ID: 1077190846

View in Genome Browser
Species Human (GRCh38)
Location 11:1255482-1255504
Sequence AGAGCTCTGCGTAAGCCTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077190846_1077190849 -10 Left 1077190846 11:1255482-1255504 CCTGGAGGCTTACGCAGAGCTCT 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1077190849 11:1255495-1255517 GCAGAGCTCTGCCGCGCCCGGGG 0: 1
1: 0
2: 0
3: 13
4: 117
1077190846_1077190854 11 Left 1077190846 11:1255482-1255504 CCTGGAGGCTTACGCAGAGCTCT 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1077190854 11:1255516-1255538 GGAGTGTGCAGTGACTGGCGAGG 0: 1
1: 0
2: 8
3: 10
4: 179
1077190846_1077190856 23 Left 1077190846 11:1255482-1255504 CCTGGAGGCTTACGCAGAGCTCT 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1077190856 11:1255528-1255550 GACTGGCGAGGTGCAACCGGTGG 0: 1
1: 0
2: 0
3: 7
4: 249
1077190846_1077190855 20 Left 1077190846 11:1255482-1255504 CCTGGAGGCTTACGCAGAGCTCT 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1077190855 11:1255525-1255547 AGTGACTGGCGAGGTGCAACCGG 0: 1
1: 0
2: 0
3: 2
4: 64
1077190846_1077190852 6 Left 1077190846 11:1255482-1255504 CCTGGAGGCTTACGCAGAGCTCT 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1077190852 11:1255511-1255533 CCCGGGGAGTGTGCAGTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077190846 Original CRISPR AGAGCTCTGCGTAAGCCTCC AGG (reversed) Exonic
900166971 1:1247733-1247755 AGAGCACTGTGGAAGCCTCCCGG + Intergenic
902542995 1:17167401-17167423 AGAGGTCTGAGAAAGCCTCCTGG - Intergenic
905631712 1:39522446-39522468 CGAGCTCTACGTCAGCTTCCAGG + Exonic
905666041 1:39763726-39763748 CGAGCTCTACGTCAGCTTCCAGG - Exonic
906483906 1:46220086-46220108 AGAGCTGTGTGGAAGCCCCCAGG + Exonic
909608044 1:77526393-77526415 AGAGCTCTGAGAGACCCTCCAGG + Intronic
910047214 1:82932257-82932279 TGAGCTCTGGGTGAGCCTGCTGG - Intergenic
910469743 1:87539365-87539387 AAAGCTCTACCTAGGCCTCCAGG - Intergenic
922021510 1:221709602-221709624 AGAGCTGTGCATAAGCCTTATGG - Intronic
1067570848 10:47369756-47369778 AGAGCACTGGGCAAGCCTCAAGG - Intronic
1070711245 10:78684725-78684747 AGGGCTCTGCTTCAGGCTCCTGG - Intergenic
1071121343 10:82282446-82282468 AGGGCTCTGCGTAGGACTCAGGG + Intronic
1076849339 10:133085547-133085569 AGAGGCCTGCGTGATCCTCCAGG + Intronic
1076939367 10:133591175-133591197 CGAGTGCTGCCTAAGCCTCCAGG - Intergenic
1077190846 11:1255482-1255504 AGAGCTCTGCGTAAGCCTCCAGG - Exonic
1078408217 11:11089724-11089746 AGAGCACTCAGAAAGCCTCCAGG - Intergenic
1081308057 11:41537385-41537407 GCAGTTCTGCCTAAGCCTCCTGG - Intergenic
1083190149 11:61045423-61045445 AGAGCTCTGCACCAGCCTCCAGG + Intergenic
1083254516 11:61487902-61487924 AGAGCCATGGGGAAGCCTCCTGG + Intronic
1084366996 11:68708162-68708184 AGAGCTCTGAGTAAACTCCCTGG + Exonic
1084716438 11:70877272-70877294 AGGGCTCTGCCCAGGCCTCCTGG - Intronic
1085383372 11:76140649-76140671 AGAACTCAGTGTAAGCCTTCTGG - Intronic
1088831075 11:113537367-113537389 AGAGCCCTGCCTAGGACTCCAGG - Intergenic
1095324232 12:40868579-40868601 TGCTCTCTGCGTTAGCCTCCCGG + Intronic
1098560199 12:71864611-71864633 AGTTCTCTGCCTCAGCCTCCCGG + Intronic
1098563369 12:71903016-71903038 AATTCTCTGCGTCAGCCTCCCGG + Intronic
1101253227 12:102955243-102955265 AGATCTCTGTGTATGCATCCTGG + Intronic
1104521499 12:129480115-129480137 AGAGATTTGAGCAAGCCTCCTGG + Intronic
1104681124 12:130752688-130752710 GCAGCTCTGAGTAATCCTCCTGG - Intergenic
1118332259 14:64823714-64823736 AGGGCTCTCAGAAAGCCTCCGGG - Intronic
1119442803 14:74639830-74639852 AGTTCTCTGCCTCAGCCTCCCGG - Intergenic
1119622476 14:76142053-76142075 ACAGCTCAGCCTCAGCCTCCTGG + Intergenic
1119652015 14:76390792-76390814 AGAGGTATGCTGAAGCCTCCAGG + Intronic
1122764100 14:104053296-104053318 AGCCCTCTGAGAAAGCCTCCGGG + Intergenic
1125778814 15:42244917-42244939 AGATCTCTGGGTAAGCTTCTAGG + Intronic
1133695309 16:8257486-8257508 AGAGGTCTGTGGAAGACTCCTGG + Intergenic
1134087910 16:11371364-11371386 AGTTCTCTGCCTCAGCCTCCTGG + Intronic
1136067903 16:27771046-27771068 AGTGCTCTGGGAAGGCCTCCAGG - Intronic
1138331029 16:56215378-56215400 AGAGCTCTGTGTCAGGCTCATGG - Intronic
1138432945 16:56981196-56981218 AAAGCTCTTCTTAAGCCTCTTGG + Exonic
1139212559 16:65093965-65093987 AAAGCTCTAAGCAAGCCTCCAGG + Intronic
1142551998 17:746572-746594 AGAGGTCTGCGTAACATTCCAGG + Exonic
1145814058 17:27782845-27782867 AGAGCTGTGCCCAGGCCTCCTGG - Intronic
1148152951 17:45407024-45407046 CTAGCCATGCGTAAGCCTCCCGG + Intronic
1148860545 17:50602253-50602275 AGAGATCTGCGCCTGCCTCCTGG + Intronic
1157301153 18:46480580-46480602 AGAGCTTTGTGTAAGTCTGCAGG - Intronic
1158343197 18:56488471-56488493 GCAGCTCTGTGAAAGCCTCCAGG + Intergenic
1162924323 19:13922489-13922511 ACAGCTCAGGGTAGGCCTCCTGG - Intronic
1164881783 19:31738930-31738952 ACAGGTCTGCGGATGCCTCCAGG - Intergenic
1165158719 19:33803521-33803543 AGAACTCTGCCTGAGCCTCTGGG + Intronic
1165713471 19:38028469-38028491 AGAGCTCGGGGAAGGCCTCCCGG - Intronic
925690759 2:6520840-6520862 AGAGCTCTCGGTGAGCTTCCAGG + Intergenic
925691014 2:6523328-6523350 AGAGCTCAGGGTAGGGCTCCAGG - Intergenic
937341634 2:121095056-121095078 AGGGCTCTTCCTAAGCATCCCGG - Intergenic
937976711 2:127586890-127586912 GGAGCTCTGCCTGAGCCTCAGGG + Intronic
938178788 2:129161463-129161485 AGAGCACTGCACAAGCTTCCTGG + Intergenic
941903392 2:170698512-170698534 AGCGCTCTGTGTGAGCCTACAGG - Intergenic
946167132 2:217871190-217871212 AGAGGTTTGGGTTAGCCTCCTGG - Intronic
947629172 2:231640816-231640838 CCAGCTCTGCGTTAGACTCCAGG - Intergenic
1169282707 20:4280772-4280794 AGAGCTCTGAGTGAGCTCCCAGG + Intergenic
1170172439 20:13430404-13430426 AGAGATCTGAGTGAGCCTTCAGG - Intronic
1174590752 20:51642803-51642825 AGAGCTCTGCAGAAGCCACAAGG + Intronic
1174669532 20:52293383-52293405 ACAGCTCTGCAAAAGCTTCCTGG - Intergenic
1175318673 20:58070237-58070259 AGAGCTTTGCTGAAGCCACCTGG - Intergenic
1177012283 21:15743865-15743887 ACAGCTCTGCGCAGGCCTCCTGG + Intronic
950104636 3:10380302-10380324 AGAGCTCTGGGTGAGCGTGCAGG - Intronic
950141011 3:10615291-10615313 AGACCACTGGGTCAGCCTCCTGG - Intronic
950509065 3:13414729-13414751 GGCGCTCAGCATAAGCCTCCTGG - Intronic
962062949 3:131950556-131950578 ACAGCTCTGCGTATGTCTACAGG + Intronic
962891830 3:139678778-139678800 AGAACTCTCCATAAGCCCCCAGG + Intergenic
967459405 3:189728075-189728097 AGAGCTTTGCCTAAGGATCCAGG + Intronic
970325561 4:14920078-14920100 AGAGCTCTGTCTGGGCCTCCAGG + Intergenic
971454137 4:26828098-26828120 AGAGCACTTCATAAGCCTCCTGG - Intergenic
981615629 4:146640349-146640371 AGCGCTCGGCGAATGCCTCCAGG - Exonic
988976525 5:36521812-36521834 AGAGTTCATTGTAAGCCTCCTGG - Intergenic
1001330628 5:170759998-170760020 AGAGCTCAGCTTGAGCCTCTAGG + Intergenic
1001793572 5:174482956-174482978 AGAGCTGTGAGTGAGCCTCTCGG + Intergenic
1003148273 6:3527194-3527216 TGAGCTGTGAGTAAGCGTCCGGG + Intergenic
1003192058 6:3882911-3882933 ACAGCTGTGCCTAAGACTCCCGG - Intergenic
1007212438 6:40206225-40206247 AGAGCTCTGCCCCACCCTCCAGG - Intergenic
1015225389 6:130851686-130851708 ACAGCTCTGACAAAGCCTCCAGG + Intronic
1015465991 6:133549388-133549410 AGAGCGTTGTGTAAGCCTGCTGG + Intergenic
1015753132 6:136581420-136581442 AGAGGTCTGTGTAAGCCAGCAGG - Intronic
1016855583 6:148667111-148667133 AGATATCTGTGTAAGCCTCATGG - Intergenic
1019055680 6:169221565-169221587 AGAGCTGTGGTTAAGGCTCCGGG - Intronic
1020106814 7:5426024-5426046 AGACCTCTGCGTAAGGCTCAAGG - Intergenic
1024596309 7:50940579-50940601 AGAGCCCTGCTGAAGCCTGCGGG - Intergenic
1036002368 8:4622216-4622238 AGTACTCTGCCTGAGCCTCCAGG - Intronic
1036711140 8:11079195-11079217 AGAGCTCTGTGTGTGTCTCCTGG + Intronic
1037743962 8:21628759-21628781 GTAGCTCTGCCTAAGCCTCTGGG - Intergenic
1042520936 8:69710482-69710504 AGAGCTCTGGGTGAGATTCCAGG - Intronic
1046077247 8:109327841-109327863 AGAGCTCTGCTTTAGCGGCCAGG - Intronic
1048254271 8:132893862-132893884 ACTGCTCCGCGAAAGCCTCCCGG - Exonic
1049326025 8:142022053-142022075 AGAGCTCAGCGTCAGACACCCGG - Intergenic
1049376662 8:142292577-142292599 AGAGCTCATCGACAGCCTCCTGG - Intronic
1049392450 8:142379263-142379285 ACACCTCTGAGTAAGCCTCCAGG + Intronic
1049826263 8:144670702-144670724 GGAGCTCAGGGCAAGCCTCCAGG - Intergenic
1050287748 9:4120539-4120561 AGAGCTCAGCTGAAGGCTCCTGG + Intronic
1055688964 9:78809347-78809369 AGTTCTCTGCCTCAGCCTCCTGG + Intergenic
1056438707 9:86598505-86598527 AGGGCTCTGGGGTAGCCTCCCGG - Intergenic
1057224114 9:93278313-93278335 AGTGCTCTGCGAAATCATCCAGG - Intronic
1057353581 9:94318762-94318784 AGGGCTCTGGGACAGCCTCCAGG + Exonic
1057654170 9:96938830-96938852 AGGGCTCTGGGACAGCCTCCAGG - Exonic
1057779866 9:98040761-98040783 AGTTCTCTGCCTCAGCCTCCCGG + Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060594926 9:124841896-124841918 GGAGGTCGGCGTAGGCCTCCAGG + Intergenic
1187011563 X:15285245-15285267 AGTTCTCTGCCTCAGCCTCCCGG + Intronic
1189850616 X:45172952-45172974 AGAATTCTGCCTGAGCCTCCTGG - Intronic
1199094177 X:143720743-143720765 AGAGCTCTGGGACATCCTCCTGG - Exonic
1199214165 X:145247490-145247512 AGAGCTCTGGGACATCCTCCTGG + Exonic
1200078622 X:153564668-153564690 GGAGCTCTGGGCCAGCCTCCGGG - Intronic