGCTCAGAGGGGACCAGG - Intergenic
1132968656 16:2673725-2673747 ACTGAGGCTCAGAGGGGACCTGG + Intergenic
1133049166 16:3106845-3106867 CCGGAGGCAGGGAGGCGACCCGG - Intergenic
1133138120 16:3726200-3726222 TCTGAGGCAGAGAGTGCTCCAGG - Exonic
1133317493 16:4893498-4893520 CCTGAGGCTCTGGGGGTACCGGG - Intronic
1133685751 16:8163953-8163975 ACTGGGGCACAGAGTGTACCGGG + Intergenic
1134841371 16:17404575-17404597 CCTAAGACAGAGAGGCTTCCTGG - Intronic
1134867432 16:17620733-17620755 CCTGTGGCAGAGAGGGATGCTGG - Intergenic
1138375458 16:56560704-56560726 CCAAAGGCAGAGAGGGAACAGGG + Intergenic
1139088716 16:63618259-63618281 CAGGAGGCAGAGAGGCTCCCGGG - Intergenic
1139422875 16:66859713-66859735 CCTGAGGCTTAGAGAGCACCAGG + Intronic
1139466145 16:67155156-67155178 CCTCCGACAGAGAGGGCACCGGG + Exonic
1139955636 16:70691740-70691762 CCTGGGGCAGAGAGCCTATCAGG + Intronic
1140954488 16:79849411-79849433 GCTGGGGCGGAGAGGCTACCTGG + Intergenic
1141726781 16:85794900-85794922 CCTGAGCGTGAGAGGGCACCGGG - Intronic
1142146312 16:88494343-88494365 CCTGGTGCTGAGAGGGTAACGGG - Intronic
1143795100 17:9329955-9329977 CCTGAGGCAGAGGGTGCAGCTGG + Intronic
1143855330 17:9844004-9844026 ACTGATGCAGACAGGGGACCAGG + Intronic
1144387558 17:14763558-14763580 ACGGGGGCAGAGTGGGTACCAGG - Intergenic
1144760458 17:17704168-17704190 CCTGAGGCAGAGGCTGTCCCTGG + Intronic
1146018963 17:29259141-29259163 CCTGAGGAAAAAAGGGTACATGG + Exonic
1146656060 17:34635985-34636007 CCTGAGGCAGAGCGGGACCGGGG - Exonic
1147219127 17:38918370-38918392 CCAGAGGCAGAGCAGGGACCGGG - Intronic
1147322981 17:39657115-39657137 CCGGAGGCAGAGAGGGAGCAGGG + Intronic
1147998969 17:44376565-44376587 TCTGAGGAAGAAAGGGAACCAGG + Intronic
1148108383 17:45131441-45131463 CCAGACTCTGAGAGGGTACCAGG + Intronic
1149453689 17:56770253-56770275 TCTGAGGCAGAGAGAGGGCCAGG - Intergenic
1150006034 17:61469583-61469605 CCTGGGTCTGAGACGGTACCTGG - Intronic
1151507666 17:74540175-74540197 CCTGAGGCAGAGAGAGCAGCAGG - Intergenic
1151509216 17:74548002-74548024 CCTGAGGCAGAGAGAGGAGCAGG - Intergenic
1152062367 17:78087122-78087144 CATCAGGTAGAGAGGGTACCTGG + Intronic
1152425105 17:80214427-80214449 ACTGAGGCAGTGAGGGTCACAGG - Intronic
1152699495 17:81812008-81812030 CCTGAGGCAGGGAGGGGCCGGGG + Intronic
1155108364 18:22689254-22689276 CTGGAGGCAGAGAGGGAAGCTGG + Intergenic
1156163358 18:34386864-34386886 CTTTAGACAGAGAGGGTACATGG - Intergenic
1157429788 18:47615266-47615288 CCTGAGGCACAGAGGGAGCAAGG + Intergenic
1157482291 18:48063163-48063185 CCTGAGACAGAGGGGGTTTCTGG - Intronic
1157596602 18:48867899-48867921 CCTGAAGCAGAGATGGTTCAAGG + Intergenic
1158304366 18:56088580-56088602 TTTGAGGCAGAGAAAGTACCTGG - Intergenic
1160845171 19:1163081-1163103 CCAGGGACAGAGAGGGCACCGGG + Intronic
1161293718 19:3508910-3508932 CCGGAGGCGGAGCGGGGACCAGG - Intronic
1161299298 19:3535144-3535166 ACGGAGGCAGTGAGGGTCCCAGG - Intronic
1162919187 19:13890170-13890192 CCTGAGACAGACAGGGTTCCAGG - Exonic
1163408991 19:17141637-17141659 CTTGAGGCAGGGAAGGTGCCTGG - Intronic
1164854851 19:31512823-31512845 CCAGGTGCAGAGAGGGTACTGGG + Intergenic
1165112173 19:33508866-33508888 CATGAGGCAGGGATGGTTCCAGG - Intronic
1165281632 19:34803065-34803087 CCTGGGGCGGAGAGGTCACCTGG + Intergenic
1165311856 19:35033349-35033371 CCTCAGGCAGGGAGGGCACAGGG - Intronic
1165484296 19:36086169-36086191 CCTGAGGCAGAGGGGAGATCAGG - Intronic
1167117721 19:47497886-47497908 CCTGGGGCAGAGAAGCGACCTGG - Intronic
1167168178 19:47813567-47813589 CAAGGGGCAGAGAGGGCACCTGG - Intronic
1168634496 19:57985235-57985257 ACTGAGCCAGAGATGGGACCGGG - Intronic
1168643470 19:58045039-58045061 CCGGGGGCAGAGAGGGTGCTGGG + Intronic
925755025 2:7124941-7124963 CCTGAGGCAGAGAGGTAGCCAGG + Intergenic
926156595 2:10458321-10458343 CCTGGGGCAGAGAGCGCCCCTGG + Intergenic
926212422 2:10880603-10880625 CATGAGGCAGACAGAGTTCCTGG - Intergenic
927592561 2:24369384-24369406 GGTGAGACAGAGAGGGTCCCTGG - Intergenic
932141973 2:69287055-69287077 CCAGAGGCACAGAGGGTTCCTGG + Intergenic
935526176 2:104170684-104170706 TCTGAGGCCAAGTGGGTACCTGG + Intergenic
936574674 2:113642983-113643005 CCTGAAACAGAGTGGGTACACGG - Exonic
936838826 2:116743535-116743557 CCTAAAGCAGAGAGGGTTCTTGG - Intergenic
937998139 2:127710639-127710661 GCTGAGGCAGAGAGGGTACCAGG + Intronic
938425447 2:131182625-131182647 CTTGACGCAGAAAAGGTACCTGG + Intronic
938841458 2:135168830-135168852 CCTGAGGGAGGGAAGGTACCAGG + Exonic
940854938 2:158722550-158722572 TCTGAGGCAGAAAGGGAAGCAGG + Intergenic
942058316 2:172205612-172205634 CCTGAGGCTGAGAGGGGGGCAGG + Intergenic
942192227 2:173481580-173481602 CATGAGGCAGAGAGGAGACAAGG + Intergenic
943319666 2:186432110-186432132 CCAGATGCAGACAGGGCACCTGG + Intergenic
945420138 2:209625554-209625576 CATGAGGCAGAGAGAGAAGCAGG + Intronic
946383143 2:219362808-219362830 CCTGAGAGAGAGAGAGAACCAGG + Intergenic
948004078 2:234592840-234592862 CCTAAGCCAGAGAGGGCTCCTGG + Intergenic
949034155 2:241808911-241808933 CCTGATGCTCAGAGGGTAACTGG - Intronic
1169187580 20:3631659-3631681 CCTGAGGCATAGAGGGAAGCAGG + Intronic
1170327781 20:15176019-15176041 TCTGCAGCAGAGAGGGTACTGGG - Intronic
1170818927 20:19739583-19739605 CCAGAGGCAGATAGGGGAGCGGG + Intergenic
1171361228 20:24587688-24587710 ACTGCGGCAGAGAGGGCTCCGGG - Intronic
1172228755 20:33323054-33323076 ACAGAGGCAGAGAGAGAACCAGG + Intergenic
1172267529 20:33629697-33629719 CCTGAGTCACAGAGGGGGCCAGG - Exonic
1173896921 20:46558283-46558305 CCTGAGGCAGAGTATGTAGCTGG + Exonic
1174307927 20:49627792-49627814 ACTGTGGCATCGAGGGTACCAGG + Intergenic
1175222907 20:57427578-57427600 CCTGAGGCAGGGACGCTGCCTGG - Intergenic
1175517863 20:59580133-59580155 GCTGAGGCAGAGAGTGTGGCTGG + Intronic
1175527679 20:59646748-59646770 CCTGAGGCAGGGAGGGTGCTGGG + Intronic
1175693063 20:61079894-61079916 GCTGAGGGAAAGAGGGTACAGGG + Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175863543 20:62162928-62162950 GCAGAGGCAGAGTAGGTACCTGG - Exonic
1176185528 20:63776257-63776279 CCTGGAGCAGAGCAGGTACCAGG - Intronic
1181333438 22:22112256-22112278 CCTGAGCCAGAGTTGGTCCCAGG - Intergenic
1181372880 22:22432002-22432024 GGTGAGGAAGAGAGGGGACCAGG - Intergenic
1181939699 22:26465586-26465608 CCTGAGCCAGAGAGGGCAGCGGG + Intronic
1182951177 22:34377334-34377356 CCTGGGCCAAAGAAGGTACCTGG - Intergenic
1183086920 22:35492130-35492152 CCTGAGGCAGGGAGCACACCTGG - Intergenic
1183380298 22:37487308-37487330 CCTGGGCCAGCGAGGGTCCCAGG - Intergenic
1183430316 22:37761874-37761896 CCTGAGGCAGAGAAGGGAGCTGG + Intronic
1183688712 22:39376276-39376298 CCAGAGGCAGAGCGGGTCCCAGG - Intronic
1183946195 22:41327149-41327171 CCTGGGGGAGGGAGGGTAACAGG + Intronic
1183960828 22:41410979-41411001 CCTGGGGCAGAGAGGCTGCCAGG + Intergenic
1184118611 22:42436372-42436394 ACTGAGGCAAAAAGGGTTCCAGG + Intergenic
1184339810 22:43880096-43880118 CCTGGGGCAGAGAGGATGCCAGG - Exonic
1184459245 22:44627852-44627874 CCTGAGGCAGGGAGGAGACAGGG + Intergenic
1185009175 22:48303572-48303594 CATGAGGCAGGGAGGGGACGGGG + Intergenic
1185041832 22:48508096-48508118 CCTGAGGCAGAGCCAGTACGTGG + Intronic
1185045282 22:48525556-48525578 GCTGAGGCAGAGGGTGGACCTGG - Intronic
1185274202 22:49943358-49943380 CCACAGGCCGAGAGGGTCCCAGG + Intergenic
950239599 3:11356911-11356933 CCTGAGGCAGAAAGGATTTCAGG - Intronic
952884767 3:38005770-38005792 TCTGAGCCACAGAGGGGACCTGG - Exonic
954073362 3:48159138-48159160 CCCTAGGCAGAGAGGAAACCAGG - Intronic
954426538 3:50446364-50446386 ACTGAGGCACAGAGAGTAACTGG + Intronic
954497845 3:50982602-50982624 GCTGCTGCAGAGAGGGTACAGGG + Intronic
956387372 3:68734412-68734434 GCTGAGGCAGGGAGGGTAGAGGG + Intronic
956686190 3:71830381-71830403 CCAGAGACAGAGGGGGTTCCTGG + Intergenic
957636330 3:82790653-82790675 CAGGAGGCAGACAGGGTTCCTGG + Intergenic
959444982 3:106427765-106427787 CCAGAGGCAGAGTGGGCTCCTGG - Intergenic
963068361 3:141281646-141281668 CCTGGGGCAGGGAGGGGACATGG + Intronic
963863124 3:150330946-150330968 CCTGAAGCAGAGACAGCACCAGG - Intergenic
963948471 3:151171722-151171744 CCTGTGGCACAGAGTGTCCCAGG + Intronic
964495381 3:157283911-157283933 CCTGAGGCTGATAGGGCAGCTGG + Intronic
964707245 3:159632429-159632451 CCTGAGGGAGAGGGAGTCCCAGG - Intronic
964873743 3:161342306-161342328 CCTGAGCCAGAGAAAGTACCTGG - Intergenic
965115033 3:164477732-164477754 CATGAGGCAGAGAGGCTCCTGGG + Intergenic
966596051 3:181725753-181725775 CCTGAGAAAGAGAGTGGACCGGG - Intergenic
967099133 3:186201417-186201439 CATGTGGCAGTGAGGGTGCCAGG - Intronic
967394933 3:188997535-188997557 CCAGAGGCTGAGAGGGTTACTGG + Intronic
967717751 3:192782709-192782731 TCTGAGGCAGAGAGAATTCCTGG + Intergenic
968068922 3:195773999-195774021 CCTGAGGAACACAGGGTGCCAGG - Intronic
968426452 4:526589-526611 GCTGACCCCGAGAGGGTACCAGG + Intronic
969722234 4:8898475-8898497 CCTGAGGCAGGAAAGGTAACAGG + Intergenic
971650953 4:29273543-29273565 GCGGAGGCAGAGAGGGGACATGG - Intergenic
977615205 4:99080675-99080697 TTTGACACAGAGAGGGTACCTGG - Intronic
978490374 4:109305280-109305302 CTTGATGCAGAGAGTCTACCAGG - Intergenic
979181349 4:117731920-117731942 CCTGAGTGACAGAGGTTACCTGG - Intergenic
985621700 5:959477-959499 ACTGAGGCACAGGGGGCACCCGG - Intergenic
985701805 5:1378051-1378073 ACTGAGGCAGGGAGGGTTCCCGG - Intergenic
985829073 5:2214495-2214517 CCTGAAGGAGAGAGGGCACATGG - Intergenic
986468222 5:8048330-8048352 ACTGAGGAAGCCAGGGTACCAGG - Intergenic
986486476 5:8243255-8243277 CCTGAAGAAGAGAGAGGACCTGG + Intergenic
987172142 5:15270085-15270107 CCTGATGCAGAGAGGCTGCATGG - Intergenic
988271483 5:29023186-29023208 CCTAAGGCAGAGTAGGTAGCTGG - Intergenic
989526366 5:42457895-42457917 ACTGAGGCAGAGAGGCTAGTAGG - Intronic
992622299 5:78606082-78606104 CCTAAGGCAGAGTGGGCACTTGG - Intronic
992693254 5:79259964-79259986 CCTGAGGCAGAGGTGGGCCCAGG - Intronic
996597760 5:125225512-125225534 CCTGTGCCAGTGAGGGGACCTGG - Intergenic
996767174 5:127046228-127046250 CCTGAGGCAGAGAATGTAAGAGG - Exonic
997251000 5:132388538-132388560 TCTGGGTCAGAGAGAGTACCTGG - Intronic
997531591 5:134584768-134584790 CCTGGGGCTGAGGGGGTATCTGG + Intergenic
997593825 5:135092860-135092882 CCTGAGGCAGTGAGGCCCCCAGG - Intronic
998399452 5:141841012-141841034 CCAGAGGCAGCGAGGGCACTTGG - Intergenic
999199364 5:149805004-149805026 CTGGAGGCAGAGCGGATACCAGG - Intronic
999483023 5:151966249-151966271 CCTGAGGAAGGGAAGGTACTTGG + Intergenic
1001385500 5:171335462-171335484 CCTGAGGCAAAGATGCCACCTGG - Intergenic
1001435713 5:171697673-171697695 CCTGAGTGAGAGGGGGTCCCAGG - Intergenic
1001784389 5:174399486-174399508 CAAGAGGCAGAGAGGGTCCCAGG + Intergenic
1003115736 6:3282874-3282896 CCAGGGGCAGAGACGGCACCAGG + Intronic
1003175989 6:3752253-3752275 CCTGAGGCACGGAGGGAACCCGG - Intergenic
1003489775 6:6611350-6611372 ACTGAGGCAGAGAGGGTTTATGG - Intronic
1004504684 6:16238499-16238521 CCTGAGGCGGAGGCGGTGCCCGG + Intergenic
1005943397 6:30578211-30578233 CCTGAGGGGGAATGGGTACCTGG + Intronic
1006166485 6:32068506-32068528 CCCAAGGCAGTGAGGGTGCCAGG - Intronic
1006309785 6:33249548-33249570 CCTGAGGCTGAGAGTGGATCCGG - Intergenic
1007014149 6:38446372-38446394 TCTGATGCAGAGAGGGGTCCCGG + Intronic
1007485162 6:42175821-42175843 CTGGGGGCAGAGAGGGTCCCAGG - Intronic
1011541199 6:88432117-88432139 GCAGAGGCAGAGAGGGGACTAGG - Intergenic
1013415943 6:109924573-109924595 GCTGAGGCAGAGAGGGAACTGGG + Intergenic
1013847259 6:114467981-114468003 CCTCAGGGAAATAGGGTACCGGG + Intergenic
1014640097 6:123898884-123898906 ACAGAGGCAGAGAGGCTAACAGG - Intronic
1014797927 6:125747892-125747914 CCTGAGGCCGACAGGGGAGCTGG + Intronic
1015283657 6:131460454-131460476 CCTGAGACAGTGAGGGAACCAGG - Intergenic
1017021343 6:150142898-150142920 CCTGCGGCAGAGAGGGCCCGGGG - Intergenic
1017496761 6:154990327-154990349 GCTGAGGCAGAGAGTTTACGTGG + Intronic
1018328668 6:162704078-162704100 ACTGAGGCTCAGCGGGTACCAGG - Intronic
1018619877 6:165719871-165719893 CCTGAGCCAAATAGGGTACTTGG - Intronic
1018986722 6:168643419-168643441 CCTGAGGCCCTGAGGATACCAGG - Intronic
1024053334 7:45643892-45643914 CCTGAGGCAGGGAGGCTTCCGGG + Intronic
1024241276 7:47438485-47438507 CCTGAGGAGGAGAGGGCCCCTGG + Intronic
1026363461 7:69624673-69624695 CATGAGGCAGAGAGGGGAAAGGG - Intronic
1026481593 7:70784362-70784384 CCTGAGCCAGAGATGATAACGGG + Intronic
1026493719 7:70885002-70885024 GCTGAGGAAGAGAGGTGACCAGG + Intergenic
1027978375 7:85186515-85186537 CCTGAGACAGAGAAGGCTCCCGG - Intronic
1029991662 7:104967873-104967895 TCTGAGGCAGAGAGGATATATGG + Intergenic
1030077147 7:105746487-105746509 CTCTAGGCAGAGAGGGCACCAGG - Intronic
1033269327 7:139916540-139916562 CCTGGGGCAGCCAGGGTGCCGGG - Intronic
1034098924 7:148435482-148435504 AGGGAGGCAGAGAGGGTGCCTGG - Intergenic
1034911168 7:155000095-155000117 TCTGCTGCAGAGAGGGGACCTGG - Intronic
1035531579 8:356398-356420 CTAGAGGCACAGAGGCTACCTGG + Intergenic
1036743858 8:11390326-11390348 CCTGAGGCTGTGAGCGCACCTGG - Intergenic
1036915474 8:12799807-12799829 CAGGAGGCAGAGAGGCTTCCGGG - Intergenic
1037782697 8:21881637-21881659 CCTGTGACAGAGAGGACACCTGG + Intergenic
1037937877 8:22927538-22927560 CGGGAGGCACAGAGGCTACCAGG - Intronic
1038402681 8:27297395-27297417 CTGGAGGAAGAGAGGGTGCCAGG + Intronic
1038660156 8:29490207-29490229 CTTGAGGCTGAGAGGGAATCAGG - Intergenic
1039800274 8:40948590-40948612 CCTGAGGGAGAGAGGGAATGGGG + Intergenic
1040752355 8:50726434-50726456 CCTCAGGCAGAGTGGGCAACAGG + Intronic
1042490626 8:69393675-69393697 CCTCTGGCTGAGAGGGTTCCTGG - Intergenic
1042760233 8:72264609-72264631 TCTGTGGCAGAGAGGGGTCCTGG + Intergenic
1043621368 8:82197010-82197032 CGTGAGACAGAAAGGGCACCAGG + Intergenic
1044475527 8:92620942-92620964 CCTGAGACAGAGAGCCTAGCAGG - Intergenic
1044926223 8:97210786-97210808 GCTGAGCCAGAGAGGCTTCCTGG + Intergenic
1045062383 8:98421359-98421381 CCTGAGGCTGAGAGGGGCCCTGG + Intronic
1045484673 8:102621766-102621788 TCTGAGGCAGTGAGGGTTTCGGG + Intergenic
1046139922 8:110078142-110078164 ACTGATGCAGAGAGGCTTCCTGG + Intergenic
1047550905 8:125871260-125871282 CCTGAGGCAGAGATGGGATAGGG + Intergenic
1048333820 8:133488948-133488970 CCAGAGGGAGAGAGGGAACTGGG + Intronic
1049059247 8:140263361-140263383 CCTGAAGCACAGTGGGTACTGGG + Intronic
1049187391 8:141264410-141264432 CGGGAGGCAGAGAGGCTGCCGGG + Intronic
1052733971 9:32321254-32321276 CCAGAGGCTGGGAGGGTAGCTGG + Intergenic
1052965505 9:34337735-34337757 GCTGATGCAGAGAGGGCAGCTGG - Intronic
1056096838 9:83263211-83263233 CCAGAGTCAGAGAGGATTCCAGG - Intronic
1057201389 9:93142184-93142206 CCTGTGGCAGGGAGGGGACAGGG + Intergenic
1059275777 9:113095859-113095881 CCTGAGGGAGAGAGGATTCAGGG - Intergenic
1059391414 9:114001874-114001896 CCAGGGGCAGAGATGGTCCCTGG - Intronic
1059400953 9:114070588-114070610 CCTGAGGCAGAGCTGGGCCCAGG + Intronic
1060015425 9:120082469-120082491 CATGAGTCAGAGAGGCTTCCTGG - Intergenic
1060150261 9:121283983-121284005 CCCTAGGCAGAGAGGCGACCTGG + Intronic
1060513953 9:124254264-124254286 CCAGATGCAGAGAAGGTGCCCGG + Intergenic
1060719792 9:125969281-125969303 CTTGATGCAGAAAAGGTACCTGG - Intergenic
1061764560 9:132873708-132873730 CCTGAGGCCGAGTGGGTGCTGGG - Intronic
1062002718 9:134224941-134224963 CCTGAGGCTGAGCGGGGCCCAGG + Intergenic
1062399870 9:136367602-136367624 CCTGCGGCAGGGAGGGGAGCCGG - Intronic
1186477989 X:9873583-9873605 CCTGAGGCAGAGCAGGTCCTCGG - Intronic
1186478649 X:9878768-9878790 CCTGAGGCAGAAATGGTGCATGG + Intronic
1187484927 X:19694424-19694446 CCTGAGCCAGAGAAGGCAACAGG + Intronic
1188133964 X:26471432-26471454 CCTGAGACAGAGAGGGTTAAAGG - Intergenic
1189247028 X:39571287-39571309 CCTAAGGCAGAGAGTGTGCAGGG - Intergenic
1189846825 X:45146028-45146050 CCCGCGGCAGAAAGGGTTCCTGG - Intergenic
1189896612 X:45663374-45663396 ACTGAGGTAGAGAGGGTATTAGG + Intergenic
1190283156 X:48944565-48944587 CCTGAGGCAGTGTGGCTCCCTGG - Intronic
1191129612 X:56994340-56994362 CCTCTGGCAGAGAGGGAGCCAGG - Exonic
1198711054 X:139504798-139504820 TCTGAGGCAGAGAGGATATTAGG - Intergenic
1198884545 X:141319972-141319994 CCTGAGGCAGAGAAGGAATATGG + Intergenic
1199168017 X:144700466-144700488 CCTGTGGCAGAGGGGGGACAGGG - Intergenic
1199502712 X:148526501-148526523 GCTGAAGCAGAGAAAGTACCAGG - Intronic
1200210361 X:154344374-154344396 CCTGGGGCAGAGAGGGGACAGGG - Intergenic
1200220491 X:154387718-154387740 CCTGGGGCAGAGAGGGGACAGGG + Intergenic
1200765509 Y:7077535-7077557 CCTGAAGCAGAGACTGGACCAGG + Intronic