ID: 1077188649

View in Genome Browser
Species Human (GRCh38)
Location 11:1246602-1246624
Sequence GGCGGTGCCCAGGGAGGAAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 721
Summary {0: 1, 1: 1, 2: 9, 3: 75, 4: 635}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077188649_1077188659 11 Left 1077188649 11:1246602-1246624 CCTCTTCCTCCCTGGGCACCGCC 0: 1
1: 1
2: 9
3: 75
4: 635
Right 1077188659 11:1246636-1246658 ATCACAGACCACCACACCCACGG 0: 5
1: 0
2: 2
3: 26
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077188649 Original CRISPR GGCGGTGCCCAGGGAGGAAG AGG (reversed) Exonic