ID: 1077188835

View in Genome Browser
Species Human (GRCh38)
Location 11:1247326-1247348
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 4, 1: 0, 2: 0, 3: 19, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077188835 Original CRISPR CCGTGGAAGGCTCTGTGATG TGG (reversed) Exonic
900783399 1:4632267-4632289 CCATGTGAGGCTCTGGGATGAGG + Intergenic
900795957 1:4708562-4708584 CCTTGGGCGGCTCTGAGATGAGG - Intronic
900911231 1:5598377-5598399 CCGTGGGAGGCTCTGCACTGAGG - Intergenic
902332992 1:15739655-15739677 CTGAGCAAGGCTCTGGGATGTGG - Exonic
903270895 1:22187631-22187653 CCGTGGAAGGATGCGGGATGGGG - Intergenic
904947979 1:34213258-34213280 GCAGGGAAGGTTCTGTGATGGGG - Intronic
907037770 1:51231450-51231472 CTATGGAAAGCACTGTGATGTGG + Intergenic
907754681 1:57300103-57300125 ACATGGAAGGCTCTGTGCAGGGG - Intronic
909607176 1:77519257-77519279 CCATGATAGGCTCTGTAATGAGG + Intronic
915752598 1:158226272-158226294 AGGTGGAAGGCTCTGAGGTGGGG - Intergenic
916103532 1:161413070-161413092 CCCTTAAAGGGTCTGTGATGAGG + Intergenic
918262699 1:182810089-182810111 CCCTGGAGGACTCTGTGATTGGG + Intronic
919453845 1:197800801-197800823 CCCTGGGAGCCACTGTGATGAGG + Intergenic
920385498 1:205568366-205568388 CCCTGGAAGGGCCTGAGATGAGG - Intergenic
921506097 1:215972170-215972192 CAGTGGGAGGCACTGTGAGGAGG + Intronic
921687720 1:218109241-218109263 CAGGGGATGGCTCTGGGATGGGG - Intergenic
922755872 1:228096720-228096742 CCCTGGAAGGTTCTGTGTTGGGG + Intronic
924162633 1:241249077-241249099 CTGTGGAAGACCCTGTGAAGAGG - Intronic
924654590 1:245962067-245962089 ACGTGGGAGGCTGTGTCATGTGG - Intronic
924727999 1:246687676-246687698 CCGTTGAGGGCTGTGTGGTGAGG + Intergenic
1063049381 10:2430224-2430246 CTGTGGGAGGCTGTGTGATTGGG - Intergenic
1063240564 10:4165349-4165371 CCATGGAAGTCTCTGTGCTCTGG + Intergenic
1065630177 10:27671786-27671808 CCTTGGAAGGCGGTGTGTTGTGG - Intergenic
1069590116 10:69636193-69636215 CCCTGAAAGGCTCTGAGAGGCGG - Intergenic
1071503183 10:86217880-86217902 CTGAGGCAGGCTCTGTGGTGTGG - Intronic
1071525696 10:86356885-86356907 CAGTAGAAGGCTCAGTGAAGAGG + Intronic
1072977264 10:100069512-100069534 CCATGGAGGGCTCTATGCTGAGG + Intronic
1074999609 10:118785763-118785785 GCCTTGAATGCTCTGTGATGTGG - Intergenic
1075344582 10:121672919-121672941 CCATGGGAGGCGCTGTGGTGGGG + Intergenic
1075591959 10:123698385-123698407 CCGTGAGAGCCACTGTGATGTGG - Intergenic
1075598807 10:123752141-123752163 GCATGAAAGGCTGTGTGATGTGG - Intronic
1075688450 10:124379743-124379765 CCGTGCAAGGCTCTGGGAAGTGG - Intergenic
1076271042 10:129152445-129152467 TCGTGGCATGCTCTGTGGTGGGG + Intergenic
1076783724 10:132738815-132738837 CAGTGAAAGGCACTGTCATGGGG - Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077226400 11:1440713-1440735 CTGTGGGAGGCCCTGGGATGAGG + Intronic
1077974860 11:7237515-7237537 ACATGGAAGGCTCTGTGAAAAGG + Intergenic
1078532948 11:12151078-12151100 CCCTGGAAGCCAATGTGATGTGG - Intronic
1082946883 11:58770741-58770763 CAGGGGAAGGCTCTGGAATGCGG - Intergenic
1085320207 11:75569284-75569306 CAGTGCTGGGCTCTGTGATGGGG + Intronic
1085491580 11:76924058-76924080 CCTTGGCAGGCTCCCTGATGAGG - Intronic
1092008406 12:5088502-5088524 CTGTGGCTGGATCTGTGATGTGG + Intergenic
1094361791 12:29638775-29638797 CCCTGGCAGGGTGTGTGATGGGG - Intronic
1097697879 12:62792057-62792079 CCGTGGACGGCCCTGTTACGTGG - Intronic
1101157394 12:101940635-101940657 ACGTGGGAGGCTCTGTGTAGGGG - Intronic
1105620753 13:22063739-22063761 CTGTGGAAGGCTCCCAGATGAGG + Intergenic
1108380125 13:49847202-49847224 TCATGCAAGGCTCTGTGCTGTGG - Intergenic
1113271797 13:108682694-108682716 GCATGGAAGGGTCAGTGATGTGG + Intronic
1113597424 13:111543528-111543550 CCCTGTTAAGCTCTGTGATGGGG - Intergenic
1117396129 14:55312334-55312356 CCGTGAAAGCCTCTGGGAAGGGG - Intronic
1117881208 14:60315397-60315419 GCCTGGGAGGCTCTGGGATGGGG - Intergenic
1120840761 14:89083040-89083062 CTGTGGCAGGCTCTGGGAGGGGG + Intergenic
1121896163 14:97649911-97649933 CCTTGGAAGTCTGTGTCATGTGG + Intergenic
1123434694 15:20246662-20246684 CCAAGGAAGGCTTTGTGATATGG + Intergenic
1123977056 15:25563587-25563609 GTGTGGAGGGCACTGTGATGTGG + Intergenic
1125725648 15:41866924-41866946 CAGTGGAAGGCCCTGGGCTGGGG + Intronic
1126743211 15:51799148-51799170 ATGGGGAAGGGTCTGTGATGGGG + Intronic
1128290759 15:66476705-66476727 CCATGGCAGGCTCTGTGCAGGGG + Intronic
1128456109 15:67832377-67832399 TGGTGGAAGGCTCGGTGATGAGG - Intronic
1129079844 15:73029537-73029559 CCCTGGAAGGGTGTGTGATCTGG + Intergenic
1129377899 15:75145597-75145619 CCCTGGGAGCCACTGTGATGAGG - Intergenic
1130077287 15:80700137-80700159 CCCTGGAAGGATGTGTGTTGAGG - Intronic
1132756989 16:1490336-1490358 CCCTCGAAGGCTCTGGGCTGGGG - Intergenic
1135181824 16:20281510-20281532 CAGTGCAAAGCTCTGAGATGGGG + Intergenic
1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG + Intergenic
1136272042 16:29154028-29154050 CTGGGAAAGGCTCTTTGATGAGG + Intergenic
1136274718 16:29172251-29172273 TGGTGGAATGCTCCGTGATGGGG - Intergenic
1136849929 16:33604440-33604462 CCAAGGAAGGCTTTGTGATATGG - Intergenic
1137581295 16:49635040-49635062 ATGTGGAAGGCCCTTTGATGTGG - Intronic
1137584920 16:49658608-49658630 CTGGGGAAGGCTCTGGGATATGG + Intronic
1141932281 16:87213987-87214009 CCATGGAAGGCTGTGGGCTGTGG + Intronic
1142075641 16:88116009-88116031 CTGGGAAAGGCTCTTTGATGAGG + Intronic
1142079011 16:88138009-88138031 TGGTGGAATGCTCCGTGATGGGG - Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1203111540 16_KI270728v1_random:1452893-1452915 CCAAGGAAGGCTTTGTGATATGG - Intergenic
1143401978 17:6651964-6651986 CCGTGGACGTCTCTGTGTAGCGG - Exonic
1144248578 17:13393421-13393443 CCTGGGCAGGCTCTGGGATGAGG + Intergenic
1148882535 17:50740936-50740958 CTGTGTAAAGCTCTATGATGAGG + Intronic
1149670175 17:58400959-58400981 CAGTTGAATGCTCTGTGATTAGG - Intronic
1150209375 17:63433831-63433853 CCCTGGGAAGCTCTGAGATGAGG - Exonic
1153737012 18:8081731-8081753 CTGTGGATGGGTCTGAGATGGGG + Intronic
1154179792 18:12124761-12124783 CCATGGAAGTAACTGTGATGTGG + Intronic
1155215053 18:23635870-23635892 CAGAGGCAGGCTCTGTGGTGGGG + Intronic
1158547117 18:58405825-58405847 CCGTGGGAGGCTCTGGCAGGTGG - Intergenic
1160088371 18:75801468-75801490 CCCTGGAGGGCCATGTGATGAGG - Intergenic
1160370618 18:78369570-78369592 CCCAGGAAGGCTCAGTGCTGCGG + Intergenic
1160460210 18:79033482-79033504 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460340 18:79034222-79034244 TCGTGGAAGGCTCTGAGACATGG - Intergenic
1160460353 18:79034296-79034318 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460366 18:79034370-79034392 TCGTGGAAGGCTCTGAGACATGG - Intergenic
1160460379 18:79034444-79034466 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460431 18:79034740-79034762 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460470 18:79034962-79034984 TCGTGGAAGGCTCTGAGACATGG - Intergenic
1160460496 18:79035110-79035132 TCATGGAAGGCTCTGAGATATGG - Intergenic
1160460586 18:79035628-79035650 TCGTGGAAGGCTCTGAGACATGG - Intergenic
1160460638 18:79035924-79035946 TCATGGAAGGCTCTGAGATATGG - Intergenic
1160460664 18:79036072-79036094 CTGTGAAAGGCTCTGAGATATGG - Intergenic
1160460754 18:79036590-79036612 TCGTGGAAGGCTCTGAGATATGG - Intergenic
1160460767 18:79036664-79036686 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460780 18:79036738-79036760 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460806 18:79036886-79036908 TCGTGGAAGGCTCTGAGATATGG - Intergenic
1160460819 18:79036960-79036982 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460832 18:79037034-79037056 CTGTGAAAGGCTCTGAGATATGG - Intergenic
1160460877 18:79037260-79037282 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460895 18:79037336-79037358 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460912 18:79037412-79037434 CCTTGGAAGGCTCTGAGATATGG - Intergenic
1160460930 18:79037488-79037510 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460968 18:79037638-79037660 TCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460981 18:79037714-79037736 CCCTGGAAGGCTCTGAGACATGG - Intergenic
1160754750 19:751448-751470 CCTTGGAGGGCTCTGGGATTTGG - Intronic
1161210664 19:3063554-3063576 CCCTGGAAGGCTGTGGGAGGAGG + Intergenic
1162096855 19:8315263-8315285 CCGGTAAAGGGTCTGTGATGAGG + Intronic
1162544725 19:11321887-11321909 CCTTGGAAAGCTCTGTTATATGG - Intronic
1165382195 19:35489360-35489382 CCGTGTTGGGCTCTGTCATGGGG - Intronic
1166756632 19:45196475-45196497 CCTTGGCAGGCTCAGTGCTGTGG - Intronic
1167501614 19:49851513-49851535 CCGTGGAAGGCTCTGGAAAAAGG - Intronic
929265535 2:39915012-39915034 CCTGGGAAGGATCTGTGTTGGGG - Intergenic
930207390 2:48601773-48601795 CCCTGGAAGGCTTTGTGTAGAGG + Intronic
931458575 2:62431681-62431703 CCGAGGAAAGCTGAGTGATGAGG + Intergenic
931836907 2:66108738-66108760 CCGTGGAAGGGTCAGTGATATGG + Intergenic
932778565 2:74544887-74544909 CCCTGGGAGATTCTGTGATGGGG - Intronic
932848921 2:75164744-75164766 TCCTGGAAGGCTCTGTCATTTGG + Intronic
934655303 2:96114251-96114273 CCCTGGCAGGCGCTGGGATGGGG - Exonic
935292246 2:101620533-101620555 CTGGGGAAGGCTCTGTGTGGAGG - Intergenic
935804514 2:106732680-106732702 CCGTGTGAAGCTGTGTGATGGGG + Intergenic
938951249 2:136256697-136256719 CAGAGGAAGGCTCTGTTAGGAGG - Intergenic
941397655 2:164993082-164993104 GCCTGGAGGGCTTTGTGATGTGG + Intergenic
944599542 2:201289597-201289619 CCCTGGATGGCTCTGGGTTGGGG - Intronic
947619094 2:231577190-231577212 CCCGGGAAGGGTCTGTGCTGAGG + Intergenic
948223805 2:236293409-236293431 CCGTGGTAGGCCCTGGAATGTGG + Intergenic
948480780 2:238249008-238249030 CCCTAAAAGGCTCTGTGATGGGG - Intronic
948725765 2:239933046-239933068 CCGTGGCAGGGCCTGGGATGGGG + Intronic
949052606 2:241905209-241905231 CCGGGGAAGGGACTGTGACGAGG - Intergenic
1168854437 20:998756-998778 CTGTGCCAGGCTCTGTGTTGGGG - Intronic
1169818945 20:9687976-9687998 TCCAGGAAGGCTCTGAGATGTGG + Intronic
1171282349 20:23911356-23911378 CCATGGAGAGCTCTGTAATGGGG - Intergenic
1172032096 20:31989420-31989442 CCTTGGAAGGCTTTGAGAAGGGG + Intronic
1172914938 20:38436365-38436387 CACTGGGAGTCTCTGTGATGGGG + Intergenic
1175414072 20:58789991-58790013 CCGTGGTAGGCACTGTGGGGGGG + Intergenic
1176938354 21:14893585-14893607 CTGGGGAAGGGACTGTGATGAGG - Intergenic
1177047526 21:16188857-16188879 CAGTGAAAGGCTCTAAGATGGGG - Intergenic
950190780 3:10974776-10974798 CCGTGCAAAGCTCTGAGAGGAGG + Intergenic
950850023 3:16053375-16053397 TGGTGGAAGACTTTGTGATGAGG - Intergenic
951123435 3:18956354-18956376 CCCTTGACAGCTCTGTGATGTGG - Intergenic
951399121 3:22208889-22208911 TCATGGAAGGCTTTGTAATGAGG + Intronic
951982426 3:28580399-28580421 ACGTGAAAGGCTCTGTGAGAGGG + Intergenic
952952808 3:38538476-38538498 CTTTGGGAGGCTCTGTGATGGGG + Intronic
953888355 3:46732903-46732925 ACGTGGACAACTCTGTGATGGGG - Intronic
958044240 3:88264829-88264851 CCGTGGAAAGATCTGTGGGGAGG + Intergenic
961557521 3:127706809-127706831 CCGTGGAAGGCTGTGTCCTGGGG + Intronic
961787753 3:129357848-129357870 CCTCGGAAGGCTCTGAGATACGG + Intergenic
963002024 3:140690791-140690813 TCTTGGAAGACTGTGTGATGAGG - Intronic
966669006 3:182506102-182506124 ATGTGAAAGGCTCTGTGGTGGGG - Intergenic
968430345 4:554798-554820 CCTTGAAAGGCTCAGTGAGGCGG - Intergenic
970142721 4:12999768-12999790 CCCTGGAGAGCTCAGTGATGTGG - Intergenic
973796739 4:54434839-54434861 AGGTGTAAGGCTCTGTGTTGAGG - Intergenic
974052349 4:56952704-56952726 CCTGGGAAGTCTCTGTAATGGGG - Intergenic
979302459 4:119102371-119102393 CCCTGTAAGGTTCTGTGAAGGGG + Intergenic
982944689 4:161605283-161605305 CTGTGGAAGGCTATGTGCTATGG - Intronic
983577043 4:169271119-169271141 CCGGGGAAGGCGCTGTGGCGCGG - Intergenic
984754442 4:183312829-183312851 CCTTGTCAGGCTCTGAGATGTGG + Intronic
985494352 5:196433-196455 CCGTGGTGGGCGCTGTCATGAGG - Intergenic
987101621 5:14596262-14596284 CTGTGGAAGGCTTGGTGATTGGG - Intronic
990875140 5:60475855-60475877 CCCTGCAACGCTATGTGATGCGG - Intronic
991153670 5:63402529-63402551 GAGTGAAAGCCTCTGTGATGAGG - Intergenic
991772168 5:70050473-70050495 CCTTGGAAGGCTCAGGGAGGTGG + Intronic
991851461 5:70925891-70925913 CCTTGGAAGGCTCAGGGAGGTGG + Intronic
995332857 5:110965024-110965046 CCATGGCAGGTTCTGTCATGTGG - Intergenic
995359634 5:111280673-111280695 CCGTGTAAATCTCTGAGATGTGG + Intronic
997528954 5:134570573-134570595 AGGTGGCAGGCTCTGGGATGTGG - Intronic
998533266 5:142904643-142904665 TGGGGAAAGGCTCTGTGATGGGG + Intronic
1000234167 5:159342293-159342315 CAGGGGAGGGCTCTCTGATGAGG + Intergenic
1002047660 5:176550845-176550867 CCGTGGACTGCTCTGAGATGCGG + Intronic
1004529143 6:16437329-16437351 CCGTGGAAGGCTACTTGATGCGG + Intronic
1004804586 6:19188749-19188771 CCGTGACAGTCTCTGTAATGCGG - Intergenic
1007083702 6:39127710-39127732 ACATGGAAGGCTCTGTGGTGAGG + Intergenic
1007523981 6:42474902-42474924 CTGTGCTAGGGTCTGTGATGAGG - Intergenic
1011125891 6:84007223-84007245 ATGTGGAAGTCACTGTGATGTGG + Intergenic
1017232998 6:152092682-152092704 CCCTGCAAGGCGCTGTGATTAGG + Intronic
1017876042 6:158524959-158524981 CCGTGGAAGGCTCTGGGCAGAGG - Intergenic
1019121132 6:169804910-169804932 CTGTGGAGAGCTCTGTGGTGTGG - Intergenic
1019121252 6:169806309-169806331 CTGTGGAGAGCTCTGTGATATGG - Intergenic
1019121279 6:169806703-169806725 CTGTGGAGTGCTCTGTGTTGTGG - Intergenic
1019121300 6:169806893-169806915 ATGTGGAGAGCTCTGTGATGTGG - Intergenic
1019121356 6:169807736-169807758 CTGTGGAGAGCTCTGTGGTGTGG - Intergenic
1019171665 6:170136463-170136485 CCGGAGAAGGCTCTGTGGAGGGG - Intergenic
1019574912 7:1732857-1732879 CGGGGAAAGGCTGTGTGATGAGG + Intronic
1022477861 7:30723525-30723547 CCATGGAAGGCTTTATGGTGGGG + Intronic
1023149566 7:37188836-37188858 TCATGGAAGGCTCAGTCATGGGG - Intronic
1024479372 7:49848279-49848301 CCGTGGGAGGCTCTGAGTGGAGG - Intronic
1024788637 7:52937012-52937034 GCGAGGAAGAGTCTGTGATGTGG - Intergenic
1031423669 7:121580257-121580279 CAGTGGAAGCCTCAGTGAAGAGG - Intergenic
1031645626 7:124221878-124221900 CCGTGAAAGCCCCTGGGATGGGG + Intergenic
1032398326 7:131606696-131606718 CCCTGCAAGGCCCTTTGATGTGG + Intergenic
1035344925 7:158191676-158191698 TCTTGGGTGGCTCTGTGATGCGG + Intronic
1035962653 8:4155019-4155041 CAGTGTTAGGTTCTGTGATGAGG - Intronic
1037229569 8:16640060-16640082 CTGTGGTAGGCTGGGTGATGTGG - Intergenic
1037813302 8:22099035-22099057 CCGTGTGTGCCTCTGTGATGAGG - Exonic
1038711188 8:29947543-29947565 CTGTGGAAGACCCTGTGAGGGGG - Intergenic
1038714303 8:29978150-29978172 CCTTGGTAGGCTCTATGTTGAGG - Intergenic
1038782124 8:30577165-30577187 CCGTCGTGGGCTCTGTGATCAGG - Intergenic
1040919461 8:52600131-52600153 CCTTGCAGGGCTGTGTGATGAGG - Intergenic
1041205644 8:55495544-55495566 CCCTGGAAGCCACTGTGATGGGG - Intronic
1041431919 8:57791675-57791697 ACTTGGAAGGGTGTGTGATGGGG + Intergenic
1049245558 8:141560443-141560465 ACGTGCCAGGCTCTGTGCTGAGG + Intergenic
1049264248 8:141658832-141658854 ACGTGGATGGGTCAGTGATGGGG - Intergenic
1049383161 8:142327544-142327566 CGATGGAGGGCTCTGTGAGGGGG - Intronic
1055357791 9:75455263-75455285 CCATGGGAGGCCCTGTTATGAGG + Intergenic
1055391876 9:75830813-75830835 CCGTGGAAGGATCCAAGATGTGG - Intergenic
1057025973 9:91734009-91734031 CTCTGGAAGGTTCTGTGATAAGG + Intronic
1057695760 9:97322014-97322036 CAGTGGAAGGTTCTGAGCTGGGG + Intronic
1057890405 9:98865584-98865606 CCTTGGAAGTCTGTGAGATGGGG - Intergenic
1060309724 9:122448490-122448512 CCCGTGAAGGGTCTGTGATGAGG - Intergenic
1060471362 9:123951269-123951291 CCGGGGAGGGCTCTCTGAAGAGG + Intergenic
1061281628 9:129601011-129601033 CTGTGGCAGGCTCTGTGTTAGGG + Intergenic
1062284841 9:135768319-135768341 CCGTGGGGGACACTGTGATGTGG + Intronic
1203634250 Un_KI270750v1:96300-96322 CCGTGGGAACCACTGTGATGGGG + Intergenic
1189098900 X:38168745-38168767 CTGTGGATGGCTCTGGGAAGTGG + Intronic
1195094612 X:101492150-101492172 CAGTGGAGGGCTCTGGGCTGGGG + Exonic
1196425934 X:115569693-115569715 CCATGGAAGGGTCTGTGAAATGG - Intronic