ID: 1077195625

View in Genome Browser
Species Human (GRCh38)
Location 11:1278648-1278670
Sequence GTGTGGGTGTGGAGGAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1201
Summary {0: 1, 1: 0, 2: 8, 3: 148, 4: 1044}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077195625_1077195637 17 Left 1077195625 11:1278648-1278670 CCACCTTTCCTCCACACCCACAC 0: 1
1: 0
2: 8
3: 148
4: 1044
Right 1077195637 11:1278688-1278710 CACTGGACACCTCACCTCACTGG 0: 1
1: 0
2: 0
3: 22
4: 421
1077195625_1077195638 18 Left 1077195625 11:1278648-1278670 CCACCTTTCCTCCACACCCACAC 0: 1
1: 0
2: 8
3: 148
4: 1044
Right 1077195638 11:1278689-1278711 ACTGGACACCTCACCTCACTGGG 0: 1
1: 0
2: 1
3: 8
4: 120
1077195625_1077195633 0 Left 1077195625 11:1278648-1278670 CCACCTTTCCTCCACACCCACAC 0: 1
1: 0
2: 8
3: 148
4: 1044
Right 1077195633 11:1278671-1278693 CTGCCTCTTGTCCTGGCCACTGG 0: 1
1: 0
2: 4
3: 34
4: 333
1077195625_1077195639 19 Left 1077195625 11:1278648-1278670 CCACCTTTCCTCCACACCCACAC 0: 1
1: 0
2: 8
3: 148
4: 1044
Right 1077195639 11:1278690-1278712 CTGGACACCTCACCTCACTGGGG 0: 1
1: 0
2: 0
3: 20
4: 189
1077195625_1077195630 -7 Left 1077195625 11:1278648-1278670 CCACCTTTCCTCCACACCCACAC 0: 1
1: 0
2: 8
3: 148
4: 1044
Right 1077195630 11:1278664-1278686 CCCACACCTGCCTCTTGTCCTGG 0: 1
1: 0
2: 2
3: 40
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077195625 Original CRISPR GTGTGGGTGTGGAGGAAAGG TGG (reversed) Intronic
900200045 1:1400444-1400466 GTGGGGGTGAGGAGCAATGGTGG - Intronic
900488752 1:2935885-2935907 GTGTGGGTGGGGGGGAGGGGCGG + Intergenic
900658538 1:3772084-3772106 GTGTGGGTGGGGAGCAGAGAAGG - Intergenic
900736109 1:4300400-4300422 GGGTGGGTTGGTAGGAAAGGTGG + Intergenic
900787622 1:4658660-4658682 GTGGGGGTGAGCATGAAAGGGGG - Intronic
900810541 1:4798429-4798451 GTCAGTGTGTGGTGGAAAGGTGG + Intergenic
900864237 1:5255843-5255865 GTGTGGCTGTGGAGGAGTGGTGG + Intergenic
901306829 1:8238943-8238965 GTATGGAGGTGGAGGCAAGGAGG + Intergenic
901338848 1:8476461-8476483 GAGGGTGGGTGGAGGAAAGGAGG + Intronic
901453811 1:9352076-9352098 GTGAGGGGGTGGAGGGAAGGTGG + Intronic
901625447 1:10622117-10622139 GTGAGGGTGTGGAGGGGTGGAGG - Intronic
902218097 1:14947324-14947346 GTGAGGATGTGGAGGGAAGCAGG + Intronic
902239242 1:15077374-15077396 GTCAGGGAGTGGAGGACAGGAGG - Intronic
902396083 1:16133066-16133088 GTGCAGGTGTGGGGGGAAGGTGG + Intronic
902676622 1:18013185-18013207 GAGTGGGGGAGGAGGAAAGCTGG - Intergenic
902717364 1:18281914-18281936 TTGGGGGTGTGGTGGAAAGAGGG + Intronic
902906726 1:19563802-19563824 TTTTGGGTGGGGAGGAAAAGCGG + Intergenic
902917502 1:19647542-19647564 GTGTGGGGGGAGAGGAAAGGTGG + Intronic
902974940 1:20081670-20081692 GTGTGAGAGTGAGGGAAAGGTGG + Intronic
903157723 1:21459597-21459619 GTGTGTATGAGAAGGAAAGGGGG + Intronic
903226630 1:21897445-21897467 GTAGGGGTGGGGAGGGAAGGGGG - Intronic
903231064 1:21922633-21922655 GTGGAGGTGTGGGGGGAAGGAGG + Intronic
903233860 1:21937329-21937351 GGGCGGGCGGGGAGGAAAGGGGG - Intergenic
903975360 1:27146217-27146239 GAGGCGGTGAGGAGGAAAGGAGG + Intronic
904376426 1:30085198-30085220 GTGTGGGAGATGAGGAAAGAAGG - Intergenic
904501915 1:30917778-30917800 GTGAGGGGGTAGAGGAGAGGAGG - Intergenic
904570547 1:31461061-31461083 CTGTGGATGTGAAGGTAAGGAGG + Intergenic
904605650 1:31696317-31696339 GGGTGGGTGGGGGGGGAAGGAGG - Intronic
905114996 1:35630922-35630944 ATGTGGGTGAGGAGGAATGTGGG + Intronic
905492172 1:38353201-38353223 GAGTGGCTGTGGGGGAACGGGGG - Intergenic
905498740 1:38418935-38418957 GTGGGGGTGGTGAGAAAAGGTGG + Intergenic
905894747 1:41538238-41538260 GTGTGGGTGGGGAGGTCTGGAGG + Intronic
905930455 1:41783232-41783254 GTGTGGGTGTTGGGGCCAGGAGG + Intronic
906054504 1:42904654-42904676 ATGTGGGTCTGAAGTAAAGGTGG + Intergenic
906098210 1:43238498-43238520 GTGGGGGTCTGGAGGATTGGAGG + Intronic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
906536642 1:46554507-46554529 GTGGGGGTGGGGAGGAACAGTGG + Intergenic
906662131 1:47590534-47590556 GTGTGTGTGTGTATGAAATGGGG + Intergenic
906718699 1:47989739-47989761 GTGTGTGTGTGTTGGAATGGTGG - Intronic
907503990 1:54903887-54903909 GTGGGGGTATGGAAGAGAGGAGG - Intergenic
907784968 1:57602780-57602802 GTGTGTGTGTGGAGGGGAGTGGG + Intronic
907856389 1:58307768-58307790 GAGTGGGGGTGGAGGAGGGGAGG + Intronic
908928909 1:69292163-69292185 GTGTGTGTGTGTAGGGAAGCTGG + Intergenic
909449669 1:75784520-75784542 GTGTGTGTGGCGAGGAGAGGGGG + Intronic
910450049 1:87335223-87335245 AGGTGGGGGTGGAGGAAAGACGG - Intronic
910847902 1:91621423-91621445 TTGGGGTTGTGGTGGAAAGGAGG - Intergenic
910873019 1:91852285-91852307 GTGTGTGTGTGGAGGTGGGGTGG - Intronic
910991203 1:93058379-93058401 GGGTGTGTGTGGAGGAAGTGGGG + Intergenic
911037460 1:93565995-93566017 GTGTCTGTGTGGAGGAAGGCTGG - Intronic
911473248 1:98344477-98344499 GTGTGTGTGTGGAGGCGGGGTGG - Intergenic
912075717 1:105873132-105873154 GCCTGGGTGTGGAGCAAAGAAGG + Intergenic
912823537 1:112885908-112885930 GTGTGGGGGTGGGGGCAGGGAGG - Intergenic
913272384 1:117107253-117107275 GTGTGGGTGTTGGGGATTGGGGG - Exonic
913294618 1:117306988-117307010 GTGTGGGTGTGCATGCAAGAGGG - Intergenic
913345420 1:117804520-117804542 GTGTGGGGGAGGGGGAAATGAGG + Intergenic
913544501 1:119853791-119853813 GTGTGTATGAGAAGGAAAGGGGG - Intergenic
913602300 1:120433587-120433609 GTGTGTATGTGAAGGAAAGGCGG + Intergenic
914084746 1:144443050-144443072 GTGTGTATGTGAAGGAAAGGCGG - Intronic
914363474 1:146957193-146957215 GTGTGTATGTGAAGGAAAGGCGG + Intronic
914488203 1:148129941-148129963 GTGTGTATGTGAAGGAAAGGCGG - Intronic
914588567 1:149085061-149085083 GTGTGTATGTGAAGGAAAGGTGG - Intronic
914956216 1:152165028-152165050 AAGTGGGAGTGGAGGAAATGGGG + Intergenic
914986681 1:152463821-152463843 GTGTGTGTGTGTAGGAAAGGGGG - Intergenic
915013587 1:152712777-152712799 GAGTGGGAATGGAGGTAAGGAGG + Intergenic
915474797 1:156147219-156147241 GGGTGAGTGTAGAGGAAAGTAGG - Intergenic
915488091 1:156235993-156236015 GAGTGTGTGTGGAGGAAAGGAGG + Intronic
915570858 1:156744444-156744466 GGGTGGGGGTGGGGGAGAGGCGG - Intronic
916034125 1:160905967-160905989 TTTTAGGGGTGGAGGAAAGGAGG - Intergenic
916288355 1:163135773-163135795 GGGTGGGGTTGGAGGAAGGGAGG - Intronic
916360348 1:163961109-163961131 TTGTGGGGGTGGGGGAAGGGGGG - Intergenic
916420693 1:164635104-164635126 GTGGGGGTGGGGAGAAAAGGAGG + Intronic
916495338 1:165341351-165341373 GAGTGGGAGTGTAGGAAAAGAGG - Intronic
916677039 1:167072852-167072874 GCCTGGGGGTGGAGGAAAGTGGG + Intronic
916744163 1:167671475-167671497 GAGTGAGTGTGGAGGAGAGCAGG - Intronic
916820401 1:168392777-168392799 GGTTGGGTGGGGAGGATAGGTGG + Intergenic
917109366 1:171529401-171529423 CTGTGGGTATGCAGGAAAGGTGG - Intronic
917309413 1:173663044-173663066 GTGTGTGTGTGTTGGAAGGGTGG - Intronic
917511382 1:175671939-175671961 GTGTGTGTGTGTTGGAGAGGGGG + Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
917779002 1:178371313-178371335 GTGTGTGTGTGTGGGAAAGAAGG - Intronic
917798944 1:178552949-178552971 GGCTGGGTGGGGAGAAAAGGAGG + Intergenic
918039960 1:180907984-180908006 GTGTGTGTGTGGAGTGAAGCAGG + Intergenic
918538019 1:185595996-185596018 GTCAGGGAGTGGAGGACAGGAGG + Intergenic
918673931 1:187258099-187258121 GTGGGGGTTTGGAGGGGAGGTGG - Intergenic
918824223 1:189301034-189301056 GGGTGGGCCTGGAGGAAAGAAGG - Intergenic
918991081 1:191697436-191697458 GTGTGAGAGTGGAGGAAAACTGG + Intergenic
919167618 1:193916057-193916079 GTGAGAGTGTGGAGGGAAGTAGG - Intergenic
919403984 1:197152793-197152815 GTGTGTGTGTGGAGGGGTGGGGG + Intergenic
919450167 1:197762697-197762719 GGGTGGGGGTAGAGGAAATGAGG - Intronic
919766119 1:201128222-201128244 GTGACTGTGTGGCGGAAAGGAGG - Intergenic
919879697 1:201893531-201893553 CTGTGGATGGGGAGAAAAGGAGG - Intergenic
919981336 1:202644215-202644237 GTACGGGTGTGGGGGAGAGGAGG + Intronic
920165358 1:204031796-204031818 GAGAGGGTGAGGAGGAAAGCTGG + Intergenic
920337800 1:205256957-205256979 GTGGGGGTGGGGGGCAAAGGGGG - Intronic
920389443 1:205589952-205589974 GTGTGGGAGGTAAGGAAAGGAGG + Intronic
920548118 1:206835612-206835634 GTGTGGCCGTGGAGGAGAGGAGG - Intronic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
921793109 1:219312379-219312401 TTGAGGGAGAGGAGGAAAGGAGG - Intergenic
921882580 1:220271920-220271942 GTGTGGGGGTGGGGGGAGGGAGG + Intronic
922222080 1:223616318-223616340 GTGTGGATGTGTAGGAAGGTAGG - Intronic
922290503 1:224205533-224205555 GTGTGAGTGTGGATGTCAGGTGG + Intergenic
923026519 1:230208853-230208875 ATGTGGGGGTGGAGGATCGGGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923374499 1:233347050-233347072 GTGTGTGTGTAGAGGAGCGGGGG + Intronic
923622958 1:235592864-235592886 GTGTTGCAGTGGAAGAAAGGAGG - Intronic
924726715 1:246678270-246678292 GTGGGGGTGGGGAGGAGAGGTGG - Intergenic
1062974411 10:1672742-1672764 GTGTGTGCGTGGAGGGAGGGAGG - Intronic
1063015582 10:2073749-2073771 ATGTGGGTATGGAGTCAAGGTGG - Intergenic
1063083400 10:2790110-2790132 GTGTGGTTTTGGAGGGATGGTGG - Intergenic
1063157240 10:3391013-3391035 ATGTGGGGATGGAGGAATGGGGG + Intergenic
1063594180 10:7418619-7418641 GTGTGTGTGTGAAGCGAAGGAGG + Intergenic
1063639064 10:7813351-7813373 GAGAGGTTGAGGAGGAAAGGTGG - Intergenic
1063943752 10:11157381-11157403 GTGTGTGTGTGGGGGGAGGGCGG - Intronic
1063982708 10:11468633-11468655 GCGTGGGAGTGGAGGGGAGGAGG + Intronic
1063999710 10:11653487-11653509 GTGTGGGTTTGAAGAAATGGTGG - Intergenic
1064017645 10:11785027-11785049 ATGTGGCTGTGTTGGAAAGGGGG - Intergenic
1064262474 10:13797213-13797235 CTGGGAGTGTGGTGGAAAGGCGG - Intronic
1064283410 10:13971008-13971030 GTGTGGGACAGGAGGCAAGGCGG - Intronic
1064289517 10:14020859-14020881 CTGTAGAGGTGGAGGAAAGGGGG + Intronic
1064354113 10:14602990-14603012 GTGTGTGTGTGTGGGAAAGAGGG - Intronic
1064936091 10:20680536-20680558 GTGTGTGTGTGGAGGCGGGGGGG + Intergenic
1065394745 10:25222426-25222448 GTGTGGATGTGAGGGAATGGGGG - Intronic
1065659144 10:27987691-27987713 GTTTGAGTGTGGAAGAAAGTGGG - Intronic
1065773482 10:29099144-29099166 GTGTGTGTGTGCAGGTAGGGAGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066350936 10:34636316-34636338 GTGTGGGTTTGGATGACAGAGGG - Intronic
1066514108 10:36136735-36136757 GTGGGGGCTTGGAGGAGAGGTGG - Intergenic
1066731263 10:38439068-38439090 ATGAGAGTGTGGAGGGAAGGGGG + Intergenic
1067132241 10:43575119-43575141 TTGTGGGTGTGTAGGACTGGAGG + Intergenic
1067175588 10:43943480-43943502 GTGTGGGTGGGGAAGTGAGGTGG + Intergenic
1067343109 10:45419842-45419864 GGGTGCCTGTGGAGGAAGGGAGG + Intronic
1067781655 10:49211968-49211990 TGGAGGGAGTGGAGGAAAGGAGG + Intergenic
1068496099 10:57786948-57786970 ATGTGGGTAAGAAGGAAAGGAGG - Intergenic
1068540839 10:58293511-58293533 TGGTGGGGGTGGGGGAAAGGGGG + Intergenic
1068620667 10:59177346-59177368 GTGTGTGTGTTGGGGGAAGGGGG - Intronic
1068923133 10:62506377-62506399 GTGTGGGTATGGCTGAAAAGGGG - Intronic
1068969174 10:62945285-62945307 GAGTGGGGGTGGGGGAGAGGAGG - Intergenic
1068997670 10:63225989-63226011 GAGTGTATGTGGAGGGAAGGGGG - Intronic
1069244639 10:66188568-66188590 GTGTGTGTGTGGGGGGAGGGGGG + Intronic
1069907335 10:71739594-71739616 GAGCAGGTGTGGAGGAGAGGTGG - Intronic
1069950429 10:72014788-72014810 GTCTGGGGGTGGGGGAAAGGAGG - Intergenic
1069976385 10:72216444-72216466 GGGTGGGCGTGGAGAAAAAGTGG - Intronic
1069994991 10:72336503-72336525 GAGTGAGTGTGGGGGGAAGGCGG - Exonic
1070773437 10:79096149-79096171 GGGTGGGTCTGGAGGAGAGGGGG + Intronic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1072731712 10:97850653-97850675 GTGTGTGAGGGGAGGGAAGGCGG + Intronic
1072756491 10:98024784-98024806 GTGTGTGTGTGGTGGAGAGGTGG - Intronic
1072864910 10:99048589-99048611 GTGAGGCTGTAGAGAAAAGGGGG + Intronic
1073119138 10:101111009-101111031 GGGTGGGGGTGGAGAAAAGTAGG + Intronic
1073192573 10:101662258-101662280 GGGTGGGTTTTGGGGAAAGGAGG - Intronic
1073305399 10:102499985-102500007 GTGTGTGTGTGGAGAGAAGTGGG + Intronic
1073327067 10:102649335-102649357 GTGGGGTTGTTGGGGAAAGGAGG + Intronic
1073348705 10:102803544-102803566 GTGTGTTTGTTGGGGAAAGGAGG + Intronic
1074228283 10:111508811-111508833 GTGTGTGTGTTTAGGATAGGAGG - Intergenic
1074585310 10:114762618-114762640 GTAAGGGTGAGGAGGGAAGGTGG - Intergenic
1075242776 10:120793264-120793286 GTGTGTGTGTGGGGGGGAGGGGG - Intergenic
1076516176 10:131045549-131045571 GAGAGGGGGAGGAGGAAAGGAGG + Intergenic
1076568175 10:131412941-131412963 GTGTGGGGCCGGGGGAAAGGCGG + Intergenic
1076613757 10:131743130-131743152 GGGAGGCTGTGGAGGAAGGGAGG - Intergenic
1076744046 10:132503945-132503967 CTGGGGGTGTGGTGGACAGGTGG - Intergenic
1077194467 11:1272337-1272359 GTCTGGGTGGGGAGGCGAGGAGG + Intergenic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1077305574 11:1867334-1867356 GTGTGGGTGTGGTGGGTGGGTGG - Intronic
1077317329 11:1925334-1925356 ATGTGGGGGTGGGGGAGAGGGGG + Intronic
1077351070 11:2093395-2093417 GGCTGGGTGATGAGGAAAGGGGG + Intergenic
1078741050 11:14066707-14066729 ATGTGGCTGTAAAGGAAAGGTGG - Intronic
1078918783 11:15807244-15807266 CTGTGGCTGTGGAGGAGGGGTGG - Intergenic
1078919892 11:15819980-15820002 CTGTGGGTGTGGAGTCAAGCAGG - Intergenic
1079152509 11:17913248-17913270 GTGTGGGGCTGGAAGAAAGTGGG - Intronic
1079314848 11:19398808-19398830 GTGTGTCTGTGGGGGGAAGGAGG - Intronic
1079333637 11:19552887-19552909 GTGTGTGTGGGGGGGAAGGGGGG + Intronic
1079951346 11:26808867-26808889 GTGTGTGTGTGTAGGAAGAGGGG + Intergenic
1080619426 11:33974654-33974676 GTGTGTGTGTTGGGAAAAGGAGG - Intergenic
1080836413 11:35944465-35944487 TTGTGTGTGTTGAGGAACGGAGG + Intronic
1080896671 11:36453902-36453924 GGGAGGGTTTGGAGGACAGGAGG + Intronic
1081432961 11:42996691-42996713 GTGTGTGTGTGGAGGGCGGGGGG - Intergenic
1081577219 11:44326784-44326806 GCGTGTGTGTGGAGGGAGGGAGG + Intergenic
1082684275 11:56219462-56219484 GTGTGGGGGTGGAGCCAAGATGG + Intergenic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083295027 11:61710557-61710579 GGGTGGTTGTGGATTAAAGGAGG + Intronic
1083339347 11:61948878-61948900 GTGTGGGGGTGGGGGACAAGGGG + Intergenic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1084144353 11:67256201-67256223 GCGTGTGTGTGGAGGGAGGGAGG + Exonic
1084424072 11:69074984-69075006 GTGATGATGTGGAGGAAGGGCGG + Intronic
1084458798 11:69284880-69284902 GTGTGTGGGTGCAGGAGAGGAGG - Intergenic
1084523857 11:69684010-69684032 CTGTTTGTGTCGAGGAAAGGGGG + Intergenic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085027554 11:73245428-73245450 GGGTGGGGGTGGAGGAGAGGAGG + Intergenic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085131804 11:74046227-74046249 GGGTGGATAAGGAGGAAAGGAGG - Intronic
1085554719 11:77410135-77410157 GTGCTGATCTGGAGGAAAGGAGG - Intronic
1085753505 11:79184543-79184565 GTGTGGGGGTGGAGGTTAGGGGG + Intronic
1086222962 11:84471738-84471760 GTGAGGGAGTTGAGGAAGGGAGG - Intronic
1086226348 11:84514672-84514694 GTGGGGGTGAGGAGGAGAGGTGG + Intronic
1086398807 11:86443935-86443957 GTGAGGCTGAAGAGGAAAGGAGG - Intronic
1086398858 11:86444318-86444340 GTGAGGTTGGAGAGGAAAGGAGG + Intronic
1086497505 11:87419734-87419756 TTGTGGGTGTGGGAGGAAGGAGG - Intergenic
1086931889 11:92702587-92702609 GTGTGTTTGTGGAGGACAAGGGG - Intronic
1088190719 11:107225528-107225550 GTGTGTGTGTGTATGGAAGGAGG - Intergenic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1088395386 11:109362247-109362269 GAGTGGGGGTGGTTGAAAGGGGG + Intergenic
1088549369 11:110995658-110995680 GTGTGTGTGTAAAGCAAAGGTGG - Intergenic
1088595749 11:111439038-111439060 GGGTGGGTGTGCGGGACAGGGGG - Intronic
1088605930 11:111532087-111532109 GTGTGTGTGTGGAGTAGGGGTGG - Intronic
1089398982 11:118153531-118153553 GCGTGGGGGTGGGGGAAGGGAGG - Intergenic
1089575862 11:119442668-119442690 GTGGGGGTGGGGAGGAAGGGTGG - Intergenic
1089895795 11:121929021-121929043 ATGTGAGTGTGGAGGAGAGGGGG + Intergenic
1090153202 11:124406782-124406804 GTGTGTGTGTGGTGAGAAGGAGG - Intergenic
1090251240 11:125253423-125253445 GTGTGAGTGAGGAGGAGAGGAGG + Intronic
1090499488 11:127247629-127247651 GTTTGGGAGTGTATGAAAGGTGG - Intergenic
1090977119 11:131687860-131687882 GTGTGGGGCTGGAGGATACGTGG - Intronic
1091446554 12:546999-547021 TTGTGGGTGTGGAGAAACGGGGG - Intronic
1091615953 12:2051941-2051963 GGGTGGATGTGGAGGCGAGGAGG + Intronic
1091776979 12:3191076-3191098 TTCGGGGTGTGGGGGAAAGGGGG + Intronic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1092046510 12:5434761-5434783 CTGTGTGTGTGAGGGAAAGGTGG + Intronic
1092071850 12:5637711-5637733 GTGGGGCTAGGGAGGAAAGGAGG - Intronic
1092156031 12:6282069-6282091 GTGAGGGGGAGGTGGAAAGGAGG - Intergenic
1092183027 12:6458961-6458983 GTGTGGAGGTGGGGAAAAGGAGG - Intronic
1092942594 12:13424168-13424190 GTGTGTGTGTGCAGGTAAGTAGG - Intergenic
1093262031 12:16950440-16950462 GTGTGGGTGATGAAGAAAGGAGG - Intergenic
1093549352 12:20389228-20389250 GTGTGTGTGAGGAGGAAAGGGGG + Intronic
1093782809 12:23156254-23156276 TTGTGGGGGTGGGGGGAAGGGGG - Intergenic
1093809316 12:23472866-23472888 GCCTGGGTGTGGAGGAAAAAGGG - Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094043385 12:26141267-26141289 GTTTGGGGATGGAGGAAGGGAGG + Intronic
1094284030 12:28772355-28772377 GTGTGGGGTTTGAGCAAAGGGGG + Intergenic
1094344250 12:29449266-29449288 GTGTGTGTGTGTAGGGAGGGGGG - Intronic
1095319614 12:40810532-40810554 GTTAGGGTGTGGTGGAAATGGGG - Intronic
1095737880 12:45577318-45577340 GTGTGTGTGTGTAGGAGAGGTGG - Intergenic
1096086820 12:48870820-48870842 GTGGGGTTGAGGAGGAAATGGGG + Intergenic
1096155133 12:49337301-49337323 GTGGGGGAGTGGAGGGGAGGCGG - Intergenic
1096245151 12:49980612-49980634 GTCTGGGTGGGGTGGAAAAGAGG + Intronic
1096580019 12:52579062-52579084 GTGTGTGTGAGGGGAAAAGGGGG - Intergenic
1096649286 12:53054047-53054069 GTGTGGGGCCGGCGGAAAGGGGG - Intronic
1096988406 12:55777995-55778017 GTGTGGGTGTGGGGGAAACTGGG + Intronic
1097101365 12:56592025-56592047 GTGAGTGTTTGGAGGAAAGGAGG + Exonic
1097232426 12:57520783-57520805 GGGGGGGAGGGGAGGAAAGGGGG + Intronic
1097338832 12:58414748-58414770 GGGGGGGTGGGGAGGGAAGGAGG + Intergenic
1097341620 12:58444710-58444732 GTGTGGGTGAGTGGGAAGGGAGG + Intergenic
1097619067 12:61918288-61918310 GTGTGCGGGTGGGGAAAAGGGGG - Intronic
1097966352 12:65585659-65585681 GAGTGGAGCTGGAGGAAAGGAGG - Intergenic
1098072386 12:66689817-66689839 GTCTGGGAGTGGGGGAAATGGGG - Intronic
1098923691 12:76326503-76326525 GAGTGAGTGTGGAGTAAATGTGG - Intergenic
1098932443 12:76435392-76435414 GTTGGGGAGTGGAGGAAATGGGG + Intronic
1098998490 12:77149331-77149353 GTGTGTGTGTTGAGGGAGGGAGG - Intergenic
1099040463 12:77646706-77646728 TTGGGGGTGTGCAGGATAGGAGG + Intergenic
1099941604 12:89195630-89195652 TTGTGGGGGAGGAGGAAGGGAGG - Intergenic
1100125122 12:91415476-91415498 GTGTGTGTGTGTAAGAATGGAGG + Intergenic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1101119182 12:101561638-101561660 GTGTGTGTGTGTAGGGAATGTGG - Intergenic
1101652477 12:106690066-106690088 GTGTGTGTGTTGTGGGAAGGGGG + Intronic
1102576925 12:113861504-113861526 GTGTGTGTGTGAAGGAGAGAAGG + Intronic
1102701118 12:114840219-114840241 GTGAGGGGGTGGATGAAAAGAGG + Intergenic
1102867924 12:116388952-116388974 GTGTGTGTGTGGCGGGAGGGTGG - Intergenic
1102925877 12:116826059-116826081 GTGGGGGTGGGGAGGAAGGGAGG - Intronic
1103425474 12:120830326-120830348 GTGGGGGGGAGGTGGAAAGGAGG + Intronic
1103615555 12:122149422-122149444 GTGGGGCAGGGGAGGAAAGGGGG + Intergenic
1103839856 12:123853620-123853642 GGATGGGTGTGGCGGAAGGGTGG + Intronic
1103856803 12:123976328-123976350 GTGTTAGTGTGGAGGAAAGTGGG + Intronic
1103909479 12:124344470-124344492 GTTTGGATGTGGTGGAAAGCGGG + Intronic
1103993879 12:124816669-124816691 GTGGGGGTGTGGAGGAGGGGAGG + Intronic
1104291510 12:127473369-127473391 GGGTGGGGGTGGAAAAAAGGGGG + Intergenic
1104707618 12:130959154-130959176 GTGTGGCCGTGGTGGAAAGTAGG - Intronic
1104953887 12:132454500-132454522 GTGTGGGGGTTGAGGGAACGGGG + Intergenic
1105391914 13:19987589-19987611 GTGTGTGTGTATAGGAAAGATGG + Intronic
1105391918 13:19987649-19987671 GTGTGTGTGTATAGGAAAGATGG + Intronic
1105607315 13:21936898-21936920 GTGTGTGTGTGTAGAGAAGGTGG + Intergenic
1106051637 13:26195779-26195801 GTGTGGGTGTGTAAGAAGGGAGG - Intronic
1106393313 13:29356556-29356578 ATGTGGGTGGACAGGAAAGGGGG + Intronic
1106456994 13:29936229-29936251 GTGTGGGTGTGGAGAGCAGTGGG + Intergenic
1106782690 13:33075404-33075426 GTGTGTGTGTGTAGGTAAGTCGG - Intergenic
1107332039 13:39311766-39311788 GTGAGGGAGCCGAGGAAAGGGGG + Intergenic
1107638842 13:42420456-42420478 GTGTGCGTGGGAGGGAAAGGAGG + Intergenic
1109582229 13:64355692-64355714 GTGTGGGTGGGGTGGGGAGGTGG + Intergenic
1109668050 13:65564947-65564969 GGGTGGGGGAGGGGGAAAGGGGG + Intergenic
1109838245 13:67887043-67887065 GTAGGTGTGTGGAGGAATGGGGG - Intergenic
1110035971 13:70684365-70684387 GTGTGGGAGTGGGGAAGAGGAGG + Intergenic
1110210020 13:72960627-72960649 GTGTGTGTGTGGGGAAAGGGTGG - Intronic
1110596678 13:77327146-77327168 GAGGGGGTGGGGAGGAAAAGGGG - Intergenic
1111642096 13:90981486-90981508 GTGTGGGTGTGCTGGAGAGGGGG - Intergenic
1111987680 13:95081261-95081283 ATGTGGATGTGGAGAAAAGGGGG - Intronic
1112117414 13:96371614-96371636 GTCTGGGAGTGGGGGAAATGGGG - Intronic
1112182702 13:97100562-97100584 GTGTGTGTGAGAAGGAAAGAAGG + Intergenic
1112883485 13:104138050-104138072 GTGTGTGTGTGGTGGTATGGGGG + Intergenic
1113030696 13:105990748-105990770 GGTTGGGTGTGGAGGATGGGGGG - Intergenic
1113106102 13:106772851-106772873 GTGTGTGTGTGGAGGGAGAGGGG - Intergenic
1113333192 13:109352033-109352055 GTGTGTGTGTGGAGGTGAGAGGG + Intergenic
1113343468 13:109448994-109449016 GTGTGCGTGTGGAGCGAGGGAGG - Intergenic
1113445631 13:110364279-110364301 GTGTGGCTTTGGAGCAAAGGTGG + Intronic
1113520419 13:110936654-110936676 GTGTGGGCGGGGCGGCAAGGCGG + Intergenic
1113959548 13:114119055-114119077 GGGTGGGTCAGGAGGAAAGCGGG - Intronic
1114376739 14:22154808-22154830 GTGTGGGTGGGGGGTAATGGAGG - Intergenic
1114552678 14:23542427-23542449 GGGTGGGTGTCCAGGAGAGGAGG + Intronic
1114690398 14:24575100-24575122 GTGTAAATGAGGAGGAAAGGAGG - Intronic
1115446718 14:33498980-33499002 GTGTGTGTGTGGTGGGAAGGGGG + Intronic
1115653339 14:35419689-35419711 GTGTGGCTGTGCAGGAAGGAGGG + Intergenic
1115755899 14:36525553-36525575 GGGTGGGTGTGAGGGAAGGGTGG + Intergenic
1116015822 14:39405496-39405518 GGGGGGGTGTGGAGGCATGGTGG + Intronic
1117125333 14:52617180-52617202 GTGTGTGTGTGAGGGAATGGTGG - Intronic
1117326991 14:54678505-54678527 GTGTGTGTGTGTAGGTCAGGTGG + Intronic
1117340862 14:54790009-54790031 GTGTGTGTGTGGAGCAAGGCTGG - Exonic
1117593403 14:57300512-57300534 GTGTGTGTGTGTAGGTGAGGTGG - Intergenic
1117732279 14:58735445-58735467 GTGTGTGTGTGTAGGAAAGAGGG - Intergenic
1118098085 14:62562311-62562333 GTCTGGGAGTGGAGGAAGTGAGG + Intergenic
1118284748 14:64461370-64461392 GTGAGGATGTGGAGGCAGGGAGG - Intronic
1118810330 14:69268510-69268532 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
1118892638 14:69922767-69922789 GTGTGTGTGTAGGGAAAAGGAGG + Intronic
1118906705 14:70028697-70028719 TGGAGGGAGTGGAGGAAAGGTGG + Intronic
1119266335 14:73265039-73265061 GAGGGGGTGTGGAGGACCGGAGG + Intronic
1119289295 14:73482062-73482084 GTATTTGTGGGGAGGAAAGGAGG + Intronic
1119483834 14:74975729-74975751 GTGTATGTGTGGTGGGAAGGAGG - Intergenic
1119492276 14:75045804-75045826 GTGTGTATGTGTAAGAAAGGGGG - Intronic
1119586725 14:75842707-75842729 GGGTGGGGGTTGGGGAAAGGAGG + Intronic
1119642528 14:76325919-76325941 CTGTGGGTGTGCAGCACAGGCGG - Intronic
1119647293 14:76356992-76357014 GGGTGCATGTGGAGGAGAGGGGG - Intronic
1120265480 14:82244124-82244146 GTGTGGATTTGGAGGAAGGATGG - Intergenic
1120746969 14:88160862-88160884 GGGTGGATGGGAAGGAAAGGAGG - Intergenic
1122093566 14:99355149-99355171 GTGTGGGAGTGGAGGACATGGGG - Intergenic
1122253116 14:100454365-100454387 GTGTGAGGGTGGAGGTGAGGAGG + Intronic
1122278025 14:100605191-100605213 CTGTGGGTGTTGGGGAAGGGGGG + Intergenic
1122348273 14:101073598-101073620 GTGTGGGGGTGGCGGGGAGGAGG + Intergenic
1122371908 14:101233643-101233665 GTGTGGGTGAGGGCGGAAGGTGG - Intergenic
1122403020 14:101478672-101478694 GGGTGGGTGTGGGGGCCAGGCGG - Intergenic
1122405375 14:101497675-101497697 GTGGGGGTGGGGAGGCACGGGGG - Intergenic
1122606064 14:102948256-102948278 GGGTGGGGGTGGAGGTGAGGGGG + Intronic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606092 14:102948324-102948346 GGGTGGGTTTGGAGGTGAGGGGG + Intronic
1122606105 14:102948352-102948374 GGGTAGGTGTGGAGGTGAGGGGG + Intronic
1122606239 14:102948677-102948699 GGGTGGGTGTGGAGGTGAGGGGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122651490 14:103229359-103229381 GTGTGGGGCAGGAGGAAGGGAGG - Intergenic
1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG + Intergenic
1122879470 14:104683603-104683625 GTGTGTGTGTGGTGGGGAGGGGG - Intergenic
1122891728 14:104735142-104735164 CTGTGTGTGAGCAGGAAAGGGGG + Intronic
1123038416 14:105480614-105480636 GTGTGGCTGAGGAGGGAAGGGGG + Intergenic
1123827826 15:24101309-24101331 GTGTGGGTCTGGGAGAAAGGAGG + Intergenic
1123842282 15:24260720-24260742 GTGTGGGTCTGGGAGAAACGAGG + Intergenic
1123857314 15:24426782-24426804 GCGTGGGTCTGGGAGAAAGGAGG + Intergenic
1124216630 15:27812920-27812942 GTGGGGAGGAGGAGGAAAGGAGG - Intronic
1124230574 15:27942489-27942511 GTCTGGGGGTTGGGGAAAGGGGG + Intronic
1124791544 15:32731705-32731727 GTGAGGAGGAGGAGGAAAGGAGG - Exonic
1124872324 15:33555340-33555362 GGGAGGGTATGGAGCAAAGGAGG + Intronic
1125689465 15:41584778-41584800 GTGTGGGGGTAAGGGAAAGGAGG + Intergenic
1125719542 15:41838760-41838782 GAGTGGGTGTGGAGCTTAGGTGG + Exonic
1125910395 15:43432753-43432775 GTGTGTGTGTAGTGGCAAGGGGG + Intronic
1126688488 15:51268249-51268271 GGATGGGTGTGGAGGAAGGATGG - Intronic
1126858002 15:52857654-52857676 TTGTGGCTGTGGAGAAAGGGAGG + Intergenic
1126938978 15:53744817-53744839 ATGAGGAAGTGGAGGAAAGGTGG + Intronic
1126971151 15:54113097-54113119 GGTTGAGTGTGGAGGAGAGGTGG - Intronic
1127221794 15:56887595-56887617 GTGTGGGGAGGAAGGAAAGGTGG + Intronic
1127525352 15:59787080-59787102 GGGTGCGTGTTGAGGAGAGGCGG + Intergenic
1127559085 15:60118100-60118122 GTGTGGGTGGGGAGGTAGGTGGG + Intergenic
1127578144 15:60312615-60312637 GGTTGGGTGTGGAGGTGAGGAGG + Intergenic
1127656087 15:61057582-61057604 GTGTGGGGGTGCAAGAAAGATGG - Intronic
1128039888 15:64562901-64562923 GTGTGTGTGTCTAGGAGAGGGGG + Intronic
1128112798 15:65087129-65087151 GTCTGGGTGCTGAGGAACGGGGG + Intergenic
1128530448 15:68441555-68441577 GTGGTGGTGTGGAGGAGGGGTGG + Intergenic
1128608197 15:69054045-69054067 GTCTGGGTGTAGAGGAAGAGAGG + Intronic
1128693638 15:69744317-69744339 GAGTGGGAGAGCAGGAAAGGAGG + Intergenic
1128874006 15:71187219-71187241 GAAAGGGTGTGGAGGAAGGGAGG - Intronic
1128969289 15:72092900-72092922 GTGTGTGTGTGTAAGTAAGGTGG - Intronic
1129152440 15:73697351-73697373 GTGTGTGTGTGTAGGAGTGGAGG + Intronic
1129164596 15:73769285-73769307 GAGTGGGTGGGGAGCAAATGGGG + Intergenic
1129687837 15:77696590-77696612 GTGAGGATGAGGAGGATAGGGGG - Intronic
1129692680 15:77722753-77722775 GCGTGGGTGTAGAGGAAAGAGGG + Intronic
1129758225 15:78111499-78111521 GGGTGGGTGTGGTGGAAATAGGG - Intronic
1130006997 15:80109171-80109193 GTGGTGGTGTGCAGGTAAGGTGG + Intronic
1130095215 15:80850666-80850688 TTGAAGGTGTGGAGGGAAGGGGG + Intronic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130355478 15:83126082-83126104 GTGTGGGGGTGCATGCAAGGTGG + Intronic
1130437832 15:83919675-83919697 GTGTGGGTGTGGGTGAAGGGTGG + Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1130533580 15:84766729-84766751 GTGTGTGTGTGTAAGAAAAGGGG + Intronic
1130570569 15:85039459-85039481 GTGAGGATGTGGAGGAGAGAAGG + Intronic
1130929330 15:88411509-88411531 GGGTGGGTGTCCAGGAAAAGAGG - Intergenic
1130977234 15:88786460-88786482 GTGTGTGTGTTGGGGAGAGGGGG - Intergenic
1131015991 15:89058291-89058313 GTGTGGGTGTGGAGGAAGCTTGG - Intergenic
1131065101 15:89429642-89429664 GTGTGTGTGTGGAGCAACAGTGG - Intergenic
1131229019 15:90646997-90647019 GAGTGGGTGTGGAGGAGTTGGGG - Intergenic
1131708814 15:95029637-95029659 GTGTGGTTTAGGAGGTAAGGTGG - Intergenic
1131784846 15:95901321-95901343 GTGTGTGTGTGAAGGAAGTGGGG + Intergenic
1131865325 15:96702601-96702623 GTGTGGGTATGGGGGAGGGGCGG + Intergenic
1131951447 15:97685881-97685903 GTGTGTGTGTGTATGAAATGAGG - Intergenic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133034462 16:3027205-3027227 TGGTGGGTGTGGAGGATCGGAGG - Exonic
1133405215 16:5518859-5518881 GTGTGGGAGTGGGGGTTAGGGGG - Intergenic
1133421437 16:5650343-5650365 GTGGTGGTGTGGAGGGAGGGAGG + Intergenic
1133732117 16:8586900-8586922 GTGTGGGAGTTGAGGAAAGGTGG - Intronic
1133845472 16:9449306-9449328 GGTTGGGGGTGGAGGAAAGATGG + Intergenic
1133847417 16:9468287-9468309 GTGAGGGTGTAGATGAATGGGGG - Intergenic
1133866025 16:9644134-9644156 GTGGGGGTGCAGAGGAAAGAGGG + Intergenic
1133897078 16:9940072-9940094 GTGTGTGTGTGTGTGAAAGGTGG + Intronic
1134842445 16:17412586-17412608 GTGGGGGTGGGGAAGAAAAGAGG + Intronic
1134858052 16:17537168-17537190 GGTTGGGGGTGGAGGAAATGTGG + Intergenic
1135162296 16:20107776-20107798 GTGTAGGTGTGGAGGAGAAGGGG - Intergenic
1135394783 16:22122925-22122947 GTGTGTGTGTGGTGGAGATGTGG + Intronic
1135656303 16:24253438-24253460 GTGGGAGTGTGGAGGCAGGGAGG - Intergenic
1135686098 16:24499471-24499493 GTGCGTGTGTGGAGGAAGGAAGG - Intergenic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136016301 16:27403242-27403264 CTGTGCATGTGGAGGAGAGGAGG + Intronic
1136382182 16:29900799-29900821 GCGGGGGTGGGGAGGAAAGGGGG + Exonic
1136588413 16:31202368-31202390 GTGTGGGTGGAGGGGAAAGACGG + Intronic
1137447246 16:48539381-48539403 GGGTGGGTGTGGAAGAAGGGAGG + Exonic
1137819914 16:51434450-51434472 GAGTTGGATTGGAGGAAAGGGGG + Intergenic
1138190545 16:55010272-55010294 GTTTGGGTATGAAGAAAAGGTGG + Intergenic
1138307915 16:55995113-55995135 GGGTGGGTGGGGAGGAGGGGCGG + Intergenic
1138419804 16:56891954-56891976 GTGGGGCTGTGGAGGCCAGGTGG + Intronic
1138595977 16:58029121-58029143 GTGGGCCTGTTGAGGAAAGGCGG - Intronic
1138707704 16:58934568-58934590 GTGGGGGTGGGGAGGAAGGAAGG - Intergenic
1138945764 16:61847870-61847892 GTGTGTGTGTGTAGGATAGTTGG - Intronic
1140202224 16:72903976-72903998 GTGTGGCGGAGGAGCAAAGGTGG - Intronic
1141292154 16:82728338-82728360 GTGTCGCTGGGGAGGAAAAGTGG - Intronic
1142043008 16:87907332-87907354 CTGTGTCTGTGGGGGAAAGGGGG + Intronic
1142224856 16:88872366-88872388 GGGTGGGTGGGGGGGAAGGGCGG + Intergenic
1142321571 16:89386501-89386523 ATGAGGGTGTGGGGGAAAGGGGG + Intronic
1142622160 17:1172077-1172099 GTGTGTGTGGGGAGGAAGGAAGG + Intronic
1142676791 17:1518410-1518432 AGGTGGGTGAGGAGGAAAGGGGG + Exonic
1143057529 17:4173496-4173518 GTGAGGGTGAGGAGGAGTGGAGG - Intronic
1143072964 17:4312877-4312899 GTGTCAGTGTGAAGGTAAGGTGG + Intronic
1143137427 17:4719696-4719718 ATGTGGGTGAGCAGGAAAGGAGG + Intronic
1143329317 17:6121840-6121862 GTGAGGCTGTGGAGGCCAGGAGG + Exonic
1143373441 17:6454357-6454379 GTCTGGGTGGGCTGGAAAGGAGG - Exonic
1143968137 17:10771673-10771695 GTTTGGGTGTGGATTATAGGAGG + Intergenic
1144032660 17:11336325-11336347 ATGTGGGTATGGGGTAAAGGAGG + Intronic
1144249435 17:13400717-13400739 ATGGGGGTGAGCAGGAAAGGAGG + Intergenic
1144511810 17:15883480-15883502 CTGTGGTTCTGGAGGAGAGGAGG + Intergenic
1144576881 17:16435139-16435161 GTGTGGGTGGAAAGGAAAGGAGG - Intronic
1144764762 17:17726289-17726311 GAGTGGGTGTGTGGGAAGGGTGG - Intronic
1145264746 17:21374360-21374382 GTGTGTGTGTGTGGGAAGGGGGG + Intergenic
1145782154 17:27570485-27570507 TGGTGGGTGTGGAGGAATAGAGG - Intronic
1145912218 17:28549374-28549396 GAGGGGGTTTGGAGGAGAGGAGG - Intronic
1146519658 17:33516422-33516444 GTGTGTGTATGGAGGAGGGGTGG + Intronic
1146572876 17:33968133-33968155 ATGGGGATGTGGAGGAAGGGAGG - Intronic
1146679111 17:34794386-34794408 TTGCGGGTGTGGAGGAAATCGGG - Intergenic
1146710998 17:35041282-35041304 GTGTGTGTGTTGAGGGGAGGAGG - Intronic
1146794864 17:35773821-35773843 GTGTCAGAGTGGAGGAGAGGTGG + Intronic
1147134128 17:38425528-38425550 GTGAGGGGGTAGAGGAGAGGAGG - Intergenic
1147309871 17:39589159-39589181 TTGGGGGTGTGGAGGAAAATGGG - Intergenic
1147314234 17:39611970-39611992 GAGTGTGTGTGGAGGGGAGGTGG + Intergenic
1147331312 17:39700824-39700846 GTGTGTGTGTGGTGGAGTGGAGG + Intronic
1147686747 17:42290474-42290496 GAGTGGGTATGGAGGAAGAGAGG + Intronic
1147882889 17:43665352-43665374 GGGTGGGTGGGGAGGTCAGGAGG + Intergenic
1147923740 17:43934149-43934171 GTATGGGGAGGGAGGAAAGGGGG - Intergenic
1148349253 17:46928064-46928086 GCGGGGGTGTGGAGGTATGGGGG - Intronic
1148435986 17:47685609-47685631 GTATGTGTGTGGGGAAAAGGAGG + Intergenic
1148481029 17:47959472-47959494 GGGTGGGTGTGCATGAGAGGAGG - Intergenic
1149155663 17:53626851-53626873 GTCTGGTTGTGGAGGAAATAGGG + Intergenic
1149330412 17:55575713-55575735 GTGTGGGTAGGGAAGAAATGAGG - Intergenic
1149431959 17:56601333-56601355 GTGTGGGTTGGGGGTAAAGGAGG - Intergenic
1149659351 17:58326279-58326301 CTGAGGGTGGTGAGGAAAGGAGG - Exonic
1150161054 17:62898458-62898480 TTGTGGGAGTGCAGGAGAGGTGG + Intergenic
1150577441 17:66442595-66442617 GTGTGGGTGATGAGGAGAGGCGG - Intronic
1150689878 17:67355959-67355981 GTGTGTGTGTGTAGAAATGGGGG - Intronic
1151042758 17:70882788-70882810 GAGTTGGTGTGGAGGACGGGAGG + Intergenic
1151104188 17:71593292-71593314 GTGTGTGTGTGGAGGGAATAGGG + Intergenic
1151128879 17:71875235-71875257 GTGGGGGTGTGATGGGAAGGTGG + Intergenic
1151476853 17:74349042-74349064 TTGTGGAAGTGGAGGAAAGGAGG + Intronic
1151580466 17:74974779-74974801 GAGCGGGTGTGGAGGGAAAGAGG + Intergenic
1151658094 17:75504920-75504942 GGGTGGGTGCGGAGGGGAGGCGG + Exonic
1151855087 17:76715306-76715328 CTGTGGGCGTGGGGGTAAGGAGG + Exonic
1152077733 17:78169264-78169286 GTGTGTGTGTGGCGGGGAGGGGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152279386 17:79376363-79376385 GTGTGGGTGGAGAGGGAAGGTGG + Intronic
1152889743 17:82873714-82873736 GTCTGGGTGTGGAGGGCTGGGGG + Intronic
1152901935 17:82947316-82947338 GTGGGTGTGTGGAGGGAAGGTGG - Intronic
1153376982 18:4391854-4391876 GTGTAGATGTGGAGGGAATGAGG - Intronic
1153985503 18:10347195-10347217 GTGTGGGTGGGGTGGGGAGGAGG + Intergenic
1154430453 18:14304204-14304226 GTGTGGGTGAGGATGAAACATGG + Intergenic
1155567135 18:27147617-27147639 GTGTGGGTGTGGACCAATGAAGG - Intronic
1155753548 18:29460130-29460152 GTGTGTGTGTGTTGGAAGGGTGG + Intergenic
1156310018 18:35913231-35913253 GTGTGTGTGTGGTGGGATGGGGG - Intergenic
1156455250 18:37289554-37289576 GTCTGGCTGTGGGGGAAGGGAGG - Intronic
1156463657 18:37335503-37335525 GTGTGTGTGTGGAGGTGTGGGGG + Intronic
1156627819 18:38931017-38931039 GTGTGTGTGTGGAGGTGGGGAGG + Intergenic
1157268561 18:46250481-46250503 GTGTGTGTGTGTACGAATGGAGG - Intronic
1157469358 18:47976701-47976723 GTGTGTGTGTGGAGGGGCGGGGG + Intergenic
1157480772 18:48052214-48052236 GTGGGGCTGTGGTGGAAGGGTGG + Intronic
1157515310 18:48306995-48307017 GTGGGAGAGTGGAGGGAAGGTGG - Intronic
1157607816 18:48937296-48937318 GTGTGTGTGTGTAGGAAGTGAGG + Intronic
1157632443 18:49112128-49112150 GTGGGGGTGCGGAGGGGAGGGGG - Intronic
1157692728 18:49697219-49697241 GTGTGGGTGGGCAAGAAAGTGGG - Intergenic
1157918470 18:51692741-51692763 GTGTGTGTGTGGAGGGGAGGGGG + Intergenic
1157966542 18:52215231-52215253 GTGTGTGTGTGGTGGAGAGAAGG - Intergenic
1158120000 18:54038426-54038448 GTGTGTGTGTGGGGGAGGGGAGG - Intergenic
1158662531 18:59401396-59401418 GTCTGTGTGTGTAGGAAGGGTGG + Intergenic
1158767786 18:60476082-60476104 GTGTGGGTGGGTGGGAAGGGAGG - Intergenic
1158769934 18:60503558-60503580 GTTTGGGGGTGGGGGAAATGTGG - Intergenic
1159039000 18:63305464-63305486 GTGTGTGTGGGGAGGAAAGTAGG + Intronic
1159365750 18:67464172-67464194 CTGGGGGTGTGGTGGAAAGATGG + Intergenic
1159507392 18:69354802-69354824 ATGTGGGAGTGGATGAAAGGAGG - Intergenic
1159559940 18:69983452-69983474 GGGGGAGTGGGGAGGAAAGGAGG - Intergenic
1159688929 18:71460714-71460736 GTGTGTGTGTGGAGGTGGGGTGG + Intergenic
1159730892 18:72026202-72026224 GTGTGGGACTGGAGGAAGGTGGG - Intergenic
1159797614 18:72863804-72863826 GTGTGTGTGTGGGGGGAAGGTGG + Intronic
1160136969 18:76280567-76280589 GGGTGGGTGTGGAGGGACGTGGG - Intergenic
1160191837 18:76721338-76721360 CTGTTTGTGGGGAGGAAAGGAGG - Intergenic
1160425714 18:78777886-78777908 GTGTGGATGTGGAGGAAGACAGG - Intergenic
1160591462 18:79947184-79947206 GTGAGTATGTGGAGGAAAAGCGG - Intronic
1160825360 19:1077767-1077789 ATGGGGGTGGGGAGGAAAGGAGG + Intronic
1162172776 19:8804554-8804576 GAGGTGGTCTGGAGGAAAGGTGG - Intergenic
1162198103 19:9001160-9001182 GTGTGGGTGTGCATGAATGAGGG - Intergenic
1163034882 19:14564592-14564614 GTGAGGGCGTGGTGGACAGGAGG - Intronic
1163128201 19:15255826-15255848 GTTTGGTTGGGGAGGATAGGCGG - Intronic
1163758523 19:19120729-19120751 GTGTGGGGGTGGAGGAGGGGCGG - Intronic
1164230659 19:23284870-23284892 ATGTCAGTGTGGAGGAAAGAAGG + Intergenic
1164496854 19:28773537-28773559 GTGTTCATTTGGAGGAAAGGAGG + Intergenic
1164531485 19:29051656-29051678 TTGAGGGTGTGGAGGGGAGGAGG - Intergenic
1164806578 19:31121571-31121593 GTGCGGATGTGGAGGAGAGAGGG - Intergenic
1165104487 19:33460883-33460905 GGATGGGGGTGGAGGGAAGGTGG + Intronic
1165105087 19:33464496-33464518 GTGGGGGTGGGGAGGAAACGAGG - Intronic
1165320003 19:35079437-35079459 GTGAAGGTGGGGAGGAGAGGAGG - Intergenic
1165469744 19:35996372-35996394 GTGTGTGTGTGGTGGCAGGGGGG - Intergenic
1165489359 19:36114421-36114443 GGGCGAGTGTGGGGGAAAGGGGG + Intronic
1166318912 19:42004316-42004338 GTGAGGTTGGGGAGGAGAGGTGG - Intronic
1166810161 19:45509505-45509527 GTGGTGGTGGGGAGGACAGGGGG - Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167267917 19:48492795-48492817 GTGTGGGTCTGGAAGGAAAGAGG - Intronic
1167533442 19:50033337-50033359 GAGTGGATGAGCAGGAAAGGGGG + Intronic
1167620995 19:50560617-50560639 GTGTTGGTGTTGAGGAAAACTGG + Intronic
1168078333 19:53992331-53992353 GTGTGTGTTTGGAGGAGATGTGG - Exonic
1168302680 19:55415309-55415331 GTGTGGATGTGGAGGGTAGGAGG - Intergenic
1168618320 19:57856027-57856049 GGGTGGGTGTGTGGGAGAGGTGG + Intronic
1168625130 19:57912244-57912266 GTGTGGGTGTGTGGGAGAGGTGG - Intronic
925055187 2:851804-851826 GTGTGTGTGTAGGGGCAAGGGGG + Intergenic
925257502 2:2502795-2502817 GTGGGGGTGCAGAGGAAATGTGG - Intergenic
925291212 2:2749808-2749830 GTGTGTGTGTGTAGGGATGGGGG + Intergenic
925291246 2:2749933-2749955 GTGTGTGTGTGTAGGGATGGGGG + Intergenic
925398237 2:3552543-3552565 GTGGTGGTGTGGAGGGGAGGGGG - Intronic
925398248 2:3552568-3552590 GTGGTGGTGTGGAGGGGAGGGGG - Intronic
925474699 2:4200073-4200095 TTTTGGGTATGGAGGAAAGTGGG + Intergenic
925718670 2:6807859-6807881 CTGGGGGTGTGGAGGTAAAGGGG - Intergenic
925747137 2:7052828-7052850 GTGTGTGTGTGTTGGAAAGGGGG - Intronic
925907094 2:8546053-8546075 GCGTTGATGTGGAGGGAAGGGGG + Intergenic
926031673 2:9596203-9596225 ATATGGGGGTGGGGGAAAGGAGG - Intronic
926193519 2:10745770-10745792 GCCTGGGGGAGGAGGAAAGGAGG - Intronic
926608554 2:14922510-14922532 GTGAGGATGTAAAGGAAAGGTGG - Intergenic
926641705 2:15244610-15244632 GGGTGGGTGTGGGGGAAACAGGG + Intronic
926881369 2:17548201-17548223 GTGTGGGGGTGGGGGAAATGTGG - Intronic
926913975 2:17876373-17876395 GTGGGTGTGTGGGGAAAAGGAGG + Intergenic
927098955 2:19772233-19772255 GGGTGGCAGTGGAGGATAGGAGG + Intergenic
927275525 2:21259268-21259290 GTGTGTGTGTGTCGGGAAGGGGG + Intergenic
927291833 2:21412357-21412379 GTGTGTGTGTGGAGGGGGGGTGG - Intergenic
927378655 2:22450948-22450970 GTGTGGATGTGGCGGATCGGCGG + Intergenic
927454932 2:23241234-23241256 GTGTGGGCTTGGTGGAATGGTGG + Intergenic
927684141 2:25159265-25159287 GAGAAGGTGTGGGGGAAAGGAGG + Intergenic
927888766 2:26735198-26735220 GTGTGTGTGTGTTGGAAAGTTGG - Intergenic
928098876 2:28423308-28423330 CTGCAGGTGTGCAGGAAAGGTGG + Intergenic
928219233 2:29389437-29389459 GTGTGTGTTTGGAGAACAGGTGG + Intronic
928287345 2:30004439-30004461 GTGGGGGTGAGGAGGAAAAAAGG - Intergenic
928549730 2:32358063-32358085 GTGGGGGTGGGGAGGGAAGTAGG + Intronic
928593695 2:32841167-32841189 GTGTGGGTTAGGTGGAATGGTGG + Intergenic
928659543 2:33487446-33487468 ATTTGGGTGTGCAGGAAAGGAGG + Intronic
928826338 2:35425917-35425939 GTTTTGGAGTGGAGGAGAGGAGG - Intergenic
929723015 2:44390519-44390541 GTGTGTGTGTGGGGGGGAGGTGG + Intronic
930576086 2:53150517-53150539 GTGTGGGTGGGGAGAGAGGGAGG + Intergenic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931255537 2:60569055-60569077 GTGTGGGTCTTTGGGAAAGGAGG - Intergenic
931797744 2:65727929-65727951 GTGTGTGTGTGGGGGCAGGGGGG + Intergenic
931800020 2:65749083-65749105 GTGTGCATGTGGAGCACAGGAGG + Intergenic
931825152 2:65992532-65992554 GTGTGTGTGTCGAGGATGGGGGG + Intergenic
931881363 2:66574428-66574450 GTGGGGGGGGGGTGGAAAGGGGG + Intergenic
931969447 2:67569367-67569389 GTGTGTGTGTTGGGGAATGGGGG + Intergenic
932036395 2:68251733-68251755 GAGTGAGTGTGGAGGGGAGGGGG + Intronic
932120816 2:69098074-69098096 GTGTGGGAGTGGAGGTAGGGAGG + Intronic
932344256 2:70985364-70985386 TTGTGGGTGGCGAGGAAAGGGGG + Intronic
932361880 2:71115810-71115832 GTTGGGGGGTGGGGGAAAGGGGG + Intronic
932424146 2:71618728-71618750 GTGTGTATGTGGAGTAGAGGTGG + Intronic
932429231 2:71664084-71664106 GTGTGTGTGTAGGGGGAAGGGGG - Intronic
932638864 2:73421014-73421036 GTGTGTGTGTGATGGGAAGGTGG - Intronic
932701330 2:73993979-73994001 CTGTGGGTGTGGTGGGTAGGTGG + Intronic
932725441 2:74176073-74176095 GTGTGTGTGTGTAGTAGAGGCGG - Intronic
932741602 2:74295127-74295149 GTGTGTGTGTGTTGGAGAGGGGG + Intronic
932814298 2:74849516-74849538 ATCTGGGAGAGGAGGAAAGGAGG - Intronic
933356676 2:81218994-81219016 GTGTGGGGCTGGAGGGGAGGTGG - Intergenic
933498910 2:83087408-83087430 GTGTGTGTGTGGTAGAGAGGTGG - Intergenic
933762790 2:85684737-85684759 GTGTGTGTGTAGTGGAATGGGGG + Intergenic
934522200 2:95026486-95026508 GGGTGGGGGTGGAGGAGATGGGG + Intronic
935412530 2:102780709-102780731 TTGTGGGTGTGGAGGGGATGTGG + Intronic
935691328 2:105734873-105734895 GTGGGGGTGTGCAAGAAATGTGG - Intergenic
935716742 2:105945925-105945947 GTGTGGGTGTAGGGGGATGGTGG + Intergenic
935998343 2:108798798-108798820 GTGTAGGTGTGGAGAGGAGGAGG - Intronic
936037253 2:109122862-109122884 GTGTGGGTGTGAAAGAAACAGGG - Intergenic
936573105 2:113632784-113632806 GTGTGGCTGTGGAGTGAAAGGGG + Intronic
936820225 2:116510980-116511002 GCCTGGGTGTGGAGCATAGGAGG + Intergenic
937293262 2:120794629-120794651 GTGTGTGTGGCGAGGAGAGGAGG + Intronic
937390618 2:121482780-121482802 TTGTGGATGTTGAGGAATGGTGG - Intronic
937534862 2:122873711-122873733 GTTGGGGCGTGGAGGAAAAGGGG + Intergenic
937737237 2:125306914-125306936 ATGAGGGTGGGGAGGAAATGGGG + Intergenic
937855131 2:126666698-126666720 GTGTGTGTGTGTAGGGAGGGAGG - Intronic
937862827 2:126724398-126724420 GTGTGTTTGTGGAGGAAAGGAGG - Intergenic
938090359 2:128427327-128427349 GTGTGTGTGTGAAGGGTAGGAGG + Intergenic
938170529 2:129071606-129071628 GTGAGGGTGGGGTGGAAAAGAGG - Intergenic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
940000588 2:148963198-148963220 GTGTGTGTGTAGGGGAATGGCGG + Intronic
940005946 2:149009826-149009848 GGGTGTGTGTAGAGGAAAGGGGG - Intronic
940833291 2:158492492-158492514 GGGTTGGTGTGGGGGAGAGGGGG - Intronic
940963103 2:159807577-159807599 GTGGTGGTGTGGGAGAAAGGTGG - Intronic
941111536 2:161423258-161423280 GTGTGGGGGTGGGCGAAAAGTGG + Intronic
941225146 2:162838829-162838851 GTGGGGGTGGGGTGGGAAGGGGG + Intergenic
941622088 2:167789770-167789792 CTGTGGGGGAGGAGGAAAGGTGG - Intergenic
942241073 2:173964575-173964597 GTGGGGGTGGGGAGGAAGGCGGG + Intronic
942364959 2:175215757-175215779 TTGTGGGTTTGGGGGAGAGGCGG - Intergenic
942546308 2:177067643-177067665 GGGTGGGGGTGGAGGGATGGGGG + Intergenic
942580575 2:177412261-177412283 GTATGGGTCAGAAGGAAAGGTGG + Intronic
942682290 2:178490099-178490121 GTGTGTGTGTGCAGGAGAAGAGG + Intronic
943261356 2:185667525-185667547 GTGTGGGTGAGGATGAATTGAGG - Intergenic
943745657 2:191460355-191460377 GTGTGTGTGTGGAGGGATGGTGG - Intergenic
943762230 2:191622376-191622398 GTGTGGGTGTTGGGGATAGTAGG + Intergenic
944510160 2:200456656-200456678 GTGTGGGGTTGGTGGAATGGTGG - Intronic
944580373 2:201126992-201127014 GTGTGGGTGTGGAAAAGAAGGGG + Intronic
944822444 2:203444080-203444102 GTGAGGGGAGGGAGGAAAGGAGG + Exonic
945067193 2:205957251-205957273 GTGTGTGTGGGGAGGAGTGGGGG + Intergenic
946092623 2:217243497-217243519 GTGTGTGTGTTGGGGAAAGGGGG - Intergenic
946306004 2:218857464-218857486 GTGTATGTTTGCAGGAAAGGTGG + Intergenic
946356441 2:219188538-219188560 GTGTGTGTGTAGAGCAGAGGTGG - Intergenic
946507658 2:220318696-220318718 GTGTGGGTGTGTGGGTATGGGGG - Intergenic
946940170 2:224761795-224761817 GTGTAGGGGTGGAGGATATGGGG + Intergenic
946976614 2:225160039-225160061 GTGTGTGTGTGGAGGGGTGGGGG - Intergenic
947220770 2:227790345-227790367 GTGAAGGAGGGGAGGAAAGGAGG - Intergenic
947331674 2:229035455-229035477 GTGTGTGAGTAGAGGGAAGGAGG - Intronic
947398579 2:229711243-229711265 GTTTTGATGTGGAGGAAAAGAGG + Intronic
947546217 2:231012086-231012108 TTGGGAGTCTGGAGGAAAGGAGG + Intronic
948007024 2:234617949-234617971 GTGAGTGGGTGGGGGAAAGGAGG - Intergenic
948043425 2:234923390-234923412 CAGTGGGTGTGCTGGAAAGGTGG + Intergenic
948313419 2:237007791-237007813 GTGTGGCTGGGGTGGAGAGGGGG + Intergenic
948529606 2:238595949-238595971 TTGTGGTAGTGGAGGAATGGTGG + Intergenic
948920712 2:241064728-241064750 GCGTGGGTGTGGAGGGGCGGGGG - Intronic
1168793498 20:595930-595952 GTGGGGGTGGGGAGGAGCGGGGG + Intergenic
1168958298 20:1849987-1850009 GGGAGGGGGTGTAGGAAAGGCGG + Intergenic
1169016739 20:2298589-2298611 CTTTGGGGGTGGAGGAAATGAGG - Intronic
1169141808 20:3230848-3230870 GTGGGGGTGCGGAGGTCAGGTGG + Intronic
1169473675 20:5911304-5911326 GAGCGGGGGTGGGGGAAAGGCGG - Intergenic
1170118269 20:12884799-12884821 GTGGGGGTATGGGGTAAAGGTGG + Intergenic
1170525084 20:17228481-17228503 GTGTGGGTGCAGAGAGAAGGTGG + Intronic
1170647332 20:18209205-18209227 GTGTGGGTGTGGAGAAGGTGTGG - Intergenic
1170647367 20:18209380-18209402 GTGTGGGTGTGGAGAAGGTGTGG - Intergenic
1170647394 20:18209544-18209566 GTGTGGGTGTGGAGAAGGTGTGG - Intergenic
1170647401 20:18209586-18209608 GTGTGGGTGTGGAGAAGGTGTGG - Intergenic
1170647436 20:18209793-18209815 GTGTGGGTGTGGAGAAGGTGTGG - Intergenic
1170647443 20:18209834-18209856 GTGTGGGTGTGGAGAAGGTGTGG - Intergenic
1170647459 20:18209918-18209940 GTGTGGGTGTGGAGAAGGTGTGG - Intergenic
1170647488 20:18210083-18210105 GTGTGGGTGTGGAGAAGGTGTGG - Intergenic
1170647509 20:18210206-18210228 GTGTGGGTGTGGAGAAGGTGTGG - Intergenic
1170647532 20:18210331-18210353 GTGTGGGTGTGGAGAAGGTGTGG - Intergenic
1170647554 20:18210454-18210476 GTGTGGGTGTGGAGAAGGTGTGG - Intergenic
1170647590 20:18210659-18210681 GTGTGGGTGTGGAGAAGGTGTGG - Intergenic
1171234546 20:23513574-23513596 GTGTGTGTGTGGTGGAGGGGGGG - Intergenic
1171424699 20:25042267-25042289 GCCTGGGGCTGGAGGAAAGGTGG + Intronic
1171993996 20:31718295-31718317 GTGTGCGTGTGGGGAGAAGGTGG - Intronic
1172566512 20:35934733-35934755 GTGGGGGTGGGGATAAAAGGAGG + Intronic
1172766751 20:37355224-37355246 GTGGGGGTGGGGAGGGCAGGAGG - Intronic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173160075 20:40645969-40645991 GTGTGGGTGGGGTGGATAGGAGG + Intergenic
1173183357 20:40820979-40821001 GGGTGGGTGTGGGAGACAGGGGG - Intergenic
1173374888 20:42474442-42474464 GTGAGGGTGTTGAGGATAGTGGG + Intronic
1173403322 20:42743957-42743979 GTGGGTGGGTGGAGAAAAGGAGG - Intronic
1173427895 20:42958436-42958458 GGAAGGGTGAGGAGGAAAGGAGG + Intronic
1173603072 20:44309935-44309957 GGGTGGGTGAGGAAGGAAGGTGG + Intronic
1173742040 20:45407922-45407944 GTGTGGGTGGAGAGAAAAGGAGG + Intronic
1173938961 20:46894215-46894237 GTTGGGGAGTGGAGGAGAGGCGG - Intergenic
1174084687 20:47998561-47998583 GTGTGTGTGTGTGTGAAAGGTGG + Intergenic
1174490352 20:50888872-50888894 TTGTGGGTGTCGGGGGAAGGGGG - Intergenic
1174837020 20:53866167-53866189 CTGTGGCTGGGGAGGAGAGGAGG - Intergenic
1175541430 20:59750528-59750550 GGGTTGGGTTGGAGGAAAGGAGG + Intronic
1175681094 20:60989471-60989493 GTGTGTGTGTGGAGTAATGAAGG + Intergenic
1175931923 20:62497569-62497591 GGGTGGGTGTGGGGGATGGGTGG + Intergenic
1176899872 21:14427163-14427185 GTGGGGGGTTGGAGGAGAGGTGG + Intergenic
1176946603 21:14989782-14989804 ATGTGTGTGTGGAGGTGAGGAGG + Intronic
1177174550 21:17689804-17689826 GTGTGTGTGTCCAGGAGAGGTGG + Intergenic
1177209119 21:18047872-18047894 GTGTGGGTGGTGAGGACAAGAGG + Intronic
1177351673 21:19951278-19951300 ATGTGGGTGTAGAGGCAAGCAGG + Intergenic
1177482881 21:21714978-21715000 GTATAGGTGAGGAGGAAAGTAGG - Intergenic
1177942263 21:27425305-27425327 CTGTGTGTGTGGCAGAAAGGGGG + Intergenic
1178225867 21:30717778-30717800 GTGTGTGTGTGTAGCCAAGGCGG + Intergenic
1178363389 21:31968515-31968537 GTGTGGGTGTGGGTGTTAGGGGG - Intronic
1178822106 21:35984674-35984696 CTGAGGGTGTGGATGAACGGTGG - Intronic
1179310139 21:40188136-40188158 ATGTGAGTCTGGAGGAATGGGGG - Intronic
1179452133 21:41474389-41474411 GGGTGGGTGAGGAGGTGAGGGGG + Intronic
1179452161 21:41474469-41474491 GGGTGGGTGAGGAGGTGAGGGGG + Intronic
1179967709 21:44816958-44816980 CTGGGGGTGTGATGGAAAGGGGG + Intronic
1180871205 22:19148333-19148355 GTGTGGGAGTGGAGCCAAGGTGG + Intergenic
1181106122 22:20576711-20576733 GTGTGGCTGTGGTGGAAAGGAGG + Intronic
1181320757 22:22004318-22004340 CTGTGGGTGGGTAGGAAAGGGGG - Intergenic
1181758732 22:25043108-25043130 TGGGGGGTGGGGAGGAAAGGAGG + Intronic
1182074252 22:27484083-27484105 GTTTGGCTATGGAGGGAAGGAGG - Intergenic
1182251657 22:29005492-29005514 GTTTGGGGTAGGAGGAAAGGAGG + Intronic
1182692867 22:32176017-32176039 GTGTGCGTGTGCTGGGAAGGTGG - Intergenic
1183246335 22:36696480-36696502 GTGTGGGTGTTCAGAAAGGGTGG - Intronic
1183359582 22:37376527-37376549 CTTTGGGCATGGAGGAAAGGAGG - Intronic
1183380716 22:37489295-37489317 GAGTGGGTGTAGGGGAGAGGTGG - Intergenic
1183700525 22:39448512-39448534 TGCTGGGTGTGGAGGAGAGGAGG + Intergenic
1183724851 22:39582808-39582830 GGGTGGGTGGGGAGTAAAGATGG - Intronic
1184292885 22:43507545-43507567 GTGTGCGGGTGGAGAAAAGCAGG + Exonic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184474509 22:44713215-44713237 GGGTGGATGTGGTGGAGAGGTGG + Intronic
1184521454 22:44996645-44996667 GTGTGTGTGTGTAGGACAGGTGG - Intronic
1184835651 22:47019553-47019575 GTGTGGGTGTGCAGGGAGGGAGG + Intronic
1185015872 22:48342232-48342254 GTGAGGATGAGGAGGGAAGGAGG + Intergenic
1185119345 22:48956643-48956665 GTGTGGGTGTGGTGTGAATGTGG - Intergenic
1185119353 22:48956743-48956765 GTGTGGGTGTGGTGTGAATGTGG - Intergenic
1185199007 22:49490818-49490840 GTCTGGGAGAGGGGGAAAGGGGG - Intronic
1185427080 22:50778090-50778112 GTGTGGCTGTGGAGTGAAAGGGG - Intronic
949124936 3:435789-435811 GTGTAGGTTTGGAGAAGAGGAGG - Intergenic
949424319 3:3900037-3900059 GTGTGTGTGTGAAGCAAAGGAGG - Intronic
949793238 3:7816732-7816754 GTGTGGGTGGGGGTGACAGGAGG + Intergenic
949866705 3:8553185-8553207 GGGTGGGTGTAGGGGAAAGTGGG - Intronic
950204484 3:11068228-11068250 GAGTGGGTGCAGAGGTAAGGAGG - Intergenic
950217403 3:11169219-11169241 GTGGGGGTGAGGAGTAAGGGAGG + Intronic
950591332 3:13937535-13937557 GCGTGGGTGTGGGGGACAGATGG + Intronic
950712400 3:14821652-14821674 GCGTGGGTGTGGGGGACAGATGG + Intronic
950967737 3:17157583-17157605 GTGTGTGTCCGCAGGAAAGGAGG + Intronic
951038411 3:17961143-17961165 AAGTCGGTGTGGAGGATAGGTGG - Intronic
951315481 3:21185046-21185068 TTGTGGGGGTGGGGGAAATGGGG + Intergenic
951318558 3:21217064-21217086 GTGGGGGCGTAGAGGAAAGGGGG + Intergenic
952049700 3:29369539-29369561 GTGAGGGTGAGGAGGAGAGAGGG + Intronic
952075654 3:29694145-29694167 GTTTGTGTGTTGAGGGAAGGGGG + Intronic
952448539 3:33408370-33408392 GTGTGTGTGTGAAGGAGAGAGGG + Intronic
952648250 3:35689031-35689053 GTCTGGGTGTGGGGGAGAGGTGG - Intronic
952841967 3:37654179-37654201 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
953025269 3:39141525-39141547 GTGTGGGTGTGTAGGAAGAAGGG + Intergenic
953031065 3:39180351-39180373 ATGTGGGTGAGGAGGAGAGTGGG + Intergenic
953088616 3:39700373-39700395 GGGAGGATGTGGAGAAAAGGGGG + Intergenic
953193504 3:40711518-40711540 GAGTAGGGGTAGAGGAAAGGGGG - Intergenic
953411972 3:42695749-42695771 GTGTGGATGCAGAGGAAAGCAGG - Intronic
953631909 3:44625167-44625189 GGGTGGGCGTGCAGGGAAGGCGG + Intronic
953699598 3:45185556-45185578 GTGTGTGTGTGGAAGGAAGCTGG + Intergenic
954110592 3:48430739-48430761 AAGTGGGAGTGGAGGAAAAGGGG - Intergenic
954280420 3:49573253-49573275 AGGTAGGTGGGGAGGAAAGGGGG + Intronic
954377052 3:50200774-50200796 GTGTGAGTGTGGAGGAGGAGAGG + Intergenic
954436371 3:50498495-50498517 GTGGAGGGGTGGAGGAGAGGAGG - Intronic
954460826 3:50625921-50625943 GTGGGGGTGGGGAAGGAAGGAGG + Intronic
954624092 3:52012995-52013017 GGTTGGGTGTGGGGGAAGGGAGG + Intergenic
955131329 3:56171933-56171955 GTGTGGAGGTGGATGGAAGGGGG + Intronic
955593305 3:60560864-60560886 GTGTGTGTGTCAAGGAGAGGTGG + Intronic
955731841 3:61995586-61995608 GTGTGGGTGTGTGGGTATGGGGG + Intronic
955799285 3:62669292-62669314 ATGGGGCTGTGGAGGAAAGGAGG - Intronic
955872309 3:63451997-63452019 GTCTGGGGGAGGAAGAAAGGAGG - Intronic
955877932 3:63513150-63513172 GTGTGGGGGTGGGGGGGAGGGGG - Intronic
956159669 3:66335891-66335913 GTGGTGGTGGGGAGGGAAGGAGG + Intronic
956456023 3:69421159-69421181 GTGTGAGGGTGGAGGAAAAGGGG - Intronic
956634343 3:71348651-71348673 GTGTGTGTGTCGAGCAGAGGAGG + Intronic
956638443 3:71390565-71390587 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
956857256 3:73287308-73287330 TTGTGGGGCTGGAGGAGAGGAGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957037058 3:75303130-75303152 GAGTAGGGGTGGAGGAAAGGGGG + Intergenic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
957878844 3:86183978-86184000 GTGTGCTGGTGGAGGAAAGGTGG - Intergenic
958765449 3:98361579-98361601 GAGTGTGTGTGGAGGAGGGGTGG + Intergenic
959011459 3:101081636-101081658 GTGTGGGGGTGGGGGTAGGGGGG + Intergenic
960384619 3:117007163-117007185 TTGTGGGGGTGGAGGGAGGGAGG - Intronic
960513023 3:118572589-118572611 GTGTGTGTGTTCAGGAGAGGAGG + Intergenic
960692662 3:120363183-120363205 GTGTGTGTGTGGTGGGGAGGAGG + Intergenic
960708622 3:120505522-120505544 GTGTGTGTGTGGTGGAAGGGGGG - Intergenic
960713058 3:120550227-120550249 GTGTTGGTGTGGGGGAAGGTTGG + Intergenic
961129541 3:124453258-124453280 GCTTTGGTGTGAAGGAAAGGAGG - Intronic
961155785 3:124678342-124678364 GGGTGGGAGTGGATGACAGGTGG - Intronic
961380208 3:126492091-126492113 GTGAGGGGGTGGTGGGAAGGAGG - Intronic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961588931 3:127960327-127960349 GTGTGTGCGTAGTGGAAAGGGGG - Intronic
961639696 3:128357518-128357540 GTAGGGCTGTGGAGGAAAAGTGG + Intronic
961649884 3:128412036-128412058 GTGTGGGAGTGGGGTGAAGGAGG + Intergenic
961795855 3:129408485-129408507 GTGGGGGCGTGGAGGAGAAGAGG - Intronic
962007258 3:131361446-131361468 GTGGGGGTTAGGAGGAAATGAGG - Intergenic
962009623 3:131381162-131381184 GTGGGGGTTAGGAGGAAATGAGG - Intergenic
962174214 3:133135850-133135872 GTTTGGGAGTGGAGGGAGGGTGG + Intronic
962269536 3:133967868-133967890 GTGGGGGTGTGGAGGTGGGGTGG - Intronic
962269570 3:133967967-133967989 GGGGGGGTGTGGAGGTGAGGAGG - Intronic
962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG + Intronic
962730006 3:138273310-138273332 GTGTAGGAGTGGAGAATAGGGGG - Intronic
962755088 3:138460478-138460500 GTGGGGGTTCGGAGGAAAGCAGG - Intronic
962756393 3:138468254-138468276 GTGTGCAGGTGGAGGAAGGGTGG + Intronic
963076993 3:141356071-141356093 GTGTGTGTGTGGTGGAGTGGGGG + Intronic
963399911 3:144785441-144785463 GTTTGGGGGTGGAGGACAAGGGG - Intergenic
963407409 3:144884013-144884035 GTGTGAGTCTAGAGGACAGGTGG + Intergenic
963459828 3:145597231-145597253 TTGAGGGTGAGGAGGAGAGGAGG - Intergenic
964586497 3:158311564-158311586 GTATGTGTGTAGAGGAAAAGGGG - Intronic
964668786 3:159202879-159202901 GTGTGCCTTTTGAGGAAAGGAGG + Intronic
965903688 3:173675684-173675706 GTGTGGGTTGGGAAGAAAGGAGG + Intronic
966133002 3:176665838-176665860 GTGTGGATATGGAGGAAAAGTGG - Intergenic
966476260 3:180351044-180351066 GGCTGGGGGTGGAGGAAATGGGG - Intergenic
966591641 3:181690406-181690428 GGGTGGGGGAGGAGCAAAGGAGG - Intergenic
966666721 3:182479856-182479878 GAGTGGGAGTGGGGAAAAGGGGG + Intergenic
966677254 3:182602757-182602779 GGGTGGCTCTGTAGGAAAGGAGG - Intergenic
966743994 3:183258439-183258461 GTGGGTTTGGGGAGGAAAGGAGG - Intronic
966875748 3:184320692-184320714 GGGTGGGTGTGGAGGCAGTGCGG - Exonic
967967432 3:194973261-194973283 GTGTGGTTGTTGAGTAAAGGAGG - Intergenic
968407289 4:351861-351883 GTGAGGGTTTGGATGAGAGGAGG + Intronic
968568015 4:1325121-1325143 GGGTGTGTGGGGAGGCAAGGAGG + Intronic
968948487 4:3678050-3678072 CTGAGGGTGAGGAGGAGAGGAGG + Intergenic
969108865 4:4828911-4828933 GAGGGGGAGAGGAGGAAAGGAGG - Intergenic
969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG + Intronic
969622810 4:8287138-8287160 GTTTGGGCGTGGAGGCCAGGGGG + Intronic
969642339 4:8406341-8406363 GAGTGGGTGTGGGGAAGAGGGGG + Intronic
970093641 4:12437465-12437487 GGGTGGGGGGGCAGGAAAGGTGG + Intergenic
970143053 4:13003509-13003531 GTGTGTGTGTGGGGGGAGGGGGG + Intergenic
970398939 4:15699774-15699796 GTGGGGGTGGGGAGGCAGGGTGG - Intronic
970566366 4:17335814-17335836 GGTTGGATGTGGAAGAAAGGAGG - Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
970869413 4:20798486-20798508 GTGTGTGTGTGGTAGAAAGAAGG - Intronic
971810572 4:31420363-31420385 GCGAGGATGTGGAGAAAAGGGGG - Intergenic
972242555 4:37208935-37208957 GTGTGGAGGTGGAGGGAGGGAGG - Intergenic
972396254 4:38662270-38662292 ATGTGGGTGTGGACGCAAAGGGG - Intergenic
972446355 4:39148044-39148066 GTGTGTGTGTGGAGGGGGGGCGG - Intergenic
972638093 4:40901933-40901955 GTGTGTGTGTGATGGAAAGATGG + Intronic
972644802 4:40957110-40957132 GGGTGGATGTGGAACAAAGGCGG + Intronic
973068339 4:45825066-45825088 GTGTTGGGGTGGAGGGAGGGGGG + Intergenic
973561723 4:52143859-52143881 GTGTGGGTGAGAAGGGGAGGTGG - Intergenic
973845756 4:54911507-54911529 GTGTGGGTATGGTGGAGAAGGGG - Intergenic
974260464 4:59518719-59518741 GGGAGGGTGTGGAGAATAGGCGG - Intergenic
974272161 4:59664501-59664523 GTGTGGGTAACGGGGAAAGGAGG - Intergenic
975101841 4:70522538-70522560 GGGATGGTGTGGAGGGAAGGGGG - Intronic
975196578 4:71531744-71531766 GTGTGTGTGTGTAGGCAGGGAGG - Intronic
975814285 4:78201829-78201851 GTGTGAGTTGGGAGAAAAGGGGG + Intronic
976268892 4:83210995-83211017 GCCTGGGGGAGGAGGAAAGGGGG - Intergenic
976455834 4:85246193-85246215 GCGTGGGTGTGCAGGAACGCCGG + Intergenic
976806068 4:89048457-89048479 GTGGGGGTGGGGAGGGATGGTGG + Intronic
976897133 4:90126966-90126988 GTGTGGGTGAGAAGGAAAAGCGG + Intergenic
976997678 4:91455817-91455839 GTGTGTATGTGGAGGAATGGGGG + Intronic
977040247 4:92007371-92007393 GTGTGTGTGTGAGAGAAAGGAGG - Intergenic
977758991 4:100708081-100708103 GTGAAAGTGTGGAGGGAAGGAGG + Intronic
978029386 4:103920859-103920881 GGTTGGGTGTGGAAGAAAGTGGG - Intergenic
978277729 4:106972203-106972225 ATGTGGGTGGGGAGGAGAAGTGG - Intronic
978384561 4:108167341-108167363 GTGTGTGTGTGTAGGATGGGAGG - Intronic
979210869 4:118100393-118100415 ATGTGGTTGTGGAGGCAAGCTGG - Intronic
979962418 4:127036691-127036713 GTCTGGGAGTGGAGCAAAGAGGG - Intergenic
980419958 4:132546587-132546609 GTGTGGGTGTGGGGGTAGGGCGG - Intergenic
980754158 4:137135870-137135892 GAATGAGTGTGGAGGGAAGGGGG - Intergenic
981080433 4:140634478-140634500 ATGTGAGTGTGTAGGTAAGGGGG - Intronic
981171025 4:141623594-141623616 GGGTAGGTGGGGAGGAAAGGAGG - Intergenic
981471164 4:145137293-145137315 GTATGGGAGTGAAGGTAAGGGGG + Exonic
981479352 4:145221708-145221730 GTGAGGATGTGAAGAAAAGGTGG + Intergenic
981719440 4:147786772-147786794 GGGTATGGGTGGAGGAAAGGTGG + Intronic
981937264 4:150250918-150250940 GTGGGGGTGTGGAGGATTTGTGG - Intronic
983146889 4:164227634-164227656 GTGTGGGAGAGGAGGACAAGAGG + Intronic
983531754 4:168816862-168816884 GTGTGTGTGTGTAGAAAAGGGGG + Intronic
983644532 4:169976562-169976584 GTGCAGGTGTGGTGGGAAGGGGG + Intergenic
984933625 4:184870313-184870335 GTGGGGGTGTGTAGGAAAGCAGG - Intergenic
985383937 4:189425510-189425532 GTTAGGCTGTGGAGGAAGGGTGG - Intergenic
985484482 5:140796-140818 GTGGGGGTTTGTAGGGAAGGGGG - Intronic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
985733935 5:1566383-1566405 GTGTGTGTCTGGAGGCCAGGTGG - Intergenic
986066666 5:4240875-4240897 GTGTGGGAGGGGAGGAACTGAGG + Intergenic
986207747 5:5641521-5641543 GTGAGGGTGTGTAGGAAAGCAGG + Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986967931 5:13297960-13297982 GTGAGAATGTGGAGAAAAGGTGG + Intergenic
986980943 5:13447589-13447611 GAGTGGGTGTAGGGGGAAGGAGG - Intergenic
987960991 5:24808593-24808615 CTTTTGGAGTGGAGGAAAGGTGG - Intergenic
987996604 5:25290131-25290153 GAGTGGGAGTGGGGGAAGGGGGG + Intergenic
987997350 5:25301802-25301824 GTGTGTGTGTGTAGGAAAAGGGG + Intergenic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
988296244 5:29366255-29366277 GTGAGGATGTGGAGAAAAGGGGG - Intergenic
988428103 5:31087573-31087595 GGGTGGGTGGGGAGGGGAGGAGG - Intergenic
988798435 5:34673958-34673980 GAGTGGGTGGGGAGGGTAGGAGG + Intronic
988995716 5:36713181-36713203 GCGGGGGTGTGCAGGAAATGTGG + Intergenic
989104149 5:37845271-37845293 GTGTGTGTGTGTATGGAAGGGGG + Intergenic
989131351 5:38110252-38110274 GTGTGTGTGTTGAGGAAGGTCGG - Intergenic
990061322 5:51652734-51652756 GTGTTTGTGTGGAGAAATGGGGG + Intergenic
990555053 5:56924694-56924716 GTTTGGGTGTGGAGCCAAGGTGG - Intronic
990626254 5:57614763-57614785 TTGTATGTGTGGAGGAAATGGGG + Intergenic
990637445 5:57745005-57745027 GTGTGTGTATGTAAGAAAGGAGG - Intergenic
990891945 5:60659660-60659682 GTATGGGTCAGAAGGAAAGGTGG - Intronic
991385026 5:66077747-66077769 GTGTGTGTGTAGAGGGAGGGAGG - Intronic
992366179 5:76092566-76092588 GGATGGGGGTGGAGGAATGGGGG - Intronic
992921642 5:81529420-81529442 GTTAGTGTGTGGAGGATAGGTGG - Intronic
993718834 5:91301734-91301756 GTGGGGGTGTTGAGGCAGGGAGG - Intergenic
993810543 5:92470713-92470735 GTGTAGGTATGGAGGTATGGAGG + Intergenic
993948994 5:94150393-94150415 GGGTGGGGGAGGAGGAAAAGGGG - Intergenic
994205237 5:97027555-97027577 TTGTCGGTGGGAAGGAAAGGTGG - Intronic
994727793 5:103456715-103456737 GTTAGGGTGTGGATGGAAGGAGG - Intergenic
995152284 5:108863042-108863064 GTGTGGGTGGGGACAAAAAGGGG + Intronic
995314222 5:110749498-110749520 GTGTGGGAGCGGTGGGAAGGGGG + Intronic
995317040 5:110787116-110787138 GTGTGTGTTGGGGGGAAAGGAGG - Intergenic
995540229 5:113178549-113178571 TTGGGGGTGAGGAGGAAATGTGG - Intronic
996307160 5:122060404-122060426 GTGTGGGTGTGATGGGAAAGTGG - Intronic
996360620 5:122641443-122641465 GTGTGTGTGGGGAGGGGAGGGGG - Intergenic
996442372 5:123506556-123506578 CTGTAGGTGTGGAGTAAGGGAGG - Intergenic
996621298 5:125506935-125506957 GTCTGGGGGTGGAGGGAAAGGGG - Intergenic
996757124 5:126946800-126946822 GTGTGTGTGTGGTGGAGGGGAGG + Intronic
996801061 5:127403570-127403592 GGGAGGGTGTGGAGGAAATGGGG - Intronic
997196128 5:131981121-131981143 GTGTGGGTGGGGGAGAAAGGAGG - Intronic
997782832 5:136677127-136677149 GTGTGAGTGTAGAGGAAAGCAGG - Intergenic
997783281 5:136681766-136681788 GTGTGAGTGTGGAAGAAGGCGGG + Intergenic
997819950 5:137056259-137056281 ATGTGGGGGTGGGGGACAGGGGG + Intronic
998187514 5:139993114-139993136 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
998499660 5:142621395-142621417 GTGAAAGGGTGGAGGAAAGGAGG - Intronic
998959149 5:147466420-147466442 GTGAGGGTGGGCTGGAAAGGAGG - Intronic
999229538 5:150053517-150053539 GTGAGGCTGTGGAGTGAAGGCGG + Exonic
999538653 5:152547724-152547746 GTGTGTGTGTGGAGCAAATTTGG - Intergenic
999651659 5:153774067-153774089 GTGTGTGTGTGGGGGGAGGGGGG - Intronic
999709245 5:154301856-154301878 GGGTGGGAGTGGAGCTAAGGAGG + Intronic
1000143462 5:158429632-158429654 GTGTGTGTGTGTAGGGGAGGAGG - Intergenic
1000227856 5:159285185-159285207 GTGTGTGTGTGGTGGGAGGGTGG - Exonic
1000245769 5:159447281-159447303 ATGTGTTTGTGGAGGAAAGAAGG + Intergenic
1000303794 5:159977729-159977751 GTGTGGGTGTTGGGGTGAGGAGG + Intergenic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1001091700 5:168746659-168746681 GTGTGAGTGTGGTGGTATGGTGG + Intronic
1001160061 5:169304826-169304848 GAGTGGATGTGGAGGAGTGGTGG - Intergenic
1001209186 5:169794283-169794305 GTGGGGAAGTGGAGGGAAGGAGG - Intronic
1001301484 5:170536845-170536867 GTGGGGGAGGGCAGGAAAGGAGG + Intronic
1001304667 5:170563011-170563033 GTGTGTGGGTGGAGGTGAGGAGG - Intronic
1001407053 5:171483778-171483800 GTGTGGGGGTTGGGGATAGGTGG + Intergenic
1001827065 5:174753525-174753547 GTGTGTGTGTGTAGGGAGGGAGG + Intergenic
1001852524 5:174981811-174981833 ATGTGGATGGGGACGAAAGGAGG + Intergenic
1001900177 5:175420589-175420611 GTGTGTGGGTGGATGAAAGGAGG - Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1001952179 5:175824025-175824047 CTGTGGGTGTTGGGGACAGGAGG - Intronic
1002105958 5:176879549-176879571 GGGTGGGTGAGGTGGACAGGAGG + Intronic
1002132503 5:177090249-177090271 GTGTGGGTGTCAAGGAGTGGTGG + Intronic
1002346092 5:178548062-178548084 GTGTGTGTGTGGGGGTGAGGGGG - Intronic
1002476152 5:179467558-179467580 GTGTGGGCGTGTTGGGAAGGTGG - Intergenic
1003263557 6:4546808-4546830 GTGTGGACTTGGAGGGAAGGGGG + Intergenic
1003403441 6:5809528-5809550 GGCTGGGTGTGCAGGAATGGAGG + Intergenic
1003701220 6:8467197-8467219 GTGGGGGTGTGGATGAAAAGTGG + Intergenic
1003874446 6:10423640-10423662 GAGGGGGGATGGAGGAAAGGGGG + Intergenic
1004009058 6:11663909-11663931 GTGTGTGTGTGTAGGGGAGGCGG + Intergenic
1004570540 6:16840389-16840411 GTGGGGGTGGGGAGGGAAAGTGG + Intergenic
1004580486 6:16946485-16946507 GTGTGGCTAAGGAGGCAAGGTGG + Intergenic
1004980906 6:21022599-21022621 TTGTGTGTGAGGAGGGAAGGGGG + Intronic
1005042917 6:21615484-21615506 GTGTGTGTGTGTAGGGAATGTGG - Intergenic
1005690146 6:28297024-28297046 GTGTGGGTCTGTAGGAAACGTGG - Intronic
1005786006 6:29246732-29246754 GTGATGGTTTGGAGGAAAAGTGG + Intergenic
1006014661 6:31070709-31070731 GAGTGGGAGTGTAGGAAAGGAGG + Intergenic
1006104933 6:31710749-31710771 GTGGGGGACTGAAGGAAAGGAGG + Intronic
1006694543 6:35920553-35920575 GGGCGAATGTGGAGGAAAGGAGG + Intronic
1006730817 6:36234948-36234970 GTCTGGGGTTGGGGGAAAGGGGG + Intergenic
1006788926 6:36686211-36686233 GTCTGAGTGTCCAGGAAAGGGGG - Exonic
1006917361 6:37603145-37603167 GTGTGTGTGTGGAGGGGGGGCGG + Intergenic
1007350106 6:41266278-41266300 TGGTGAGAGTGGAGGAAAGGGGG + Intergenic
1007371354 6:41428442-41428464 GTGGGGGTGTGGGGTAGAGGGGG - Intergenic
1007735617 6:43980489-43980511 GTGTGAGTGAGAAGGAAAAGTGG - Intergenic
1007787990 6:44292457-44292479 GTGTGGGTGTGGGGAACGGGTGG - Intronic
1007909467 6:45499047-45499069 GTGTGGGTATGGAGGAGAGTGGG + Intronic
1008191844 6:48468283-48468305 GTGTGGGGATGGAGGAGAAGTGG + Intergenic
1008371093 6:50731439-50731461 GTGTGTGTGTGTATGAAAGTGGG - Intronic
1008683222 6:53896419-53896441 GTGTGTGTATGGGGGAAGGGAGG + Intronic
1009417854 6:63435503-63435525 GGGTGGGTGAGGGGCAAAGGTGG - Intergenic
1009469180 6:64010404-64010426 GTGGTGGTGTGGAGAGAAGGGGG + Intronic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1010486413 6:76419837-76419859 GTGTGGGGGTTGAGGTGAGGAGG + Intergenic
1010840462 6:80643752-80643774 GTGTGGGAGTGGGGGAGAGGGGG - Intergenic
1010907991 6:81516743-81516765 GTGTGTGTGTGTAGGAGTGGGGG - Intronic
1010918668 6:81652912-81652934 ATGTTTGTGTGGAGGAAAGTGGG + Intronic
1010972403 6:82276837-82276859 GTGTGTGTGTGTAGGCAGGGAGG + Intergenic
1011009908 6:82692128-82692150 GTGTGTATGTGGAGGGGAGGAGG - Intergenic
1011540253 6:88420582-88420604 GTATGGGTCAGAAGGAAAGGTGG + Intergenic
1011703387 6:89976515-89976537 GTGTGTGTGGGCAGGAAAAGGGG + Intronic
1011865818 6:91825542-91825564 GTTTGGGGTTGGGGGAAAGGCGG + Intergenic
1012338558 6:98090339-98090361 GTGTGTGGGTGGGGGAAAGTGGG + Intergenic
1012645425 6:101673024-101673046 GTGAAGTTGTGGAGAAAAGGTGG - Intronic
1012646460 6:101689748-101689770 GTGTGGGAATGGAGAAAAGTGGG - Intronic
1012863978 6:104595832-104595854 GTGGTGGTGTGGTGGAAATGAGG - Intergenic
1012901990 6:105017267-105017289 GTGTGGGTGAGGGGTAAGGGTGG + Intronic
1013207496 6:107958119-107958141 GTGGGGGCGGGGAGGAGAGGCGG - Exonic
1013298633 6:108782040-108782062 GTGGGGGTGTGTTGGCAAGGAGG + Intergenic
1013474756 6:110497090-110497112 GTGTAGGTGTGGTGGAGAGGGGG - Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013878216 6:114860617-114860639 GTGGGGGTGTGGAGGGTAGGGGG + Intergenic
1014120398 6:117718915-117718937 GTGTGTGTGTGAAGGGATGGGGG + Intergenic
1015228127 6:130882211-130882233 GTGTGGGGGAGGAGGGAAGGAGG - Intronic
1015267740 6:131305989-131306011 GTGTGTGTGTGTAGGAGAGCTGG - Intergenic
1015535562 6:134264046-134264068 GTGTTGTTATGGAGTAAAGGCGG + Intronic
1015555681 6:134459231-134459253 GTGTGGGGGTTGAGGAAATTGGG - Intergenic
1016272558 6:142305394-142305416 GTGGGGGGGGGCAGGAAAGGAGG - Intronic
1016329699 6:142944410-142944432 GTGTGGGTGTGTGGGGGAGGGGG - Intronic
1016683132 6:146853373-146853395 CTGGGGGTCTGGAGGAAATGAGG - Intergenic
1016845456 6:148564333-148564355 TGGTAGGTTTGGAGGAAAGGTGG + Intergenic
1017106736 6:150895102-150895124 GCGTTTGGGTGGAGGAAAGGCGG - Intronic
1017282023 6:152636222-152636244 GTCAGGGGGTGGAGGAAGGGAGG + Intronic
1017496852 6:154991112-154991134 GAGTGGATGTTGAGGAAAGTGGG + Intronic
1017798528 6:157870159-157870181 GTGTGGGTGTGCATGAGAGCAGG - Intronic
1018216575 6:161533988-161534010 GTGAGGGCGAGGAGGACAGGTGG - Intronic
1018690081 6:166337579-166337601 GTGTGGGTGAGGTGGTTAGGGGG - Intronic
1018839780 6:167508754-167508776 GAGGGGATGGGGAGGAAAGGAGG - Intergenic
1018897172 6:168027697-168027719 GTGGGGATGTGGAGGGAAGCCGG - Intronic
1019067602 6:169315441-169315463 GTGTGTGTGTGGACGGAGGGAGG - Intergenic
1019067638 6:169315757-169315779 GTGTGTGTGTGGACGGAGGGAGG - Intergenic
1019158938 6:170056885-170056907 CTGTAGGTGTGGGGGAAAGATGG - Intergenic
1019159145 6:170057765-170057787 GAGTGGGGGAGGGGGAAAGGGGG - Intergenic
1020441098 7:8217365-8217387 GTGTAGAGGTGGAGGGAAGGAGG - Intronic
1020529324 7:9311234-9311256 GTGTGTCTGTTGAGGAAAGAAGG - Intergenic
1020693284 7:11385863-11385885 GTGAGGGGGTGGAGGTAAGGGGG - Intronic
1020845571 7:13277443-13277465 GTGTGTGTGTGTAGGAGTGGAGG + Intergenic
1021016592 7:15543146-15543168 GAGTGGGTGTGGAGGAAGGAAGG - Intronic
1021896408 7:25240101-25240123 GTGTGGGTGGAGAGAAGAGGAGG + Intergenic
1022109128 7:27217281-27217303 GTGTGTGTGTGTGGGGAAGGTGG + Intergenic
1022138629 7:27472833-27472855 GTGTGTGTGTAGGGGAATGGTGG - Intergenic
1022209332 7:28193581-28193603 GGGTGGGGGTGGGGGAAAGAGGG - Intergenic
1022306205 7:29148850-29148872 GTGTGTGTGTGGGGGAACAGAGG + Intronic
1022545118 7:31180047-31180069 GTGTGAGTGAGAAGGAAAGCTGG + Intergenic
1022813607 7:33893084-33893106 GTGGGGGTGTGGAGCTGAGGAGG - Intergenic
1022886759 7:34654697-34654719 GTGTGTGTGTGTAGGGAGGGGGG + Intergenic
1023063207 7:36349514-36349536 GTGGGTGTGTGGAGGCAAGGAGG - Intronic
1023256755 7:38320002-38320024 GTGTTGGTGAGGAGTGAAGGTGG + Intergenic
1023346028 7:39271987-39272009 GTGTGGGGGTGGGGGAGAGGGGG + Intronic
1023399627 7:39782945-39782967 ATGAGAGTGGGGAGGAAAGGGGG + Intergenic
1023862465 7:44224756-44224778 GCGTGGGTGGGGAGGAGACGGGG + Intronic
1023863211 7:44227414-44227436 GAGGGGGTGTGGGGGACAGGAGG + Intronic
1023966288 7:44964728-44964750 GGGTGGGTGTGGATGACAGGAGG - Intronic
1024145603 7:46513535-46513557 GTGAGGATGTGGAGGAATGAGGG - Intergenic
1024387465 7:48769290-48769312 ATGTGGGTAAAGAGGAAAGGAGG + Intergenic
1024525254 7:50343158-50343180 GGGAGGGTGGGGAGGGAAGGAGG - Intronic
1024712262 7:52029430-52029452 GTGTGGGTGTGGATGGATGGTGG - Intergenic
1026273100 7:68853386-68853408 ATGTGGGGGTGGAGGGGAGGGGG - Intergenic
1026531044 7:71197576-71197598 GTGGGGGAGTGGAGGAAAGTGGG - Intronic
1026605920 7:71815778-71815800 GGGTGGGAAGGGAGGAAAGGGGG - Intronic
1026666793 7:72347592-72347614 ATGTGTGTGTGAAGGAGAGGGGG - Intronic
1027396350 7:77758941-77758963 GTTTGGAAGTGGAGGAAGGGTGG - Intronic
1027629527 7:80585313-80585335 GTGTGTGTGTGGAGGTGGGGGGG + Intronic
1028618164 7:92793852-92793874 GTGTGGGGGTTGGGGAAAAGTGG + Intronic
1029492669 7:100880798-100880820 ATGTGGGTCTGGAGCACAGGCGG + Intronic
1029577273 7:101411795-101411817 GTGTGGTTCTGGTGGAAAGGAGG + Intronic
1029580603 7:101434614-101434636 GTGTTGGTGAGGAGAGAAGGCGG + Intronic
1029605593 7:101597863-101597885 GTGGGGGTGGGGAGGATAGAAGG - Intergenic
1029707376 7:102282966-102282988 GTGTGTGTGTTGGGGAAGGGGGG - Intronic
1030331866 7:108279625-108279647 GGGTGGGTGGGGAGGGCAGGGGG - Intronic
1031284331 7:119844724-119844746 GTGTGTGTGTGGGTGGAAGGCGG + Intergenic
1031991553 7:128202252-128202274 GTGAAGGGGAGGAGGAAAGGAGG - Intergenic
1032022821 7:128419466-128419488 GTGGGAGAGTGGGGGAAAGGAGG + Intergenic
1032392200 7:131562604-131562626 GTGTGGATGGGAAGGGAAGGAGG + Intergenic
1032537642 7:132678099-132678121 GTGGGGAGGTGGAGGAAGGGAGG - Intronic
1032625382 7:133586232-133586254 GCTTGAGGGTGGAGGAAAGGAGG - Intronic
1033115056 7:138617840-138617862 GTGGAGGTGGGGAGGAAAGTAGG + Intronic
1033143313 7:138847380-138847402 GTGTGGTAGGGGAGGAAGGGCGG + Intronic
1033181331 7:139182088-139182110 GTGTGTGTGTGGAGGGGCGGGGG + Intronic
1033281639 7:140010058-140010080 GTGTGGGTGTGGAGCAGGTGTGG - Intronic
1033397507 7:140989738-140989760 GTGTATGTGTGAGGGAAAGGGGG + Intergenic
1033480581 7:141736341-141736363 GTGGGGGGCTGGAGGGAAGGTGG - Intergenic
1033547844 7:142418171-142418193 GTGTGGCTGTGCAGGAAAAGTGG + Intergenic
1034008348 7:147499744-147499766 GAGTGGGTGGGGAGAAAAGGAGG + Intronic
1034036226 7:147825866-147825888 GTGTGGGTGTTGAAGATAGAAGG + Intronic
1034284509 7:149875694-149875716 GCTAGGGTGAGGAGGAAAGGAGG - Intronic
1034402798 7:150876961-150876983 GCGGGGGGGTGGGGGAAAGGCGG - Intergenic
1034404828 7:150896395-150896417 GTGTGGGAGAGGAAGAGAGGAGG + Intergenic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034445784 7:151113571-151113593 GACTGGGGGTGGAGGAAAGTGGG + Intronic
1034460783 7:151196852-151196874 GTGTGGGTGTGTAGGCAAAGGGG - Intronic
1034520555 7:151616120-151616142 GTGGGGGCGTGAAGCAAAGGCGG + Intronic
1034697165 7:153064012-153064034 GTGTGAGAGTGGAGGCAATGTGG - Intergenic
1034699865 7:153086520-153086542 CTGCAGGTGTGGAGGAAAGGAGG - Intergenic
1034749241 7:153553541-153553563 GTGTGTGTGTGGAGGTAGGGCGG - Intergenic
1034869588 7:154672150-154672172 GAGTGAGTGTCGAGCAAAGGGGG - Intronic
1034997398 7:155586910-155586932 GTGTGGGGGTGGAGGCATTGGGG - Intergenic
1035278954 7:157765466-157765488 GTGTGTGGGTGGATGAAAGAAGG - Intronic
1035279069 7:157765961-157765983 GTGTGTGGGTGGATGAAAGAAGG - Intronic
1035332665 7:158106463-158106485 GTGTGTGTGTGGAGGCAGGGAGG - Intronic
1035399142 7:158553437-158553459 GTGTGTGTGTGTAGACAAGGAGG - Intronic
1036184496 8:6612321-6612343 GGCTGGCTGTGGAGGAGAGGAGG - Intronic
1036579640 8:10061999-10062021 GTGGGGGAAGGGAGGAAAGGAGG + Intronic
1036642679 8:10593851-10593873 GGGTGGGGGTGGAGTAAATGGGG - Intergenic
1036678424 8:10853176-10853198 GTGTGGGAGGGCAGGGAAGGTGG + Intergenic
1036961933 8:13254143-13254165 GGGTTGGGGTGGGGGAAAGGAGG - Intronic
1037118425 8:15253941-15253963 GTGTGTGTGTGAAGGGATGGGGG - Intergenic
1037240555 8:16772438-16772460 GTGAGAGTGAGTAGGAAAGGTGG - Intergenic
1037366504 8:18128251-18128273 CTGTGGGGGTGGGGGTAAGGAGG - Intergenic
1037579678 8:20236969-20236991 GTGTGGGGTTGGAGTAAGGGTGG + Intergenic
1037585108 8:20270673-20270695 GTGTGGGACAGGAGGAAGGGTGG + Intronic
1037681385 8:21100571-21100593 GTCTCGGTGGGGAGGAAAGATGG + Intergenic
1037788604 8:21918119-21918141 GTGCGGGGGTGGGGGAAGGGAGG + Intergenic
1037992834 8:23332811-23332833 GTGTGGGTGTGTATGAGTGGGGG - Intronic
1038127539 8:24691342-24691364 GTGTGGGGGTGGAGGGTCGGGGG - Intergenic
1038236972 8:25768911-25768933 GTGTGTGTGTTGGGGAGAGGAGG - Intergenic
1038411320 8:27361833-27361855 GTGTGGGTGTGGAGCGGAGCAGG - Intronic
1039058676 8:33556461-33556483 GTGTGTGTGTGGTGGGCAGGGGG + Intronic
1039435356 8:37556171-37556193 GTGTGGGTGTGGAGGGGAAGGGG - Intergenic
1040475473 8:47773234-47773256 GTTTGGGTGTGGAGGACTGGCGG + Exonic
1040839690 8:51772040-51772062 GTGTGGGCATGGAGGAAGAGGGG - Intronic
1041087388 8:54269326-54269348 GTGTGTATGTGTAGGAAATGGGG + Intergenic
1041106204 8:54446401-54446423 GTGTGGGTGTGGCTGACAGCAGG + Intergenic
1041333022 8:56748914-56748936 GTGTAAGTGTGGAACAAAGGTGG + Intergenic
1041570677 8:59333705-59333727 GGGTGTGTGTTCAGGAAAGGAGG + Intergenic
1041886211 8:62811045-62811067 GTGGGGTTGGGAAGGAAAGGAGG - Intronic
1041960585 8:63610953-63610975 GAATGGGTGTGGAGGAATAGAGG + Intergenic
1042361352 8:67886873-67886895 GTGTGGCTGTGGTGCAAATGTGG - Intergenic
1042428031 8:68672156-68672178 GTCTGGTTATGGAGGCAAGGGGG + Intronic
1042555384 8:70029967-70029989 GTGTGGGTGGGAAGGAAATTAGG - Intergenic
1043381135 8:79703335-79703357 GTGAGGCTCAGGAGGAAAGGGGG + Intergenic
1043915591 8:85919268-85919290 GTGTGTGTGTGGTGGATATGTGG - Intergenic
1044727930 8:95208174-95208196 GTGTGTGTGTGGGGGAGGGGGGG + Intergenic
1044818378 8:96136555-96136577 GGGTGGGTGGAGAGGAGAGGAGG - Intergenic
1044866254 8:96574030-96574052 GAGGGGGTGTGGAGGGGAGGGGG - Intronic
1045686420 8:104717277-104717299 GTGGTAGGGTGGAGGAAAGGAGG - Intronic
1045719038 8:105084905-105084927 GACTGGGTGTGGAAAAAAGGAGG - Intronic
1046027530 8:108743810-108743832 GAGAGGCTGTGGAGGAGAGGGGG - Intronic
1046833166 8:118769707-118769729 GTGTATGTGTGGGAGAAAGGAGG - Intergenic
1047058412 8:121193805-121193827 GAGTGAGTGTGGAGGAAACATGG + Intergenic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048411594 8:134180151-134180173 GTCTGGGGGTGGAGGATGGGTGG + Intergenic
1048890218 8:138940483-138940505 GTGGGGGGGTGGGGGGAAGGTGG - Intergenic
1048905255 8:139081655-139081677 GGGTTAGTGTGGGGGAAAGGTGG + Intergenic
1049205387 8:141361215-141361237 GTGTGGGTGGGGAGCAGAGCTGG - Intronic
1049456093 8:142690103-142690125 GTGTGTGTGTGGAGGGGAGGCGG + Intergenic
1049865492 8:144932900-144932922 GTGTGGGTGTCGAGGAAGAGGGG - Intronic
1050233559 9:3554816-3554838 GTGTGTGTGTGTTGGAAAGTTGG - Intergenic
1050502565 9:6314663-6314685 GGGTGTGTGTTCAGGAAAGGAGG - Intergenic
1050820917 9:9878869-9878891 GTTTGATTGTGGAGGGAAGGAGG - Intronic
1051349306 9:16184122-16184144 GTGTGGAGGTGGAGGTGAGGAGG + Intergenic
1051436611 9:17040406-17040428 AGGTGGGTGGGGAGGAAATGGGG - Intergenic
1051515155 9:17922531-17922553 ATGTGGGTGAGGGGGAAGGGTGG - Intergenic
1051714608 9:19969174-19969196 GTGTGTGTGTGTGGCAAAGGAGG - Intergenic
1052320607 9:27163473-27163495 GTGAGGCTGAGGAGAAAAGGAGG + Intronic
1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG + Intergenic
1052656784 9:31373658-31373680 GGGTGGGGGTGGAGGATGGGGGG - Intergenic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1053345780 9:37377300-37377322 GTGTGTGTGTGTAGGAGAGAAGG + Intergenic
1053418768 9:37963614-37963636 GTGTTGGTGAGGGGGAAAGGTGG + Intronic
1053663150 9:40298611-40298633 GTGTGGGGGTGGAAGAAAAAAGG + Intronic
1053664603 9:40308698-40308720 GTGTGGGGGTGGAAGAAAAAAGG + Intronic
1053913655 9:42929141-42929163 GTGTGGGGGTGGAAGAAAAAAGG + Intergenic
1054375274 9:64444835-64444857 GTGTGGGGGTGGAAGAAAAAAGG + Intergenic
1054520011 9:66067586-66067608 GTGTGGGGGTGGAAGAAAAAAGG - Intergenic
1054521466 9:66077674-66077696 GTGTGGGGGTGGAAGAAAAAAGG - Intergenic
1054758363 9:68981476-68981498 GTGGGGGTGGGGAGGGCAGGAGG + Intronic
1054959139 9:70947741-70947763 GTGTGTGGGTGGGGGAAAGAAGG + Intronic
1055008282 9:71534483-71534505 GTGTGTGTGTGGAGGGGTGGTGG + Intergenic
1055206162 9:73733091-73733113 TTGTGAGTTTGGAGAAAAGGTGG - Intergenic
1055666028 9:78553956-78553978 TTTTGGTTTTGGAGGAAAGGAGG + Intergenic
1056036655 9:82613456-82613478 GTTTGGGTGAGGGGGAAAGGCGG + Intergenic
1056884170 9:90424111-90424133 GTGTGAGTGTGCAGTGAAGGGGG - Intergenic
1056898024 9:90569247-90569269 GTGTTTGTGTGGAGGAAAACCGG + Intergenic
1056902120 9:90609499-90609521 CTGGGGTTGTGGAGGAAAGCAGG + Intergenic
1057693796 9:97309772-97309794 CTGTGGGAGTGGGGGAATGGGGG - Intronic
1057851480 9:98570131-98570153 GTGAGGGAGTGGAGGCAAGGAGG - Intronic
1057869888 9:98709280-98709302 GTGTGCGTGTGCTGGGAAGGTGG - Intergenic
1057922787 9:99111969-99111991 GTGGATGTGTGGTGGAAAGGAGG + Intronic
1058435087 9:104955210-104955232 GTGTGCGTGTCCAGGAAAGTAGG - Intergenic
1058719541 9:107751160-107751182 GTGTGTGTGTGGAGGCGGGGGGG + Intergenic
1058944199 9:109841616-109841638 GTGGGGGGGTGGAGGGAAAGAGG + Intronic
1059054596 9:110966121-110966143 GTCTGGGAGTGGGGGAAAAGGGG + Intronic
1059516544 9:114901045-114901067 GTGTGTGTGTGGTGGGGAGGTGG + Intronic
1060331095 9:122671200-122671222 GACTGGGGGTGGAGGAAACGGGG + Intergenic
1060385955 9:123228457-123228479 GTGTGGGGTTGGGGGACAGGGGG + Intronic
1060868754 9:127022254-127022276 CTGTGTGTGTGGAGAAAGGGAGG - Intronic
1061374241 9:130214711-130214733 GTCTGGGTGTGGAGTATGGGGGG + Intronic
1061479185 9:130888168-130888190 GTGTGGATGAGGAGGAGCGGAGG + Intergenic
1061886969 9:133596053-133596075 GGGTGGGTGTGGAGGCAGAGTGG + Intergenic
1062040901 9:134403848-134403870 GTGTGGGTGAGGAGCAGACGCGG + Intronic
1062478879 9:136742475-136742497 GAGTGGGTGTGGAGCAAGCGGGG - Intronic
1062550702 9:137085037-137085059 GGGTGGGGATTGAGGAAAGGGGG + Intergenic
1185622987 X:1464788-1464810 GTGTGTGTGTGGGGGGAAGTGGG + Exonic
1185689382 X:2140651-2140673 GTGAAGGCGTGGAGGAATGGAGG + Intergenic
1185724287 X:2406775-2406797 GGGAGGGTGTAGAGAAAAGGGGG + Intronic
1185894374 X:3844375-3844397 GCGAGGGGGTGGAGGAAAGGGGG - Intergenic
1185899492 X:3882799-3882821 GCGAGGGGGTGGAGGAAAGGGGG - Intergenic
1185904608 X:3921228-3921250 GCGAGGGGGTGGAGGAAAGGGGG - Intergenic
1186325076 X:8467179-8467201 GTGTGTGTGGGGAGGGAGGGAGG + Intergenic
1187192221 X:17045957-17045979 GTGTGGGTGTGGGGAATGGGAGG + Intronic
1187225039 X:17367583-17367605 GTGTGTGTGTGGGGGATGGGGGG + Intergenic
1187414462 X:19081223-19081245 CTGTGGGTGTGGGGGTGAGGTGG - Intronic
1187593436 X:20744084-20744106 GTGAGGGAGTGGAGGAGAGGTGG - Intergenic
1187884710 X:23878758-23878780 GTGGGGGTCTGGGGGAAAGGTGG - Intronic
1187995766 X:24924794-24924816 GTAAGGGTGTGGAGGAAGGAAGG + Intronic
1188747376 X:33862751-33862773 GGGTGGGTGTGGAGGGGAGGTGG - Intergenic
1189271881 X:39757826-39757848 GTGTGGGGATGGTGGAAAGTAGG - Intergenic
1189532724 X:41902953-41902975 GTGTGGGTGGGGATTAAAGAAGG + Intronic
1189608914 X:42710625-42710647 GTGTGGCAGTGGAGGTATGGGGG + Intergenic
1189913466 X:45834785-45834807 GTGGGGGGTTGGAGGAAAGTGGG + Intergenic
1190124544 X:47692059-47692081 GGTTGGGTGGGGAGGAAATGGGG + Intergenic
1190322724 X:49188051-49188073 GTGGAGGTGTGGAGGGAGGGAGG + Exonic
1190464808 X:50715697-50715719 GTGAGGCTGTGGAGGAAAGGTGG + Intronic
1190580932 X:51892974-51892996 GTGTGTTGGGGGAGGAAAGGAGG - Intronic
1192491480 X:71579775-71579797 GTGCGAGTGTGGGGGAAGGGTGG + Intronic
1193933990 X:87592491-87592513 GTGAGGATGTGGAGAAAAGGGGG - Intronic
1194024592 X:88736055-88736077 GTCTGGGTGTGTAGCAAAGAGGG + Intergenic
1194245324 X:91504196-91504218 GTGTGTGTGTGTATGATAGGGGG - Intergenic
1194605582 X:95974631-95974653 GTGTGTGTGTTCAGGAGAGGAGG - Intergenic
1194814335 X:98424199-98424221 GTGTGTGTGTTGGGGAAGGGGGG + Intergenic
1194978653 X:100417630-100417652 GTGGGGGTGGGGTGGGAAGGAGG + Intergenic
1195105543 X:101599300-101599322 GTGGGGATATGGAAGAAAGGAGG - Intergenic
1195107339 X:101614467-101614489 GTGGGGATATGGAAGAAAGGAGG + Intergenic
1195133417 X:101877685-101877707 GTGTGTGTGTTGAGGGAGGGCGG - Intergenic
1195308329 X:103607767-103607789 GTGTGTTTGTGTAGCAAAGGGGG - Intronic
1195316885 X:103687840-103687862 GGGTAGGTGTGGAGGAGGGGAGG - Intronic
1195990166 X:110674448-110674470 GTGTGTGTGTGTGGTAAAGGGGG - Intronic
1196482675 X:116167795-116167817 GTGTGTGGGTGGAGGTGAGGCGG + Intergenic
1196921034 X:120585367-120585389 GTTTTGGTTTGGGGGAAAGGAGG + Intergenic
1197128864 X:122980402-122980424 GGCTGTGTATGGAGGAAAGGAGG - Intergenic
1197163508 X:123350156-123350178 GTGTGGGTGTGGGGGATTGCTGG - Intronic
1197466817 X:126814931-126814953 GTGTGTGTGTGGTGAAATGGGGG - Intergenic
1197693164 X:129523584-129523606 GGGGGGGGGTGGAGGAAGGGGGG - Intergenic
1197892315 X:131279384-131279406 GGGGGAGGGTGGAGGAAAGGGGG + Intronic
1198214365 X:134543652-134543674 GTGTGGGTATGGGGGAACAGCGG + Intergenic
1198440675 X:136660095-136660117 GTGTGTGTGTGTTAGAAAGGGGG - Exonic
1198447743 X:136735334-136735356 GTCGGGGTGGGGAGCAAAGGAGG - Intronic
1198847585 X:140929348-140929370 GTATGTGTGTGGAGGGGAGGAGG + Intergenic
1199681559 X:150228136-150228158 ATGTGGGAGTGGAGGATGGGAGG - Intergenic
1199698666 X:150361488-150361510 GCGTGGGCGTGGAGGGAAGGAGG + Intronic
1199819097 X:151427063-151427085 TTTTGGGAGTGAAGGAAAGGAGG + Intergenic
1199871180 X:151900283-151900305 GTGTGGGAGTGTAGGAGATGAGG + Intergenic
1200072326 X:153535416-153535438 GAGTGGCTGAGGAGGAGAGGAGG - Intronic
1200237297 X:154473835-154473857 GGGTGGGGGTGGTGGAAGGGAGG - Intergenic
1200293754 X:154896496-154896518 GTGTGTGTGTGTACGAAATGGGG - Intronic
1200425458 Y:3015611-3015633 ATGTGTGTGTGGGGGACAGGGGG + Intergenic
1200564294 Y:4745507-4745529 GTGTGTGTGTGTATGATAGGGGG - Intergenic
1200881357 Y:8215711-8215733 GTGTGTGTGTGTTGGAGAGGTGG - Intergenic
1201229929 Y:11854316-11854338 GTGGGGGGTTGGGGGAAAGGAGG - Intergenic
1201782861 Y:17742683-17742705 GGCTGAGGGTGGAGGAAAGGTGG + Intergenic
1201818692 Y:18163304-18163326 GGCTGAGGGTGGAGGAAAGGTGG - Intergenic
1201856116 Y:18545106-18545128 ACATGGGTGTGGAGGAAAGAGGG - Intergenic
1201877205 Y:18775279-18775301 ACATGGGTGTGGAGGAAAGAGGG + Intronic
1202035149 Y:20625547-20625569 GTGTGTGTGTGGAGGAGGAGGGG + Intergenic