ID: 1077195514

View in Genome Browser
Species Human (GRCh38)
Location 11:1278004-1278026
Sequence GTCCTCCCGCATCAGACATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 3, 3: 3, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077195514_1077195519 17 Left 1077195514 11:1278004-1278026 CCCCATGTCTGATGCGGGAGGAC 0: 1
1: 0
2: 3
3: 3
4: 74
Right 1077195519 11:1278044-1278066 ATCGAGCAGGAGACGCACGGCGG 0: 1
1: 0
2: 0
3: 3
4: 59
1077195514_1077195518 14 Left 1077195514 11:1278004-1278026 CCCCATGTCTGATGCGGGAGGAC 0: 1
1: 0
2: 3
3: 3
4: 74
Right 1077195518 11:1278041-1278063 TCTATCGAGCAGGAGACGCACGG 0: 1
1: 0
2: 0
3: 3
4: 40
1077195514_1077195517 4 Left 1077195514 11:1278004-1278026 CCCCATGTCTGATGCGGGAGGAC 0: 1
1: 0
2: 3
3: 3
4: 74
Right 1077195517 11:1278031-1278053 TGAGATGCAATCTATCGAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077195514 Original CRISPR GTCCTCCCGCATCAGACATG GGG (reversed) Intronic
903184117 1:21619814-21619836 GGACTCCGGCATCAGAGATGGGG + Intronic
904282833 1:29433382-29433404 GTCCTCCAGCATCAGCCTTATGG - Intergenic
915128734 1:153682799-153682821 GTGCTCCCTCCTCAGGCATGGGG - Intronic
915792108 1:158683757-158683779 GTCCTTCCTCATCAGAAAAGAGG + Intronic
922009972 1:221573539-221573561 ATTCTCCCGCATCATACATAAGG - Intergenic
1068229120 10:54148272-54148294 GTCCTCCCTCAGCATCCATGTGG + Intronic
1075447037 10:122520147-122520169 TTCCTGGCGCCTCAGACATGAGG - Intergenic
1076693805 10:132237404-132237426 CTCCTCCTGAATCAGTCATGAGG + Intronic
1077028437 11:452023-452045 GTCCTCCCGCAGCACAGCTGGGG + Intronic
1077195514 11:1278004-1278026 GTCCTCCCGCATCAGACATGGGG - Intronic
1077677327 11:4206704-4206726 GTCCTCCAGCATCAGAATGGTGG + Intergenic
1083794642 11:65008123-65008145 GTGCACCAGCTTCAGACATGAGG - Intergenic
1085052197 11:73385525-73385547 GGCCTCCCGCTTCAGACATGGGG + Intronic
1088558620 11:111089529-111089551 GTCCTCACGAATCTTACATGAGG - Intergenic
1092329515 12:7570376-7570398 GTCCTCCCGCTGTAGATATGAGG + Intergenic
1094505701 12:31059395-31059417 AACCTCCCGGATCAGACAGGTGG + Intergenic
1097651549 12:62304480-62304502 TTCCACCTGCATCAGTCATGTGG - Intronic
1098556354 12:71823089-71823111 TTCCTCACGCATCAGACCGGGGG + Intergenic
1104634380 12:130428373-130428395 CTCCTCCCGCATCCTACAAGAGG + Intronic
1105972434 13:25442028-25442050 GTCCTCCAGCTTCATCCATGTGG + Intronic
1108260067 13:48647085-48647107 GTCCTCCCTGATAACACATGTGG - Intergenic
1111660051 13:91198373-91198395 GTCCTTCAGCCTCATACATGTGG - Intergenic
1112506170 13:99977398-99977420 GGGCTCCCGCACCACACATGTGG + Intergenic
1117920414 14:60722232-60722254 GTCCTCCCGAGTCAGACACTTGG - Intronic
1118063829 14:62168898-62168920 TGCCTCTAGCATCAGACATGGGG + Intergenic
1119122769 14:72095106-72095128 GTACCTCCGCATCAGCCATGTGG + Intronic
1120620331 14:86755201-86755223 AAGCTCCAGCATCAGACATGAGG - Intergenic
1122391515 14:101390776-101390798 GTCGTCCCTCAGCATACATGGGG - Intergenic
1122509443 14:102254674-102254696 GACCTTCTGAATCAGACATGTGG - Intronic
1125162392 15:36660911-36660933 TTCCTCCCAAATTAGACATGAGG + Intronic
1127892161 15:63262591-63262613 TTCCCCCCGCCTCAGAGATGGGG - Intronic
1129751602 15:78069122-78069144 GTCCACCCCCCTCAGACGTGAGG + Intronic
1129959920 15:79675017-79675039 GTCATACTGCATAAGACATGGGG - Intergenic
1134062104 16:11205574-11205596 GTCCTCCCACATCTGCCATGGGG - Intergenic
1139101880 16:63777603-63777625 GTACTCCCCCACCAGTCATGGGG + Intergenic
1143352728 17:6300460-6300482 GTCCTCCCTCATCATCCATGGGG - Intergenic
1144945534 17:18967778-18967800 GTCCTGCCCCATCAGACTAGAGG - Intronic
1144952432 17:19001476-19001498 GTCCTCCAGCCTCGGACAGGTGG - Intronic
1150124698 17:62628344-62628366 GTCCTAACGCATCAGTCCTGGGG - Intronic
1152108220 17:78342763-78342785 TTCCTCCTGCATCAGGCCTGGGG + Intergenic
1152305867 17:79519846-79519868 GTCCTCTCGCAGCAGCCATGCGG - Intergenic
1155837738 18:30608101-30608123 ATCCTCCTGCATAAGCCATGTGG - Intergenic
1160071039 18:75628035-75628057 TTCCTCCTGCTCCAGACATGAGG - Intergenic
1160122074 18:76139846-76139868 GACCTCCAGCTTCAGACATAAGG + Intergenic
1161354967 19:3813836-3813858 GTCCTCCCGCATCAGAGGTGAGG + Exonic
1161988930 19:7673009-7673031 GGCCACCAGCATCAGACAGGGGG - Intergenic
1162585298 19:11554501-11554523 GTCCTCCTGCATCAGGACTGAGG - Intronic
1167144380 19:47673090-47673112 GTCCTGCCTCCCCAGACATGAGG - Intronic
1167877490 19:52426512-52426534 TTCCTCCCGCATCACAGCTGAGG + Intergenic
925091341 2:1158402-1158424 CTCCTCCCCCACCAGAAATGGGG - Intronic
937707540 2:124938385-124938407 GTCCAAACACATCAGACATGCGG + Intergenic
952553323 3:34503482-34503504 GACATCCAGCATCAGGCATGTGG - Intergenic
954609553 3:51937140-51937162 GCCCTCCCGGATCCGCCATGGGG + Intronic
959335265 3:105056871-105056893 TTCCTCCTGCATCAGCCAGGTGG + Intergenic
960702519 3:120451424-120451446 GGCCTCCCCCTTCAGCCATGGGG - Intergenic
965133569 3:164732711-164732733 GTCCTCCCTTAGCACACATGGGG - Intergenic
969152837 4:5185035-5185057 CTCCTCCAGCGTCAGACGTGAGG + Intronic
974552348 4:63394966-63394988 TTCATCCATCATCAGACATGTGG - Intergenic
975189859 4:71447718-71447740 TTCCTACCTCATCAGACATCAGG - Exonic
975747730 4:77491435-77491457 GTCCTCCAGCTGCAGACATATGG - Intergenic
978980182 4:114935312-114935334 GTCCTCCCTCGACAGACTTGTGG - Exonic
980420186 4:132548592-132548614 TTCTTCCCGCACAAGACATGCGG + Intergenic
984603375 4:181755032-181755054 TTTCTCCTGTATCAGACATGAGG + Intergenic
995106609 5:108382328-108382350 CTCCTCCCGCCTCAGAAACGCGG - Intergenic
1001872287 5:175167303-175167325 ATCCTCCCACATCAGACATGCGG - Intergenic
1007799556 6:44380726-44380748 GCCATCCTGCATCAGGCATGTGG - Intergenic
1025092832 7:56077737-56077759 GTGCTCAGGCATGAGACATGGGG + Intronic
1034316948 7:150142002-150142024 GTCCTCCAGCCCCAGCCATGGGG + Intergenic
1034789916 7:153958684-153958706 GTCCTCCAGCCCCAGCCATGGGG - Intronic
1040306022 8:46212251-46212273 GTCCACCCGCGTCAGTCCTGGGG - Intergenic
1040422646 8:47254661-47254683 GTCCACCAGCTTCATACATGTGG - Intergenic
1040536134 8:48312506-48312528 GTCCTCCAGGATCATCCATGAGG - Intergenic
1048110396 8:131461772-131461794 GATCTCCAGCATCAGAAATGAGG + Intergenic
1048585989 8:135774566-135774588 GTCCTCCAGAATCATTCATGTGG - Intergenic
1049605628 8:143528001-143528023 GGCCTCCAGCACCGGACATGGGG + Intronic
1056516658 9:87358749-87358771 ATCCTCCAGCAGCAGCCATGTGG + Intergenic
1057397284 9:94691386-94691408 TTCATCCATCATCAGACATGAGG - Intergenic
1059682506 9:116599807-116599829 TTCCTCCTCCATCTGACATGGGG - Intronic
1062001407 9:134217601-134217623 GCCCGTCCGCATCAGCCATGGGG - Intergenic
1199084742 X:143615693-143615715 GTCCTGCCCCAACAGAGATGAGG - Intergenic
1199190908 X:144969501-144969523 GTCCTCCTGCCTCAGGCAAGAGG + Intergenic