ID: 1077191097

View in Genome Browser
Species Human (GRCh38)
Location 11:1256223-1256245
Sequence TAGGTAAGTACAGGGATGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 228}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077191089_1077191097 2 Left 1077191089 11:1256198-1256220 CCATACAGCCTGCCACCTGCAAC 0: 1
1: 0
2: 3
3: 16
4: 222
Right 1077191097 11:1256223-1256245 TAGGTAAGTACAGGGATGGCTGG 0: 1
1: 0
2: 2
3: 10
4: 228
1077191092_1077191097 -10 Left 1077191092 11:1256210-1256232 CCACCTGCAACTCTAGGTAAGTA 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1077191097 11:1256223-1256245 TAGGTAAGTACAGGGATGGCTGG 0: 1
1: 0
2: 2
3: 10
4: 228
1077191086_1077191097 12 Left 1077191086 11:1256188-1256210 CCATGCGGCCCCATACAGCCTGC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1077191097 11:1256223-1256245 TAGGTAAGTACAGGGATGGCTGG 0: 1
1: 0
2: 2
3: 10
4: 228
1077191082_1077191097 30 Left 1077191082 11:1256170-1256192 CCCACCAAAGTGTACAAGCCATG 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1077191097 11:1256223-1256245 TAGGTAAGTACAGGGATGGCTGG 0: 1
1: 0
2: 2
3: 10
4: 228
1077191088_1077191097 3 Left 1077191088 11:1256197-1256219 CCCATACAGCCTGCCACCTGCAA 0: 1
1: 0
2: 1
3: 12
4: 140
Right 1077191097 11:1256223-1256245 TAGGTAAGTACAGGGATGGCTGG 0: 1
1: 0
2: 2
3: 10
4: 228
1077191083_1077191097 29 Left 1077191083 11:1256171-1256193 CCACCAAAGTGTACAAGCCATGC 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1077191097 11:1256223-1256245 TAGGTAAGTACAGGGATGGCTGG 0: 1
1: 0
2: 2
3: 10
4: 228
1077191087_1077191097 4 Left 1077191087 11:1256196-1256218 CCCCATACAGCCTGCCACCTGCA 0: 1
1: 0
2: 1
3: 23
4: 299
Right 1077191097 11:1256223-1256245 TAGGTAAGTACAGGGATGGCTGG 0: 1
1: 0
2: 2
3: 10
4: 228
1077191085_1077191097 26 Left 1077191085 11:1256174-1256196 CCAAAGTGTACAAGCCATGCGGC 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1077191097 11:1256223-1256245 TAGGTAAGTACAGGGATGGCTGG 0: 1
1: 0
2: 2
3: 10
4: 228
1077191091_1077191097 -6 Left 1077191091 11:1256206-1256228 CCTGCCACCTGCAACTCTAGGTA 0: 1
1: 0
2: 1
3: 12
4: 204
Right 1077191097 11:1256223-1256245 TAGGTAAGTACAGGGATGGCTGG 0: 1
1: 0
2: 2
3: 10
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077191097 Original CRISPR TAGGTAAGTACAGGGATGGC TGG Exonic
900493455 1:2964969-2964991 TAGATGAGTAGAGGGATGGTAGG - Intergenic
900804180 1:4756530-4756552 TAGGGCAGAACAGAGATGGCTGG + Intronic
901700138 1:11040916-11040938 TTGGTAAGTAGAAGGATGGGTGG + Intronic
902243146 1:15101923-15101945 TAGGTAGGTAGATGGATGGACGG - Intronic
904130508 1:28272291-28272313 CAGGTAAGAACACTGATGGCGGG - Exonic
904826485 1:33276686-33276708 TAGGTAAGAGCAGGGCGGGCAGG + Intronic
905032979 1:34900048-34900070 CAAGTAAGGACAGGGAGGGCCGG - Exonic
905654058 1:39674750-39674772 TTGGGAAGTTCAGGCATGGCTGG - Intergenic
906163612 1:43669450-43669472 TAGGGATGTACAGGGAGGACTGG + Intronic
908929973 1:69306385-69306407 TAGGTAAGGACAGGCATTTCTGG - Intergenic
909858814 1:80576228-80576250 TGGGCAAATACAGGGGTGGCTGG + Intergenic
911257099 1:95645647-95645669 AAGGTAATTACAGTGTTGGCTGG - Intergenic
914891538 1:151628263-151628285 TACCTAAGTACTGGGATTGCAGG + Intronic
915587702 1:156853046-156853068 GAGGAAAGAAAAGGGATGGCTGG - Intronic
916461272 1:165027452-165027474 TGAGTAAGCACTGGGATGGCTGG - Intergenic
916915995 1:169407615-169407637 TAATTAAATACAGGGGTGGCTGG + Intronic
918203216 1:182286729-182286751 TAGGTATGTATAGGGATGCTAGG - Intergenic
919463518 1:197906197-197906219 TAGGCAAGTACAAAGAGGGCAGG + Intronic
920150253 1:203900490-203900512 TGGGGAAGTTCAGGCATGGCGGG - Intergenic
922683182 1:227617907-227617929 TAGCTAAAGACAGGGGTGGCTGG - Intronic
922863543 1:228839506-228839528 AAGCTAAGTACAGGGCAGGCCGG + Intergenic
923093425 1:230756502-230756524 TGGGTAAATACATGGATGGATGG + Intronic
923278185 1:232416369-232416391 CATGTAAGGGCAGGGATGGCAGG + Intronic
924471232 1:244344266-244344288 TAGGTAAGCACTGGGTTGACTGG - Intergenic
924477184 1:244392630-244392652 TGGGTAATTACAGTGGTGGCTGG + Intergenic
1062908360 10:1195165-1195187 TGGGGAAGGACAGGGATGGGAGG - Intronic
1063456678 10:6187979-6188001 TAGGTAGGTAAATGGATGGATGG - Intronic
1063716344 10:8530674-8530696 AAGGTAAGGACAAGGATAGCTGG - Intergenic
1063851080 10:10191310-10191332 TAGGTAGGTAGATGGATGGATGG + Intergenic
1064016188 10:11774138-11774160 TAGGTATTTAAAGGAATGGCGGG - Intergenic
1064430177 10:15263947-15263969 TAGGTAGGTAGATGGATGGTTGG - Intronic
1066679036 10:37918247-37918269 TAGGGAAACACAGGGATGACAGG + Intergenic
1068007565 10:51408761-51408783 TAGGCGATGACAGGGATGGCTGG + Intronic
1068051462 10:51954873-51954895 TAGGTAGGTACATGGTTGGGAGG - Intronic
1069319195 10:67146615-67146637 AAGGTAAGTACAGGATTGGTGGG + Intronic
1069831198 10:71283483-71283505 TGGGTAAGGACAGGGTTGGATGG - Intronic
1071032847 10:81205534-81205556 TGGGTGATGACAGGGATGGCTGG - Intergenic
1071758494 10:88573237-88573259 TAGGGAAGTCCAAGGATGCCAGG - Intronic
1074978836 10:118602793-118602815 CAGGGAGGTCCAGGGATGGCCGG - Intergenic
1075841008 10:125503330-125503352 TAGGTAACAACAGTAATGGCTGG + Intergenic
1076294550 10:129374423-129374445 TAGTCAAGGACAAGGATGGCAGG + Intergenic
1076562915 10:131378657-131378679 TACGTACGTACATGGATGGATGG + Intergenic
1077191097 11:1256223-1256245 TAGGTAAGTACAGGGATGGCTGG + Exonic
1079142725 11:17823532-17823554 TAGGTAAGTGCAGGCATATCTGG + Intronic
1080337655 11:31216673-31216695 GAGGTAAGCATTGGGATGGCTGG - Intronic
1080721504 11:34853718-34853740 TAGGGATGGAGAGGGATGGCAGG - Intronic
1081280545 11:41204435-41204457 TAGGTAAGTGCTGGGCTGGCTGG - Intronic
1081484014 11:43514169-43514191 TAGGTCAGTAAAAAGATGGCTGG - Intergenic
1083597147 11:63923432-63923454 GAGGTGAGGACAGGGATGGAGGG - Intergenic
1089395707 11:118135504-118135526 TTGGTGAGGCCAGGGATGGCAGG - Exonic
1090356018 11:126140791-126140813 GAGGTTAGTACAGGGCTGTCAGG + Intergenic
1091390280 12:122069-122091 TAGGTAAGTCTATGGAAGGCAGG + Intronic
1091856159 12:3742068-3742090 GAGGTTAGGACAGGGAGGGCTGG + Intronic
1091887610 12:4027869-4027891 GAGGTAAGGACAGAGATGGTGGG + Intergenic
1092021551 12:5206968-5206990 TAGGTAAGGAAAGGGAGGTCTGG - Intergenic
1093996173 12:25645196-25645218 CAGGTAAGTACAGGGAGAGTGGG + Intronic
1095182146 12:39158610-39158632 TAGGAAGGCACAGTGATGGCTGG + Intergenic
1097686395 12:62695068-62695090 TAGATATGTCCAGGAATGGCAGG - Intronic
1099048227 12:77750586-77750608 TGGGTAAGTACAGAGCTGGGAGG + Intergenic
1100092391 12:90986679-90986701 TAGGTTGGTACAGTGCTGGCTGG - Intronic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1101200855 12:102434656-102434678 TATATAAGTAATGGGATGGCTGG + Intronic
1102650638 12:114439877-114439899 TAGGGAAGTTCAGGGAGAGCTGG - Intergenic
1103244833 12:119447620-119447642 TAGGTAATAACAGGGATGGCAGG + Intronic
1108416773 13:50205554-50205576 TAGGGAAGAACAGGGCTGACTGG - Intronic
1108853605 13:54766167-54766189 TAGATAAATAGATGGATGGCTGG - Intergenic
1111794459 13:92900063-92900085 GAAGTAAGTACAGGGATAGTAGG - Intergenic
1111917978 13:94381657-94381679 TGGGAAAGTCCAGAGATGGCTGG - Intronic
1112258116 13:97853002-97853024 TAGGTAAGTAGATGGATGGGTGG + Intergenic
1112902848 13:104379923-104379945 TAGGTCAGCCCAGGGATAGCAGG + Intergenic
1113244155 13:108376517-108376539 AAGGAAAGGACAGGCATGGCTGG - Intergenic
1113762788 13:112861473-112861495 TACGTAAGTGCAGGGAAAGCTGG - Intronic
1115482279 14:33873041-33873063 TAGGTAAGTACAGGGACTGTAGG - Intergenic
1118285339 14:64465611-64465633 TACGTAAGTAAAGGCAGGGCGGG + Exonic
1118904487 14:70013731-70013753 TAGGAAAGTCCAGGGCTGTCTGG + Intronic
1119552463 14:75524942-75524964 TTGGTAAATAGAGGGATGGAGGG + Intronic
1125625635 15:41106888-41106910 CAGTTAAGTAAATGGATGGCAGG - Intronic
1126283704 15:46987049-46987071 TGGGCAATGACAGGGATGGCTGG - Intergenic
1127354119 15:58181824-58181846 TAGGAAAGAGCAGGGTTGGCTGG + Intronic
1128326237 15:66725933-66725955 AAGGTAAGTGAAGGGGTGGCAGG - Intronic
1130740762 15:86597196-86597218 TAGGTAAATAGATGGATAGCTGG - Intronic
1133495775 16:6315522-6315544 TGGGTGAGTACATGGATGGATGG + Intronic
1133809310 16:9148919-9148941 TAGGTAAATAGAGGGACAGCAGG + Intergenic
1136077679 16:27828133-27828155 TGGGTAGGTAGATGGATGGCTGG - Intronic
1136077698 16:27828233-27828255 TGGGTAGGTAGATGGATGGCTGG - Intronic
1136291008 16:29271272-29271294 TAGCTAAACAGAGGGATGGCTGG + Intergenic
1136753976 16:32667376-32667398 TGGGTAGGCACAGGGATTGCTGG - Intergenic
1136814137 16:33202989-33203011 TGGGTAGGCACAGGGATTGCTGG + Intronic
1136820613 16:33313069-33313091 TGGGTAGGCACAGGGATTGCTGG + Intergenic
1136827176 16:33369608-33369630 TGGGTAGGCACAGGGATTGCTGG + Intergenic
1136832242 16:33468379-33468401 TGGGTAGGCACAGGGATTGCTGG + Intergenic
1142152176 16:88517453-88517475 TAGGTAAATGGATGGATGGCTGG + Intronic
1202992713 16_KI270728v1_random:25963-25985 TGGGTAGGCACAGGGATTGCTGG + Intergenic
1144839564 17:18177496-18177518 TAGGTAGGTAAAGGATTGGCTGG + Intronic
1145246459 17:21272969-21272991 GAGGTCAGTACAGGGTTTGCAGG + Intergenic
1145831110 17:27917015-27917037 TAGGGATGTATAGGGATGACAGG + Intergenic
1147018282 17:37510162-37510184 AAGCTAAGGACAGGCATGGCCGG - Intronic
1147407911 17:40226600-40226622 TAGGTGAGCACTGGGAGGGCAGG - Intronic
1148987187 17:51633238-51633260 TAGGTAAGTAAGTGGATGGATGG - Intronic
1148995283 17:51704101-51704123 TGGGTTAGTACATGGATGGATGG - Intronic
1150963131 17:69936748-69936770 CAGGAAACTACTGGGATGGCAGG + Intergenic
1152018414 17:77767273-77767295 TAGATAAGTAGATGGATGGATGG + Intergenic
1152434815 17:80269766-80269788 TAGGTAGATACATGGATGGATGG - Intronic
1153089818 18:1330953-1330975 TGGGCAATGACAGGGATGGCTGG - Intergenic
1155293186 18:24361605-24361627 TAGGTGATTACAGAGATGGGAGG + Intronic
1156975182 18:43213125-43213147 AAGGTAAGTTCAGGCTTGGCCGG - Intergenic
1157200625 18:45656291-45656313 TAGGCAAGAAGAGGGATGGAGGG + Intronic
1158172994 18:54620267-54620289 TAGCTAAGAACAGGGAGGGCAGG + Intergenic
1159033996 18:63259625-63259647 AAGGTAACCACTGGGATGGCTGG - Intronic
1163799258 19:19355058-19355080 TAGGGCAGAACAGGGCTGGCTGG - Intronic
1164670129 19:30067755-30067777 TAGATAAGTGAATGGATGGCAGG - Intergenic
1166381886 19:42359005-42359027 TAGGGAAGTACAGGGGTGGCTGG + Intronic
1167652257 19:50738784-50738806 GAGGGAAGAACAAGGATGGCAGG - Intergenic
927699520 2:25259061-25259083 TAGGGAAGTGTAGGGTTGGCTGG - Intronic
928874104 2:36016446-36016468 CGGGTTAGTACAGAGATGGCAGG + Intergenic
929783706 2:44974186-44974208 GAGGTGAGTCCAGAGATGGCTGG - Intergenic
930397446 2:50841311-50841333 TAGGAAAATCCAGGTATGGCTGG - Intronic
933204334 2:79488081-79488103 CAGGTAAGTGCTGGGATTGCTGG - Intronic
935674528 2:105583012-105583034 GAGGTAACTGGAGGGATGGCAGG - Intergenic
935705450 2:105852537-105852559 TAGTTAAGTAAAGAGCTGGCTGG - Intronic
937234077 2:120419865-120419887 TAGGTGGGTAGAGGGATGGATGG - Intergenic
937336981 2:121068180-121068202 TAGGGAAGGACAAGTATGGCAGG - Intergenic
937852467 2:126647944-126647966 TGGGCAATGACAGGGATGGCTGG + Intergenic
938108027 2:128546581-128546603 TGGGTAGGTAAATGGATGGCTGG - Intergenic
938162441 2:128997765-128997787 TTGGGAAGTATAGGGATGCCAGG + Intergenic
938326298 2:130406379-130406401 CATCTAAGTACAAGGATGGCTGG - Intergenic
938363640 2:130715080-130715102 CATCTAAGTACAAGGATGGCTGG + Intergenic
938440022 2:131321631-131321653 CATCTAAGTACAAGGATGGCTGG + Intronic
940218906 2:151330253-151330275 TAGGAAAGTATAGAGATGGTAGG + Intergenic
943879378 2:193120231-193120253 TGGGTAAGGACAGGGAAGGCTGG + Intergenic
945056824 2:205876603-205876625 TTGGTAAGTGCAAGGAGGGCTGG + Intergenic
947440949 2:230121045-230121067 TGGGTGATGACAGGGATGGCTGG - Intergenic
1171329963 20:24328851-24328873 TTGGCAATTACAGGGGTGGCTGG + Intergenic
1173371913 20:42444078-42444100 TGGGTAGGGCCAGGGATGGCAGG - Intronic
1174200426 20:48803143-48803165 TAGGTAATAGCAGGCATGGCTGG + Intronic
1174301858 20:49588229-49588251 GAGGGAAGAGCAGGGATGGCAGG - Intergenic
1175114305 20:56671360-56671382 GAGATAAATAGAGGGATGGCTGG - Intergenic
1175770490 20:61620309-61620331 TAGGTAGGTAGATGGATGGATGG + Intronic
1175772535 20:61632752-61632774 TGGGTGAGTAGAGGGATGGATGG - Intronic
1176285846 21:5019105-5019127 GAGCTAAGCACAGGGATGCCTGG + Intergenic
1176667090 21:9697779-9697801 TGGGGAAGTAGAGCGATGGCGGG + Intergenic
1177168634 21:17631002-17631024 TTGGTAAGTACAAGGAAGCCAGG - Intergenic
1179871335 21:44244370-44244392 GAGCTAAGCACAGGGATGCCTGG - Intergenic
1181443636 22:22951912-22951934 TGGGCAAATACTGGGATGGCTGG - Intergenic
1182032266 22:27168602-27168624 TAGGTAAATGGAGGGATGGGTGG + Intergenic
1183492465 22:38123826-38123848 TAAATAAGCACAGGGATGTCAGG - Intronic
950541724 3:13617190-13617212 TAGGTAGGTAGATGGATGGATGG - Intronic
957754692 3:84470219-84470241 TGGGCAATTACAGGGGTGGCTGG - Intergenic
962228306 3:133635244-133635266 GAAATAAGTACAAGGATGGCTGG - Intronic
962938298 3:140101929-140101951 TAGGAGAGTACAGGGATGTTTGG + Intronic
964738423 3:159940571-159940593 TGGGTATATACTGGGATGGCTGG - Intergenic
965489688 3:169321058-169321080 TTGGTAAGTACAGCCATGCCAGG + Intronic
968618112 4:1591401-1591423 CTGGCAAGTACAGGGGTGGCTGG - Intergenic
968924924 4:3542108-3542130 TAGGTAGATACATGGATGGATGG + Intergenic
969501664 4:7557027-7557049 GAGGAAAGTAAAGGGATGGATGG - Intronic
969528522 4:7716695-7716717 TAGATAAGTAGATGGATGGATGG - Intronic
972806022 4:42530120-42530142 TGGGTAATGACAGGGGTGGCTGG - Intronic
973846395 4:54917494-54917516 TAGGTGAGAAAAGGGATGGTAGG - Intergenic
977305492 4:95318685-95318707 AAGGCAAGTCCAGGAATGGCAGG - Intronic
977930303 4:102743027-102743049 TGGGCAATGACAGGGATGGCTGG + Intronic
978898964 4:113926021-113926043 TGGGCAATGACAGGGATGGCTGG + Intronic
985715468 5:1457123-1457145 TAGGTAAACACTGGGTTGGCTGG - Intronic
985737276 5:1591504-1591526 TAGGGAAGAAAAGGGATTGCTGG - Intergenic
987349545 5:17009662-17009684 TAGGTAGGTACATAGATGGATGG - Intergenic
987730263 5:21761714-21761736 TAGGTAGGTAGATGGATGGATGG + Intronic
989002549 5:36776220-36776242 TGAGTAAGTACTGGGGTGGCTGG - Intergenic
989375260 5:40754355-40754377 CAGGCAAGTTCAGGGATGGAGGG + Intronic
989636025 5:43534592-43534614 TAAGTGAGCACAGGGATGCCAGG - Intronic
991539548 5:67711797-67711819 TAGATAAGCAAAGGGAAGGCTGG + Intergenic
991597522 5:68320809-68320831 TAGATAAGTAGAGAGATGACAGG + Intergenic
991946246 5:71900917-71900939 TGGGCAAGGACAGGGGTGGCTGG - Intergenic
992116342 5:73541720-73541742 AAGGTAAGTAAATAGATGGCTGG - Intergenic
995507794 5:112878743-112878765 TAGGAAGGTACAGAGAGGGCAGG + Exonic
996089333 5:119335639-119335661 TAGATATGTCCATGGATGGCTGG - Intronic
997864560 5:137449628-137449650 TCCGTAAGTACAGGGATTACAGG - Intronic
998038658 5:138937167-138937189 TAGGTCAGTCCAGTGAGGGCTGG - Intergenic
998571141 5:143259111-143259133 GAGGTGAGTACAGGGCTGTCAGG + Intergenic
998816157 5:146016345-146016367 TAGGTAAGTAGATGGATGGATGG + Intronic
999351476 5:150875624-150875646 TGGGCAATTACAGGGGTGGCTGG - Intronic
999474880 5:151889463-151889485 CAGGTAAGTAGAGGGAGGACTGG + Intronic
1000417071 5:160994693-160994715 TGGGTGATTACAGGGGTGGCTGG - Intergenic
1000419328 5:161020513-161020535 TAGATAAGTACAGAGAGGGAGGG + Intergenic
1003848461 6:10198102-10198124 TAGGGAAGAACTGGGTTGGCTGG - Intronic
1004173117 6:13314314-13314336 TAGGGAATTGCAGGGATGGGGGG + Intronic
1006088950 6:31616521-31616543 CAGGTAAGTACAGGGGAGGTTGG - Intronic
1007952401 6:45884126-45884148 TAGCCAAGTAGAGGGATGGAAGG - Intergenic
1010818731 6:80389201-80389223 TAGGTGATAACAGGGGTGGCTGG - Intergenic
1012002050 6:93665717-93665739 TGGGTGATAACAGGGATGGCTGG - Intergenic
1015394432 6:132718634-132718656 TAGGTAGGTAAAGGGAGGACAGG + Intergenic
1019103430 6:169650160-169650182 TGGATAAGTAGAGGGATGGATGG - Intronic
1019173080 6:170145838-170145860 AAGGTCAGTACAGGGCAGGCTGG - Intergenic
1020095992 7:5369678-5369700 TAGGTAATTTCAGGTATGGCTGG - Intronic
1021772489 7:24019493-24019515 TAGGTAGAAACAGGGATGGTAGG - Intergenic
1022329612 7:29365184-29365206 ACAGTAAGTACAGGGCTGGCAGG - Intronic
1022529539 7:31058217-31058239 TTGGACAGTACAGGGATGGCTGG + Intronic
1027614981 7:80411079-80411101 TAGGTCAGTTGAGGGGTGGCCGG - Intronic
1027768027 7:82370536-82370558 TAGGTAAATGGAGGGATGGATGG + Intronic
1030354638 7:108528398-108528420 TGGGGAAGTACAGGTGTGGCTGG - Intronic
1030368858 7:108674821-108674843 TGGGCAATGACAGGGATGGCTGG - Intergenic
1031648392 7:124255231-124255253 TAGTTTAGTACAGGGAATGCTGG - Intergenic
1033135504 7:138780666-138780688 TAGGCAATGTCAGGGATGGCTGG + Intronic
1033642188 7:143272191-143272213 TAGGGAAGTACAGGGAGGGAGGG - Intergenic
1034450048 7:151132424-151132446 TAGGTAAGCCCAGGGCTGCCAGG + Intronic
1034697222 7:153064596-153064618 TAGGTGAGTAGATGGATGGATGG - Intergenic
1035695263 8:1591241-1591263 TAGGGAATTACAGGGAAGGGAGG + Intronic
1038499916 8:28035353-28035375 TGGGTCAGGACTGGGATGGCTGG + Intronic
1040460614 8:47644235-47644257 TATGCAAGTAAAGGGATGGCTGG - Intronic
1042142785 8:65696255-65696277 TAGATAAACACAGGGATTGCAGG + Intronic
1042964259 8:74334254-74334276 TAGGTGGGTGCAGGGATGGATGG - Intronic
1043177159 8:77036234-77036256 TGGGTAGGTACTGGGATTGCTGG + Intergenic
1043394966 8:79827235-79827257 TATGAAAGTACAGGAAAGGCAGG - Intergenic
1044422826 8:92017816-92017838 AAGGACAGCACAGGGATGGCAGG - Intronic
1044549385 8:93495389-93495411 TGGGTAATTACAGGGAGGCCCGG + Intergenic
1045398464 8:101785638-101785660 TGGGTTAGTACAGGGAAGACGGG + Intronic
1048456479 8:134583156-134583178 AAGGTAAGTGCAGTGATGGAGGG - Intronic
1049491187 8:142903962-142903984 TGGGTGAGGACAGGGTTGGCTGG - Intronic
1049589708 8:143451868-143451890 GCGGGAAGTACAGGGATGGTAGG - Intronic
1053799972 9:41757981-41758003 TAGGTAGATACATGGATGGATGG + Intergenic
1054145215 9:61556850-61556872 TAGGTAGATACATGGATGGATGG - Intergenic
1055698809 9:78918459-78918481 TTGGTAAAAACAGGGATGGTAGG - Intergenic
1058115084 9:101076183-101076205 TTGGTTAGAACACGGATGGCTGG - Intronic
1058693463 9:107538911-107538933 GGGGTAAGTTCAGGGATGGAGGG + Intergenic
1059666830 9:116454529-116454551 TGGGTATGTAATGGGATGGCTGG - Intronic
1060178894 9:121518089-121518111 TGGGCAATGACAGGGATGGCTGG - Intergenic
1060498641 9:124136202-124136224 TAGGTAGGTAGATGGATGGATGG - Intergenic
1061846859 9:133392969-133392991 TAGGTGAGTAGATGGATGGATGG + Intronic
1061846966 9:133393381-133393403 TAGGTGAGTAGATGGATGGATGG + Intronic
1062129009 9:134882637-134882659 GAGGTAGGTGCAGGCATGGCTGG + Exonic
1062655960 9:137604869-137604891 TAGGCAGGTACCGGGAAGGCGGG + Intergenic
1062688306 9:137827752-137827774 AAGGTAAGGACCGGGAGGGCGGG - Intronic
1203659006 Un_KI270753v1:23983-24005 TGGGGAAGTAGAGCGATGGCGGG - Intergenic
1185494420 X:543501-543523 TAGGAAAGTGCTGGGATGACAGG + Intergenic
1185613394 X:1405532-1405554 TAGGTAGGTAGACGGATGGATGG + Intronic
1185613518 X:1406314-1406336 TAGGTAGGTAGATGGATGGATGG + Intronic
1185613655 X:1407233-1407255 TAGGTAGGTAGATGGATGGATGG + Intronic
1187148280 X:16657406-16657428 GATGTAAGCACAGGGATGGTGGG + Intronic
1188732570 X:33668797-33668819 TGGGTAAGAAGAGGGATGCCAGG + Intergenic
1190476515 X:50833361-50833383 TAGAAAAGAACAGGGCTGGCCGG + Intergenic
1191856687 X:65632991-65633013 TAGCTAAGCAAAGGGAGGGCTGG + Intronic
1196774515 X:119326315-119326337 TTGGTGAGTACAGCGAAGGCTGG + Intergenic
1197182198 X:123548571-123548593 TAGGCAATGACAGGGGTGGCTGG - Intergenic