ID: 1077195400

View in Genome Browser
Species Human (GRCh38)
Location 11:1277341-1277363
Sequence CCTTCCTCAGGGAGGCCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077195400_1077195415 28 Left 1077195400 11:1277341-1277363 CCCACCGGCCTCCCTGAGGAAGG 0: 1
1: 0
2: 1
3: 17
4: 185
Right 1077195415 11:1277392-1277414 TCCCGCAAGACACCCTGGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 89
1077195400_1077195413 23 Left 1077195400 11:1277341-1277363 CCCACCGGCCTCCCTGAGGAAGG 0: 1
1: 0
2: 1
3: 17
4: 185
Right 1077195413 11:1277387-1277409 ACCAGTCCCGCAAGACACCCTGG 0: 1
1: 0
2: 0
3: 5
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077195400 Original CRISPR CCTTCCTCAGGGAGGCCGGT GGG (reversed) Intronic
900103313 1:971928-971950 CCACCCTGAGGGAGGCCAGTGGG - Intronic
900265438 1:1754756-1754778 CCCACCCCAGGGAGGCCAGTGGG + Intronic
900296438 1:1953943-1953965 CATTCCTCAGGGAGGAGGGCTGG + Intronic
901061871 1:6475373-6475395 CCTTCCTCCGGGATGGGGGTGGG - Intronic
901319415 1:8330433-8330455 CCTTCCTCTGGCAGGACGGGTGG - Exonic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903420975 1:23217582-23217604 CCTTCCTCCGGGCGGGCGGGGGG - Intergenic
905969486 1:42130730-42130752 CCATCTTCAGGGGAGCCGGTGGG - Intergenic
908429619 1:64043156-64043178 CTCTCCTCAGGGAGGAAGGTGGG - Intronic
912548460 1:110467863-110467885 CCTTCCTCAGGGTGGCCATCTGG + Intergenic
912822751 1:112880990-112881012 CTTTACTGAGGGAGGCCAGTTGG + Intergenic
918216498 1:182396225-182396247 CCTCCCTCAGTGAGGACTGTAGG - Intergenic
920571602 1:207022158-207022180 CCGTGCCCAGGGAGGCCGGGCGG + Exonic
920630583 1:207647664-207647686 CCTTCCTCTTGGAGGCAGGAGGG - Intronic
920848187 1:209610936-209610958 CCTTCCTCAGTAAGGCCGTCTGG - Intronic
921295054 1:213693604-213693626 CCTTCCTCAGGCAGGCAGGGTGG - Intergenic
922228946 1:223668872-223668894 CCTTCCTCATCGAGGCTGGCAGG + Intergenic
923412664 1:233725457-233725479 CCTCCATCACGCAGGCCGGTGGG + Intergenic
924561167 1:245156859-245156881 CCTTCCTCAGCCAGGCCGCCCGG + Intronic
1064894381 10:20217555-20217577 CCTTCTGTAGGGAGGCTGGTGGG - Exonic
1067347218 10:45445302-45445324 CCTTCCTTAGAGAAGCAGGTTGG + Intronic
1067559588 10:47295577-47295599 CCTTCCTCAGGAAGGCCGACAGG - Intergenic
1070148057 10:73788972-73788994 CCTTCCCCAGGGCGGGGGGTGGG - Intronic
1072626285 10:97114266-97114288 CCTGCCTAAGGGAGGCCAGCCGG + Intronic
1073184851 10:101609710-101609732 CCCTCCCGAGGGAGGCCAGTGGG - Intergenic
1073374482 10:103021233-103021255 CCTTCGTCAGGGAGGCTGTGGGG - Intronic
1075479200 10:122764944-122764966 CTTTCCTCAGGGAGGTCAGCTGG - Intergenic
1076603168 10:131672187-131672209 CCTGCCTCAAGGAGGCCGAATGG + Intergenic
1076693113 10:132233743-132233765 CCGTCCCCTGGGAAGCCGGTGGG - Intronic
1076853641 10:133104896-133104918 ACCTCCTCAGGGAGGCCAGCAGG + Intronic
1077195400 11:1277341-1277363 CCTTCCTCAGGGAGGCCGGTGGG - Intronic
1077485309 11:2835795-2835817 CCTTCCTCATGGAGGCGGCGGGG + Intronic
1078572723 11:12473507-12473529 CTTTCCTCAGGGAAGCAGGGAGG - Intronic
1083292656 11:61698573-61698595 GCTTCCCCAGGGAAGCAGGTGGG - Intronic
1084478132 11:69400454-69400476 TCTGCCTCAGGGAGCCCAGTGGG - Intergenic
1084587209 11:70069177-70069199 CCTTGGTCAGGGAGGATGGTGGG - Intergenic
1085290436 11:75395353-75395375 CCTTCCCCAGGGATGCCAGGAGG - Intergenic
1086945601 11:92841142-92841164 CCTTCCCCAGTGAGGCAGGAGGG + Intronic
1090718817 11:129454129-129454151 CCTACCAGAGGGAGGACGGTGGG - Intergenic
1091202060 11:133788567-133788589 CTTTCCTCAAGGAGGCCTGAAGG - Intergenic
1094057017 12:26278205-26278227 CCGTCCTCAGAGAGCCCCGTGGG - Intronic
1098022365 12:66169670-66169692 CCCTCCTCAGGGAGTCGGGGAGG - Intronic
1098535803 12:71592392-71592414 CCTTACTAAGGGAGGCAGATTGG + Intergenic
1102184574 12:110937591-110937613 CCTTCCTGCTGGGGGCCGGTGGG + Intergenic
1103921029 12:124399253-124399275 GCTTCCTCTGGGAGTCCTGTGGG - Intronic
1104900313 12:132186512-132186534 CCTTCCTGGGGGTGTCCGGTGGG - Intergenic
1104914535 12:132257923-132257945 CCCTCCTCAGGGAATGCGGTGGG - Intronic
1105034592 12:132909335-132909357 CTTTTCTCAGGGAAGCAGGTGGG - Intronic
1106890172 13:34236248-34236270 CCTTCCTCTGGGAGTTTGGTAGG + Intergenic
1110392215 13:74986963-74986985 CATTCCTCAGGGAGGGAGGGGGG + Intergenic
1113379999 13:109795652-109795674 CCTTCCCCAGGAAGCCAGGTTGG - Intergenic
1113462403 13:110491365-110491387 CCTTCCTCAGGCAGGCCCTCCGG + Intronic
1115959416 14:38818962-38818984 CATTCCTCAGGGTGGCCAGGAGG - Intergenic
1118468906 14:66056815-66056837 CCTTCCTCTGGGGGGCTGGGTGG - Intergenic
1118819322 14:69334766-69334788 CCTTCCTCAGGCAGACAGGGAGG - Intronic
1122928874 14:104924154-104924176 CCTTACTCAGGGACCCCAGTCGG + Intergenic
1123814011 15:23958100-23958122 CCTACCTCAGGGTGGAAGGTGGG - Intergenic
1123995690 15:25716409-25716431 CCAGCCTCAGGTAGGCAGGTGGG - Intronic
1124003689 15:25779941-25779963 CCTGCCGCAGGCAGGCCGGGCGG + Intronic
1124604770 15:31161933-31161955 ACCTCCTCTGGGAGGCCTGTCGG + Intergenic
1125090100 15:35780593-35780615 CCTTCCTGAGGGTGGAGGGTGGG + Intergenic
1129081510 15:73045205-73045227 AGTTACTCAGGGAGGCCAGTGGG - Intergenic
1129660650 15:77551089-77551111 CCTCCCTCAGGCAGGCCGCATGG - Intergenic
1129709098 15:77811151-77811173 GCTCCCACAGGGTGGCCGGTGGG + Intronic
1130514029 15:84612111-84612133 CCTTTCTCAGGGAGCCTGGAGGG + Intronic
1132549206 16:547439-547461 CCTTCCCCGGGGAGGCCAGGTGG - Exonic
1132672724 16:1108310-1108332 CCTTCCTCAGAGTGGCCAGTGGG + Intergenic
1132786085 16:1657683-1657705 CTTACCACAGGGAGGCCAGTTGG + Intronic
1137585598 16:49662393-49662415 CCTTCCTCTTGGAGGATGGTTGG - Intronic
1138556795 16:57775591-57775613 CCTTCCTCAGGGAAGACTGAGGG + Intronic
1139281985 16:65779061-65779083 CCTTCCTCAGGGCCGGCTGTCGG + Intergenic
1140481899 16:75266486-75266508 CCAGCCTCTGGGAGGACGGTGGG - Intronic
1141665776 16:85464468-85464490 CCTTCCTCCGGGTGCCCGGCTGG + Intergenic
1143785114 17:9249997-9250019 CCTACCTCATGGTGGCCAGTGGG - Intergenic
1143867427 17:9934287-9934309 CCTTCCTGAGGCAGGATGGTGGG + Intronic
1144060462 17:11579663-11579685 CCCTCCTCAGGGAAGTAGGTGGG - Intergenic
1146392857 17:32438858-32438880 CCTTCCTCAGGGAGCCCAGTTGG - Intergenic
1146454389 17:32997702-32997724 CCATCCTCAGGGAGGCCTGGAGG + Exonic
1147456725 17:40542544-40542566 CCTCCCTAAGGGAGGCCTGGGGG - Intergenic
1148049122 17:44760482-44760504 CCTTCCTCTGGGAGGCAGGAGGG - Intronic
1148245381 17:46026686-46026708 CCTTCCTCAGGCAGGCAGCTTGG - Exonic
1148322757 17:46767391-46767413 CCAACCTCAGGGAGGTGGGTGGG - Intronic
1148347358 17:46912357-46912379 CCCTCCTCAGGGCTGCTGGTAGG + Intergenic
1148784702 17:50140407-50140429 CCTTCCCAAGGGAGGCAGGAAGG + Intronic
1151712981 17:75817376-75817398 GCTTCCTGATGGAGCCCGGTGGG - Exonic
1151733931 17:75927099-75927121 CCTGCCTCAGGCTTGCCGGTGGG + Intronic
1152073951 17:78147410-78147432 CCTTCCTTATAGAGGCAGGTGGG + Intronic
1152087146 17:78227276-78227298 CCATTCTCAGGGAGGCAGGCAGG - Intergenic
1152299441 17:79486468-79486490 CCTTCTTCTGGGAGGTCAGTTGG + Intronic
1152461662 17:80445150-80445172 CCTTCCCCAGGGAGTCAGGGAGG + Intergenic
1153599425 18:6764587-6764609 GCTGCCTCAGGGAGGCTGGCAGG - Intronic
1154201324 18:12302556-12302578 CCTGCTGCAGGGAGGCTGGTGGG - Intergenic
1158259369 18:55590161-55590183 CCTTCCTCAGGGAGACCTGGGGG - Intronic
1161382592 19:3973763-3973785 CTGTCCTCAGGAAGGCAGGTGGG - Intergenic
1161382751 19:3974835-3974857 CTGTCCTCAGGAAGGCAGGTGGG - Intergenic
1162019223 19:7861118-7861140 CCTTCCTCTGGGAGCTCCGTGGG - Intronic
1162149313 19:8633635-8633657 CCATCCTCAGGGCGGCTGGAGGG - Intergenic
1162458935 19:10802984-10803006 CCTGCCTGAGGCAGGCCGGGTGG + Intronic
1163379061 19:16952246-16952268 CATGCCTCAGGGGGGCCAGTGGG + Intronic
1166340602 19:42134624-42134646 CCATGCTGAGGGAGGCAGGTAGG + Intronic
1167300557 19:48675102-48675124 CCTTCCTCATGGTGGGCGGAGGG + Intergenic
1167842556 19:52133873-52133895 CCTACCTCAGGGTGGAGGGTGGG - Intronic
1168209988 19:54883424-54883446 CCTGCCTGAGGGAGCCCCGTGGG - Intronic
926169360 2:10541882-10541904 CCTTCGTCACTGAGGCAGGTAGG + Intergenic
928202930 2:29262669-29262691 CCTTCCGCAGGGAGGGAGATGGG - Intronic
932412437 2:71555321-71555343 CCTTGCTCAGGAAGGCTGCTGGG + Intronic
932440395 2:71731170-71731192 CATCCCTCAGGGAGGCCAGTGGG - Intergenic
932699567 2:73984190-73984212 CCCTCCTCTGGGAGGCAGGGCGG + Intergenic
935106091 2:100045064-100045086 GTTTCATCAGGGAGGCTGGTTGG - Intronic
938244974 2:129769395-129769417 CCTTCCTCAGGGGGCCGGGTGGG + Intergenic
938501165 2:131831873-131831895 GCTGCCTTAGGGAGGCCGGAAGG - Intergenic
939167404 2:138654222-138654244 CCTTCCACAGAGAGGACGGGAGG + Intergenic
941905186 2:170713064-170713086 CCTTTCCCAGGGAGGCGGGCAGG - Exonic
945443511 2:209908922-209908944 CCTTTCTCAGAGAGCCCAGTAGG + Intronic
946031254 2:216706960-216706982 GCTTCCCCAGGCAGGCAGGTTGG - Intergenic
946155064 2:217801842-217801864 CCTTCCGCAGGGATGCTGGGAGG + Exonic
947289357 2:228554858-228554880 CCTTCCTCAGGGTGGGAAGTGGG - Intergenic
947742460 2:232490895-232490917 CCTACCTCTGGCAGGGCGGTCGG + Intergenic
947932796 2:233977502-233977524 CCCTGCTCTGGGAGGCAGGTAGG - Intronic
948662402 2:239515453-239515475 CCTTCCTCAGGTAGGAGCGTGGG - Intergenic
1173815578 20:45985701-45985723 CCTTCCTCTGGGAGGCAGCTTGG - Intergenic
1174179478 20:48665942-48665964 CCTTCCTCACGGAGGCCTTCGGG + Intronic
1174446523 20:50594688-50594710 CCTTCGTCCGCGAGGCCTGTGGG + Exonic
1175229069 20:57461969-57461991 CCGTCCCCAGGGAGGCCAGGAGG - Intergenic
1175251907 20:57615054-57615076 TCTTCCTCTGGGAGGCAGGATGG + Exonic
1176234299 20:64047222-64047244 CTTTCCTGAGGGAGGCTGGCAGG - Intronic
1180670588 22:17549425-17549447 CCCTCCTGAGAGAGGCCGTTGGG - Exonic
1181086467 22:20441808-20441830 CCTTCCTCAGTGAGCCCTGGAGG - Exonic
1181466141 22:23111733-23111755 CCTTCCTCAGGGAGCCAGCAGGG + Intronic
1182431608 22:30302176-30302198 CCTGCCTTAGGGAGGATGGTAGG + Intronic
1182684055 22:32107156-32107178 CCTGCCCCAGGGAGGCAGGAAGG - Intronic
1183391378 22:37547176-37547198 CCCTGCTCAGGCAGGCCGGCTGG - Intergenic
1183606277 22:38868283-38868305 CCTATCACAGGGAGGACGGTGGG + Intronic
1183986230 22:41572042-41572064 CCTTCCACAGGGAGGGCAGCAGG + Exonic
1185010360 22:48309412-48309434 CCGTCCTCAGGAAGGCCTGGAGG + Intergenic
1185281926 22:49975937-49975959 CCTTCCCTAAGGAGGCCGGAGGG + Intergenic
1185322546 22:50208703-50208725 CCTTCTTCCGGGAGGTCAGTGGG + Exonic
1185366351 22:50438710-50438732 CCTTCTTCCCGGGGGCCGGTGGG - Exonic
953474162 3:43191977-43191999 CCTTCCTCAAGGAGGCTTATAGG + Intergenic
954265153 3:49465928-49465950 TCTGCCTCAGGCAGGCCTGTGGG + Intergenic
954754332 3:52831046-52831068 CCTTCTTCCGGGAAGCCGCTAGG - Intronic
955168787 3:56542330-56542352 CCTCACTCAGGGAGACCGCTGGG + Intergenic
961166307 3:124766221-124766243 CCGTCCTCAGGGAGCCAGGTAGG - Exonic
961827897 3:129608141-129608163 GCTTCCACAGGGTGCCCGGTGGG + Intergenic
962389196 3:134957475-134957497 CCTTCCTCCTGGTGGCCTGTAGG - Intronic
968646731 4:1744766-1744788 CCTTCCTCAGGCTGGCCTGGAGG - Exonic
968869202 4:3232957-3232979 CCCTCCTCAGTGAGGATGGTGGG + Intronic
969604434 4:8195454-8195476 CCTTCCTCTAGGAGGCTGCTGGG + Intronic
974239763 4:59231665-59231687 CCTACCTGAGGGTGGACGGTGGG - Intergenic
978398232 4:108305284-108305306 CCTCCTTCAGGGAGGCAGGGAGG + Intergenic
979978395 4:127224831-127224853 CCTTCCCCTGGGAGTTCGGTAGG + Intergenic
984889062 4:184474969-184474991 CCATCCTCAGGGTGGCCTGAAGG + Intergenic
986737837 5:10681247-10681269 CCTTCCGCAGGGACGCTGGTGGG - Intronic
991118247 5:62979446-62979468 CCTTATTCAGGGAGGAGGGTGGG + Intergenic
995637563 5:114211553-114211575 CCTACCTGAGGGAGGAGGGTGGG + Intergenic
997305035 5:132830527-132830549 GCTTCCCCCGGGAGGCCGGCGGG - Intronic
997411940 5:133697239-133697261 CCTTCCTCAGGGTGGTAGATGGG - Intergenic
1001637058 5:173217964-173217986 CCTCCCCCAGGGAGGCCTCTGGG + Intergenic
1002643051 5:180639758-180639780 CCTTCTTCAGGGCTGCAGGTGGG - Intronic
1005652091 6:27893943-27893965 CCCTCCTAATGGAGGCCGGCCGG - Intergenic
1005966149 6:30728024-30728046 ACATGCTCAGGGAGGCCAGTGGG + Exonic
1006421452 6:33936518-33936540 CTTGCCTCGGGGAGGCAGGTGGG - Intergenic
1007707674 6:43800887-43800909 GCATCCTCAGGGAGGTCGATGGG - Intergenic
1008007802 6:46430440-46430462 CCTACCTCAGAGAGGCTGCTTGG + Intronic
1008042882 6:46820500-46820522 CCTGCCTCAGGGAGGCAGATGGG + Intronic
1011970849 6:93220735-93220757 CCTTCCTGAGGGTGGAGGGTGGG + Intergenic
1013461466 6:110378699-110378721 CCTCCCTCAGGGAGTTTGGTAGG - Intergenic
1016287927 6:142493960-142493982 CCTCCCTGAGGGAGGAGGGTGGG + Intergenic
1017611638 6:156193045-156193067 CCTACCTGAGGGAGGAGGGTGGG - Intergenic
1018709763 6:166489926-166489948 CCTTCCTAAGTGAGGCCACTCGG - Intronic
1019114880 6:169751867-169751889 CCTGGCCCAGGGAGGCCGGCAGG - Intronic
1027045074 7:74985741-74985763 CCTTCCTTAGGGTGGCCTGAGGG + Intronic
1028936176 7:96466339-96466361 GCTTTCTCAGGGAAGCCTGTGGG + Intergenic
1030095241 7:105892751-105892773 CATTGCTCAGGGAGGGCTGTGGG + Intronic
1034577495 7:152013184-152013206 CCTTCCTGAGGGTGGACTGTGGG + Intronic
1034577664 7:152015016-152015038 CCTTCCTGAGGGTGGACTGTGGG + Intronic
1035644647 8:1209889-1209911 CGTTTCTCAGGGAGGGAGGTGGG - Intergenic
1038844310 8:31214552-31214574 CCTTCCTTAGAGTGGCCTGTTGG + Intergenic
1039742932 8:40398549-40398571 CCTGCCTCAGGGAGGCCCTCTGG - Intergenic
1039816659 8:41100523-41100545 CCTTTCCCAGGGAGGCTGGGTGG + Intergenic
1045010924 8:97957743-97957765 CCTTCCCCAGGGAGGATTGTGGG + Intronic
1047097426 8:121640058-121640080 CCTGCCTCCGGGCGGCCGGCGGG + Intronic
1049852961 8:144843968-144843990 CCTTCCTCAGAGAGGCAGGCTGG + Intronic
1055785336 9:79864448-79864470 CCTTCTGAAGGGAGGCCGGAAGG - Intergenic
1056105374 9:83341871-83341893 CATCCCACAGGGAGGGCGGTGGG + Intronic
1056289699 9:85130259-85130281 CCTTCCTCCAGGAGGCTGTTGGG - Intergenic
1056722418 9:89083119-89083141 CCTTCCCCATGGAGGCAGGGTGG - Intronic
1057701808 9:97368435-97368457 CCTTACTCAGGAAGCCCTGTTGG - Intronic
1059964401 9:119599680-119599702 CCAGGCTCAGGGAGGCAGGTAGG - Intergenic
1060820213 9:126657568-126657590 GCCTCCTCAGGGAGGCTGGCTGG + Intronic
1060885843 9:127151472-127151494 CCTCCCACAGGGAAGCAGGTGGG + Intronic
1061007932 9:127938649-127938671 CGTTCCTCAGGGAAGCCAGTCGG + Intergenic
1061425691 9:130496911-130496933 CCTCCCTCCTGGAGGCTGGTTGG + Intronic
1062059550 9:134487595-134487617 CCTTCCTCAGTGAGGAGGGACGG + Intergenic
1062631481 9:137464999-137465021 CCTTCCTCAGTGAGGCAGGCAGG + Intronic
1062722357 9:138051011-138051033 CCTTCCCCAGGGAGCGTGGTGGG + Intronic
1185674305 X:1836432-1836454 CCTTGCTCTGGAAGGCGGGTGGG + Intergenic
1185678367 X:1867210-1867232 CCTTGCTCTGGGAGGGAGGTGGG - Intergenic
1186848417 X:13554482-13554504 TGTTCTTCAGGGAGGCCGCTTGG + Intergenic
1188738260 X:33744554-33744576 CCTTTCTCAGGGTGGAGGGTGGG + Intergenic
1199227397 X:145394056-145394078 CCTGCCTCTGGGAGACCTGTAGG - Intergenic
1199665750 X:150095249-150095271 CCTTCCCCAGGAAGGCCAGTGGG - Intergenic
1200001927 X:153066577-153066599 CCTGCCTGAGGTAGGACGGTAGG + Intergenic
1200005805 X:153083448-153083470 CCTGCCTGAGGTAGGACGGTAGG - Intergenic