ID: 1077190366

View in Genome Browser
Species Human (GRCh38)
Location 11:1253530-1253552
Sequence TGTTCCAAACCGCCACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077190361_1077190366 1 Left 1077190361 11:1253506-1253528 CCCATGTCCTTGGCCCAGGGCTG 0: 1
1: 0
2: 1
3: 45
4: 328
Right 1077190366 11:1253530-1253552 TGTTCCAAACCGCCACAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1077190360_1077190366 2 Left 1077190360 11:1253505-1253527 CCCCATGTCCTTGGCCCAGGGCT 0: 1
1: 0
2: 1
3: 25
4: 316
Right 1077190366 11:1253530-1253552 TGTTCCAAACCGCCACAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1077190363_1077190366 -6 Left 1077190363 11:1253513-1253535 CCTTGGCCCAGGGCTGCTGTTCC 0: 1
1: 0
2: 4
3: 48
4: 482
Right 1077190366 11:1253530-1253552 TGTTCCAAACCGCCACAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1077190362_1077190366 0 Left 1077190362 11:1253507-1253529 CCATGTCCTTGGCCCAGGGCTGC 0: 1
1: 0
2: 7
3: 46
4: 435
Right 1077190366 11:1253530-1253552 TGTTCCAAACCGCCACAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1077190357_1077190366 5 Left 1077190357 11:1253502-1253524 CCTCCCCATGTCCTTGGCCCAGG 0: 1
1: 0
2: 1
3: 34
4: 343
Right 1077190366 11:1253530-1253552 TGTTCCAAACCGCCACAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077190366 Original CRISPR TGTTCCAAACCGCCACAAGC TGG Intronic
913546296 1:119872075-119872097 TGTGCCTAACAGCCACAAACTGG + Intergenic
915214635 1:154331666-154331688 TGTCCCTTACCGCCACAAACTGG - Exonic
915822322 1:159038290-159038312 TGTTCGAAACCATAACAAGCAGG + Intronic
917177765 1:172256620-172256642 TGTTCAAAAGTGCCACAAACTGG - Intronic
918429373 1:184443297-184443319 AGTTCCAAACAGCAAAAAGCAGG - Intronic
920669183 1:207990129-207990151 TATTCCCAACAGCCAAAAGCTGG - Intergenic
1064829842 10:19450686-19450708 TGTTACAAAATGCCATAAGCTGG + Intronic
1072881480 10:99233339-99233361 GGTTCCAAACGGCCCCAAGTGGG - Intronic
1074847189 10:117408701-117408723 TGTAACAAACTGCCACAAACTGG - Intergenic
1077190366 11:1253530-1253552 TGTTCCAAACCGCCACAAGCTGG + Intronic
1078635578 11:13046666-13046688 TGTTCCTAACCGTGACAAGAAGG + Intergenic
1083147011 11:60767475-60767497 TGTTCCACACCGCCCCCTGCCGG - Intronic
1086253202 11:84842491-84842513 AGTTCCTAACTACCACAAGCAGG + Intronic
1095034116 12:37336340-37336362 AGTTCCAAACATCCACAAGCAGG + Intergenic
1095034229 12:37338552-37338574 AGTTCCAAACATCCACAAGCAGG + Intergenic
1096819508 12:54222998-54223020 TGCTCCAAGCCCCAACAAGCTGG - Intergenic
1097365615 12:58709278-58709300 TGTTCCAACCCATCACAAGGAGG - Intronic
1098131781 12:67358710-67358732 TGTAACAAAGTGCCACAAGCTGG + Intergenic
1104007771 12:124906091-124906113 TCTTCCAACCATCCACAAGCAGG + Intergenic
1106858147 13:33875036-33875058 TCTTCCAAAAGGCCACAAGATGG + Intronic
1128356934 15:66934803-66934825 TGTAACAAATCGCCACAAACTGG - Intergenic
1130733426 15:86523097-86523119 TGTACCAAACTGCCACAACTGGG + Intronic
1133117866 16:3588507-3588529 TGTTCACAATCGCCAAAAGCTGG - Intronic
1135630861 16:24034774-24034796 TGTTCCAAACTGAGACAAGAGGG - Intronic
1138993713 16:62422594-62422616 TCATCTAAACCCCCACAAGCAGG - Intergenic
1144239091 17:13292408-13292430 CTTTCCAAACTGCCACCAGCTGG + Intergenic
1150841043 17:68605595-68605617 TGTAACAAAGTGCCACAAGCTGG - Intergenic
1151827254 17:76530278-76530300 TGTTCCCAACCGCCACATCTGGG + Intronic
1151957678 17:77388540-77388562 TGATCCAAAGCGCGCCAAGCTGG - Intronic
1157053377 18:44196503-44196525 TGATCCAAACAGCCCCAACCAGG + Intergenic
1158858515 18:61568994-61569016 TGTAACAAACCGCCATAAACTGG - Intergenic
1164662478 19:29988708-29988730 TGTTCCTAACCGCCAAAAAATGG - Intronic
925791838 2:7497057-7497079 TGTTCCTAACCTCCACCACCTGG + Intergenic
928716044 2:34061892-34061914 AGTTCCAAACCACCACAATAAGG + Intergenic
929761799 2:44813391-44813413 TGTCCCAAATAGCCACAAGCAGG - Intergenic
930278828 2:49345264-49345286 AGTTCCAAGCCAGCACAAGCTGG + Intergenic
931858606 2:66330156-66330178 TGTTCCAAACCAGGACAAGAGGG - Intergenic
938084027 2:128386409-128386431 TGTAACAAAGCGCCACAGGCTGG + Intergenic
941250423 2:163154737-163154759 TTTCCCACACGGCCACAAGCAGG + Intergenic
941720050 2:168802940-168802962 TTTTCCAAACAGCCACCATCTGG - Intronic
947973239 2:234342261-234342283 TGTAACAAATCGCCACAAACTGG - Intergenic
948287804 2:236800631-236800653 TGTAACAAATGGCCACAAGCTGG + Intergenic
1170018901 20:11813834-11813856 TGTAACAAAGCGCCACAAACTGG - Intergenic
1170274677 20:14571612-14571634 TGTTCCAAAATGGCACAAGGAGG + Intronic
1171532500 20:25861805-25861827 TCTCCCAAGCCGCCACAAACTGG - Intronic
1172407641 20:34701490-34701512 TATGCCAGACCCCCACAAGCTGG + Intronic
1173110390 20:40182150-40182172 TGTTCCAAAGTGCCACAAAATGG + Intergenic
1175850019 20:62085274-62085296 TGTGACAAATCACCACAAGCTGG - Intergenic
1176430369 21:6571644-6571666 TGTGACAAACGACCACAAGCTGG + Intergenic
1179174722 21:39000216-39000238 TGTTCCTCACCTCGACAAGCCGG + Intergenic
1179186580 21:39089620-39089642 TGTAACAAACCACCACAACCTGG - Intergenic
1179705763 21:43179106-43179128 TGTGACAAACGACCACAAGCTGG + Intergenic
1184068609 22:42134922-42134944 TGTTCAAAACCACTACAAGCTGG + Intergenic
1184926969 22:47649303-47649325 TGTTCCCAATAGCCAAAAGCTGG - Intergenic
949156865 3:838213-838235 TGTTCAAAACCCTCAGAAGCTGG + Intergenic
952219737 3:31313186-31313208 TGTTCCAAACCACTTGAAGCAGG + Intergenic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
956944018 3:74198156-74198178 TGTAACAAAGTGCCACAAGCTGG - Intergenic
958203721 3:90359674-90359696 TGTTCCAAACATCCACTTGCAGG + Intergenic
959303923 3:104635878-104635900 TGTACCAAACAGTCACAAGGGGG + Intergenic
960684330 3:120281832-120281854 TGTTCAAAATTGCCACAAACTGG + Intronic
968226402 3:196975048-196975070 TGTTCCAAACTGCCAGAGTCTGG - Intergenic
969108689 4:4827953-4827975 TGTTGCCAACCACCAGAAGCTGG + Intergenic
971285033 4:25280881-25280903 TGTACCAAGCCCCCACAAGAAGG + Intergenic
983495558 4:168438662-168438684 TGTCACAAAGCACCACAAGCTGG - Intronic
985960202 5:3296197-3296219 TGTTACAAACTGCAACAAACTGG - Intergenic
987309553 5:16669097-16669119 TGATCCAAACCTGGACAAGCAGG + Intronic
987319822 5:16758174-16758196 TGTTTCAAGCCGCAACAACCAGG - Exonic
992506232 5:77389870-77389892 TGTTCAAAGCAGCCAAAAGCTGG - Intronic
995208675 5:109512011-109512033 TGTTCCAAACCTCGACAGCCAGG + Intergenic
1003428725 6:6019411-6019433 TATTCCAAACTGCCATATGCCGG - Intergenic
1004568246 6:16819823-16819845 AGATTCAAACCACCACAAGCAGG - Intergenic
1006652408 6:35562527-35562549 TCTTCCAAAACTCCACAACCTGG - Intergenic
1008380481 6:50835290-50835312 TGTTCCAAACAATCACTAGCCGG + Intronic
1011591629 6:88975602-88975624 TGTAACAAAAGGCCACAAGCTGG + Intergenic
1011904875 6:92352206-92352228 TGTTACAAAATGCCACAAACTGG + Intergenic
1017908453 6:158772755-158772777 TGTTCCAAATGGTCAGAAGCTGG - Intronic
1019885158 7:3897619-3897641 TGTTCATAACAGCCACAAGGGGG - Intronic
1023485927 7:40686867-40686889 TGTTCAAAACCTCTAGAAGCTGG + Intronic
1024567789 7:50696876-50696898 TATTCCCAACAGCCACAAGGTGG + Intronic
1034712541 7:153206546-153206568 TGCTCCAAAAGGCCAGAAGCCGG - Intergenic
1034922368 7:155094467-155094489 TGTGATAAACTGCCACAAGCTGG - Intergenic
1035427637 7:158791250-158791272 TGCTCCAGGCCGCCACATGCTGG - Intronic
1039105834 8:33988530-33988552 TGTGCCAAAATGCCACAGGCTGG + Intergenic
1040560761 8:48521476-48521498 TGTTCCACACAGGCAAAAGCTGG - Intergenic
1041812429 8:61926538-61926560 TGTTACAAATCACCACAAACTGG - Intergenic
1045045738 8:98275525-98275547 TGTTCAAAACAGCCCCAAACTGG - Intronic
1048010173 8:130449043-130449065 TCTTACAAAGCGCCAGAAGCCGG - Intergenic
1054906061 9:70414259-70414281 TGTCCCAAAGCTCCGCAAGCTGG - Exonic
1058850109 9:109003415-109003437 TGCTCCAAACTTCCATAAGCAGG + Intronic
1188213260 X:27447969-27447991 TGTTACAAATCACCACAAACTGG + Intergenic
1189213626 X:39304992-39305014 TGTAACAAAGTGCCACAAGCTGG + Intergenic
1190614715 X:52218075-52218097 TGTTCCAAGCCACCTAAAGCTGG - Intergenic
1190870624 X:54421855-54421877 TGCTGGAAACCGCCAGAAGCTGG - Intergenic
1197096789 X:122605257-122605279 TGTTCCAAGCCACCTAAAGCTGG - Intergenic