ID: 1077196087

View in Genome Browser
Species Human (GRCh38)
Location 11:1280872-1280894
Sequence ACTGTCCCTTCAGCTGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 249}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077196087_1077196093 13 Left 1077196087 11:1280872-1280894 CCAGGGACAGCTGAAGGGACAGT 0: 1
1: 0
2: 4
3: 24
4: 249
Right 1077196093 11:1280908-1280930 AGGCCCAGTGGCACCCGCGCTGG 0: 1
1: 0
2: 3
3: 14
4: 113
1077196087_1077196092 1 Left 1077196087 11:1280872-1280894 CCAGGGACAGCTGAAGGGACAGT 0: 1
1: 0
2: 4
3: 24
4: 249
Right 1077196092 11:1280896-1280918 CAGGCAGGGCTGAGGCCCAGTGG 0: 1
1: 0
2: 13
3: 107
4: 735
1077196087_1077196091 -7 Left 1077196087 11:1280872-1280894 CCAGGGACAGCTGAAGGGACAGT 0: 1
1: 0
2: 4
3: 24
4: 249
Right 1077196091 11:1280888-1280910 GGACAGTGCAGGCAGGGCTGAGG 0: 1
1: 0
2: 13
3: 157
4: 953

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077196087 Original CRISPR ACTGTCCCTTCAGCTGTCCC TGG (reversed) Intronic
900165968 1:1244488-1244510 CCCGTCCCTTCAGCCATCCCAGG - Exonic
900524213 1:3120599-3120621 TCTGTCCCTGCCCCTGTCCCCGG + Intronic
900538659 1:3191783-3191805 ACTGTCCCTCCTGCTGTCCCAGG - Intronic
900951307 1:5859565-5859587 ACTGTCGCCTCTGCTTTCCCAGG - Intergenic
901396935 1:8988514-8988536 ACCGTCCCTTCAGCTGTGGGTGG - Intergenic
902522108 1:17024852-17024874 ACTGTCACTTCAGGTGTCAGTGG - Intronic
903189890 1:21650627-21650649 CCTTCCCCATCAGCTGTCCCTGG - Intronic
903196220 1:21690446-21690468 ACTGTCACCTCATCTTTCCCAGG + Intronic
903325368 1:22565987-22566009 ACAGTCCCCTCAGCTGGCTCTGG - Intronic
903885754 1:26540110-26540132 TCTGTCCCTTCAGCCTGCCCAGG + Intronic
904354578 1:29930761-29930783 CCTCTCCCTACAGCTGTCCCTGG + Intergenic
905522646 1:38612311-38612333 CCTGTCCCCTGAGCTGCCCCTGG + Intergenic
906188072 1:43876925-43876947 ACTGTCACCTCAGCTCGCCCAGG + Intronic
908463176 1:64366273-64366295 ACTGTTCCTCCACCTTTCCCAGG + Intergenic
909378487 1:74968456-74968478 TTTTTCCCTTCAGCTGTACCCGG - Intergenic
909481585 1:76132752-76132774 CTTGTCCCTTCTTCTGTCCCTGG - Intronic
913147144 1:116003286-116003308 ACTGCCCCTTCTGCAATCCCAGG - Intronic
916133444 1:161631393-161631415 AGTGTGCCCTCAGCTTTCCCAGG + Intronic
916959409 1:169873933-169873955 ACTGTGCCTTGTGCTGTGCCAGG - Intronic
918118040 1:181513884-181513906 AGTGGCTCTTCAGATGTCCCTGG + Intronic
920032915 1:203048259-203048281 GCTGTCCCTCCAGCTGCCGCAGG - Intronic
920060281 1:203222553-203222575 ACTGTCCCCTCAGCACCCCCAGG + Intronic
920080620 1:203370244-203370266 ACTGACCCTTCAAGTCTCCCTGG - Intergenic
922553050 1:226511407-226511429 ACTGTGCATTCAGCCATCCCTGG + Intergenic
923015299 1:230121722-230121744 TCAGTCCCTTCAGCAGCCCCAGG + Intronic
923903421 1:238355203-238355225 TCTGTTCCTTCAGATGTGCCTGG - Intergenic
1062839230 10:657414-657436 CCTGTCCCTGGACCTGTCCCTGG + Intronic
1062839406 10:658038-658060 CCTGTCCCTGGACCTGTCCCTGG + Intronic
1065155372 10:22864450-22864472 ACTATGCCATCAGCTCTCCCTGG - Intergenic
1067527703 10:47048309-47048331 AGGGTCCCAGCAGCTGTCCCTGG - Intergenic
1070519459 10:77239295-77239317 ACTGTCCCTGCAGTTCTCTCTGG + Intronic
1072057536 10:91774873-91774895 AATGTCCTTTCAGCTCTCCATGG + Intergenic
1072805445 10:98421058-98421080 ACTGTCCCTGCTGCCTTCCCTGG - Intronic
1076150669 10:128159746-128159768 ACTCTACCTCCAGCTGTCCCAGG - Intergenic
1076690698 10:132222650-132222672 GCTGTCCCTGCTGTTGTCCCGGG + Exonic
1076883780 10:133252159-133252181 GGTGTCCCTGCAGCTGTCTCTGG + Intergenic
1077056601 11:597064-597086 ACTGTCCACTCTGCGGTCCCCGG + Intronic
1077163907 11:1126577-1126599 ACTGCCCGTCCATCTGTCCCAGG - Intergenic
1077196087 11:1280872-1280894 ACTGTCCCTTCAGCTGTCCCTGG - Intronic
1077322451 11:1948355-1948377 GCTGGCCCTTCGCCTGTCCCTGG + Intronic
1078486640 11:11729285-11729307 ACAGTCCTTTCTCCTGTCCCAGG - Intergenic
1078913026 11:15750942-15750964 TCTGCCCCCTCAGCTGTCCCTGG - Intergenic
1079702778 11:23569787-23569809 ATTATCCCTTAAGCTTTCCCAGG - Intergenic
1080568864 11:33537639-33537661 ACTGTCCCTAGTTCTGTCCCTGG + Intergenic
1080765861 11:35296196-35296218 TCTGTCTCATCATCTGTCCCAGG - Intronic
1081616308 11:44593368-44593390 TCTGCCCATGCAGCTGTCCCAGG + Intronic
1081818494 11:45967613-45967635 GCAGTCCCTACAGCTGTCCAAGG - Intronic
1081967448 11:47178243-47178265 TCTGTCCCTTCAGCTGTTCCAGG - Intronic
1082833136 11:57634176-57634198 ACTATTCATTCAGCTGCCCCAGG - Intergenic
1083729407 11:64644706-64644728 ACTGTTTCTTCAGCTCCCCCAGG - Intronic
1083736226 11:64682882-64682904 ACTGTCTCATCAGGTGCCCCTGG + Intronic
1083929096 11:65829550-65829572 ACTCCACCTTCAGCTGTGCCTGG - Intronic
1084700460 11:70783478-70783500 TCTCTCCCAACAGCTGTCCCTGG - Intronic
1085028989 11:73258341-73258363 ACTGGTCCTCCTGCTGTCCCTGG - Intergenic
1085278016 11:75312315-75312337 ACTGTCCCTTCGGCGGTCAGGGG - Intronic
1085815480 11:79732858-79732880 ACTGTCCCAGCAGGTGTGCCAGG - Intergenic
1087005429 11:93466321-93466343 TCTCTTCCTTCAGCTGTACCTGG + Intergenic
1087922967 11:103887958-103887980 ACTGTCACTCCAGCTGTCTTTGG - Intergenic
1088791632 11:113231903-113231925 ACGTTCCCTGCAGCTGACCCTGG + Intronic
1089064053 11:115648983-115649005 ACTGTCACTTCCTCTGTGCCAGG + Intergenic
1089175168 11:116543479-116543501 ACTTTCCCTGCATCTGTACCAGG - Intergenic
1089560600 11:119341342-119341364 CCTGTCCCTTTACCGGTCCCAGG - Exonic
1202805469 11_KI270721v1_random:3668-3690 GCTGGCCCTTCGCCTGTCCCTGG + Intergenic
1092025275 12:5234531-5234553 TTTGTCCCTCCAGCTGTGCCAGG - Intergenic
1092099311 12:5870096-5870118 ACTTTCCCCTCTGTTGTCCCTGG - Intronic
1092490523 12:8940774-8940796 CCTGTCCCTTCTGCTGGCTCAGG - Exonic
1093422598 12:18992218-18992240 TCTGGCCCTTCAACTGCCCCGGG + Intergenic
1094527183 12:31239248-31239270 CCAGTCCCTTCAGCTGTCTATGG - Intergenic
1096945966 12:55410384-55410406 CCTGTCCCTTCTGCTGGCTCAGG + Intergenic
1098841944 12:75487726-75487748 ACTCTCCCTCCAGGTGTCACAGG + Intronic
1099413846 12:82362795-82362817 ACTGTTCCTTGAAATGTCCCTGG - Intronic
1102562058 12:113769395-113769417 ACTGTCCTTGCAGCTGGCCCTGG - Intergenic
1104796289 12:131521614-131521636 AGTGTCCCTTCCCCTCTCCCAGG - Intergenic
1109746605 13:66631352-66631374 ACTGTCACTGCAGCTTTCCTGGG + Exonic
1113848316 13:113404532-113404554 CCTGTCCCTGAACCTGTCCCTGG + Intergenic
1119714427 14:76848836-76848858 ACTGTCCCTCCTGCTCTCTCAGG - Intronic
1120819112 14:88895522-88895544 ACAATCCCTTCTGCTGTGCCTGG - Intergenic
1122054259 14:99081929-99081951 ACTCTTCCTTCAGCTCCCCCAGG - Intergenic
1122695249 14:103549272-103549294 CCTCTCCCTTCTGCTGTCTCTGG - Intergenic
1123007736 14:105332538-105332560 CCTGTGCCCTCAGCTGTCACAGG - Intronic
1123113677 14:105884289-105884311 ACTCTCTCTACAGCTGTACCTGG + Intergenic
1123117929 14:105903038-105903060 ACTCTCTCTACAGCTGTACCTGG + Intergenic
1123402878 15:20004229-20004251 ACTGTCTCTACAGCTGTACCTGG + Intergenic
1123512217 15:21010883-21010905 ACTGTCTCTACAGCTGTACCTGG + Intergenic
1124195452 15:27622504-27622526 TCTTTCCCTTCAGCTTCCCCTGG - Intergenic
1126134595 15:45378232-45378254 AGTGTCCCTTCTGGTATCCCTGG - Intronic
1127671579 15:61199941-61199963 ACTCTTGCTTCACCTGTCCCAGG - Intronic
1127815556 15:62605865-62605887 AATGTCTCTTCAGATGTGCCTGG + Intronic
1130538264 15:84802375-84802397 ACTGTCCCCTCAGGTGTGACCGG + Exonic
1131805023 15:96112744-96112766 ACTGACCCTTTAGCTACCCCCGG - Intergenic
1132658137 16:1049769-1049791 ACTGCCCCTTCATCTCTGCCTGG + Intergenic
1132896056 16:2229922-2229944 TCTCTCCCGTCAGCTTTCCCGGG + Intronic
1133739845 16:8642940-8642962 TCTGTCTCTTCAGCTCCCCCAGG + Intronic
1134501519 16:14772537-14772559 ACTGTCCCTCCAGTTATGCCCGG + Intronic
1134579043 16:15356342-15356364 ACTGTCCCTCCAGTTATGCCCGG - Intergenic
1134723543 16:16401208-16401230 ACTGTCCCTCCAGTTATGCCCGG + Intergenic
1134943886 16:18310662-18310684 ACTGTCCCTCCAGTTATGCCCGG - Intergenic
1135463327 16:22663915-22663937 ACTCTCCCTGGAGCTGTCCTGGG - Intergenic
1136140290 16:28283941-28283963 ACTGCCCCAGCAGCTCTCCCCGG + Intergenic
1138163749 16:54780479-54780501 ACTGATGCTGCAGCTGTCCCAGG + Intergenic
1139421047 16:66849775-66849797 CCTGTCCCTTGAGCTGGGCCAGG - Intronic
1139742033 16:69043742-69043764 ATTTTCACTTCAGCTGTTCCTGG - Intronic
1140778433 16:78272231-78272253 ACTGGCACTTCAGCTGGTCCAGG + Intronic
1141709439 16:85689243-85689265 GGTGTCCCTTCACCTGTCCCCGG + Intronic
1141810772 16:86373897-86373919 TCTGTCCATTCACCTGACCCTGG - Intergenic
1141836140 16:86540884-86540906 ACTTTCCCTGCAGGTGTCCTGGG - Intronic
1142192800 16:88725593-88725615 ACTGTCTTTTCAGCTGGGCCAGG + Exonic
1142603375 17:1068369-1068391 CCTCTCCCTTCAGCCCTCCCTGG - Intronic
1142603397 17:1068460-1068482 CCTCTCCCTTCAGCCCTCCCTGG - Intronic
1142605050 17:1076861-1076883 TCTGGCCCTTCCCCTGTCCCTGG + Intronic
1144087263 17:11822047-11822069 TCTTTACCTTCAGCTGTCGCCGG - Exonic
1145915942 17:28574066-28574088 ACTGTGCCCCCAGCTGTCCCAGG - Exonic
1146630362 17:34465182-34465204 ACTGTCTGTCCATCTGTCCCAGG - Intergenic
1146648836 17:34593723-34593745 ACTTTCCCTTCTGCTCTGCCAGG + Intronic
1146693704 17:34893406-34893428 ACTGTCCCTCCTGCTGACTCTGG + Intergenic
1147134918 17:38428950-38428972 CCTCTCCCTCCAGCTGTGCCGGG - Intronic
1147330442 17:39696115-39696137 ACTGTCCCTCCAGCAGGGCCTGG - Intronic
1147450218 17:40499713-40499735 TCTGTGTCCTCAGCTGTCCCGGG - Intronic
1147521201 17:41175318-41175340 ACTATCCGTTCAGCTGTTTCTGG - Intergenic
1147552122 17:41450826-41450848 ACTGCACCTCCAGCTCTCCCTGG + Intergenic
1148025051 17:44581370-44581392 ACTGCCCCTTCTGCTATGCCTGG + Intergenic
1148187398 17:45654616-45654638 CCTGTCCCCACAGTTGTCCCCGG + Intergenic
1148774719 17:50088857-50088879 ACTGTCTCTGCAGCTGCCCTCGG + Intronic
1149491900 17:57091194-57091216 GCTGTGCCTTTAGCTGTCTCTGG + Intronic
1149645235 17:58236022-58236044 ACTCTGGCTTAAGCTGTCCCTGG - Intronic
1150107797 17:62475253-62475275 TCTGTCCCTTCACCTGTCCCAGG - Intronic
1151455196 17:74221772-74221794 ACTGGAGGTTCAGCTGTCCCTGG + Intronic
1152074525 17:78150694-78150716 TCTACCCCTTCAGGTGTCCCAGG - Intronic
1152684552 17:81687643-81687665 ACAATCCCTGCAGATGTCCCCGG - Intronic
1152733233 17:81983724-81983746 ACTGTCCCGTCCCCCGTCCCTGG - Intronic
1157698624 18:49745142-49745164 ACAGTCCCTTCCTCTGTCCTGGG - Intergenic
1160060349 18:75524203-75524225 TCTGTGCCTTCAGCAATCCCTGG - Intergenic
1162170434 19:8784838-8784860 ACTGCCCCTGGAGCTGCCCCAGG - Intergenic
1162591868 19:11597421-11597443 ACTGTCCATTCAGATGGGCCCGG + Exonic
1162617524 19:11814249-11814271 ACTGTCCCTTCCCCCTTCCCCGG - Intergenic
1163647777 19:18499812-18499834 CCTGTCCCATCAGCCATCCCTGG - Intronic
1164564476 19:29315957-29315979 GCTGTCTCTACAGCTGTCACAGG - Intergenic
1165321098 19:35085629-35085651 ACTGGCCTCTCTGCTGTCCCTGG + Intergenic
1166292116 19:41869893-41869915 ACTGTCCTTTCTCCTGTCTCTGG - Intronic
1166360059 19:42249313-42249335 GCTGCCCCCTCAGCTCTCCCCGG - Exonic
1166938851 19:46350921-46350943 ACTGTCCCCTCAACTGTGGCTGG + Intronic
1167152908 19:47719786-47719808 CCTCTCCCTCCCGCTGTCCCAGG - Intronic
1167269665 19:48499764-48499786 ACGGTCCCTTCCCCTGGCCCTGG - Exonic
925337769 2:3111224-3111246 ACTTGCCCCTCGGCTGTCCCTGG + Intergenic
925401368 2:3575579-3575601 GCTGTGCCTTCAGTTCTCCCAGG + Exonic
927866012 2:26588139-26588161 AGTGTCACTGCAGCTGTCCACGG - Intronic
932410074 2:71542012-71542034 ACTCTGCCTTCAGCTGTCCATGG - Intronic
934856490 2:97733275-97733297 ACTGTCCCTTCTGCTCCCCCAGG + Exonic
936160439 2:110080558-110080580 ACTGCCCCCTCATTTGTCCCAGG + Intergenic
936184225 2:110290796-110290818 ACTGCCCCCTCATTTGTCCCAGG - Intergenic
938764112 2:134449117-134449139 ACTGTCACTGCAGCTGCTCCAGG + Exonic
940192910 2:151061517-151061539 AGTGGCTCTTCAGCTCTCCCAGG + Intergenic
940642615 2:156362280-156362302 ACTGTCTCTGCTGCTGTCACTGG + Intergenic
942141324 2:172980144-172980166 ACTCTCTCTCCAGCTATCCCAGG - Intronic
943649991 2:190446956-190446978 CCTGTCCCAGCAGCTGGCCCAGG - Intronic
945840690 2:214884295-214884317 ACTGTCCATTCACCTATACCTGG + Intergenic
946892544 2:224293151-224293173 ACTGTGACTTCATCTGTCCTTGG + Intergenic
947371763 2:229453809-229453831 TCTGTCCATTTATCTGTCCCTGG - Intronic
948987262 2:241533156-241533178 ACTGTCCCTTGAGGGGTTCCAGG + Intergenic
1169544380 20:6635739-6635761 TCTGTCACTTGAGATGTCCCGGG + Intergenic
1170522241 20:17198597-17198619 CTTGTTCCTTCAGCTGACCCAGG - Intergenic
1170941062 20:20848299-20848321 CTTGACCCTTCAGCTGCCCCGGG - Intergenic
1170984358 20:21244405-21244427 ACTGCCATTGCAGCTGTCCCTGG + Intronic
1171080071 20:22171931-22171953 AATGTGTCTTCAGCTGTCCATGG + Intergenic
1173811655 20:45959572-45959594 ACTGTCCATTCTGGTGGCCCAGG + Intronic
1174559724 20:51422077-51422099 AGTGTCCTTTCAGCTTTCCTGGG + Intronic
1175493555 20:59395918-59395940 GCTGTCCCTGAAGCTGTCCCTGG + Intergenic
1175855383 20:62118301-62118323 GCTGTCCCTCCAGCTGCACCTGG + Intergenic
1176423360 21:6533257-6533279 TCTGTCCCTTCAGCTGAAGCGGG + Intergenic
1179232428 21:39517189-39517211 GCTGTCCCTTCAGCCTTCCATGG + Intergenic
1179698854 21:43141573-43141595 TCTGTCCCTTCAGCTGAAGCGGG + Intergenic
1179723735 21:43330416-43330438 ACTGTCCCATGAGTTGTCCAAGG - Intergenic
1181173308 22:21022433-21022455 ACTGTACCTTCATCTGGCCAGGG + Intronic
1182280720 22:29216475-29216497 TCTGTCCCTTGAGCTGTCTCTGG - Intronic
1182566552 22:31204476-31204498 TCTGTCTCTCCAGCTGTCCCTGG + Exonic
1183362854 22:37391678-37391700 ACTGTCCCTTCACCTATGCCTGG - Intronic
1183543761 22:38444651-38444673 ACTGTTCCTCCTGCTGTCTCTGG - Intronic
1184598582 22:45529062-45529084 CTTGTCCCTTCAGCTGCCCGGGG + Intronic
1184650085 22:45915669-45915691 ACTGTCCCTTCAGTTACCCCAGG + Intergenic
1184691284 22:46118462-46118484 ACTGGCCCTCCTGCAGTCCCCGG + Intergenic
1184841861 22:47056848-47056870 TCTGTCCCTGCAGCTTCCCCGGG - Intronic
1184845560 22:47082765-47082787 ACATTCCCATCAGCTGTGCCTGG - Intronic
952339875 3:32436640-32436662 ACTGTCCCTGCATCTGACCTTGG - Intronic
953631500 3:44621845-44621867 ACTATACCTTCAGCTCTCCTGGG + Intronic
954381338 3:50220778-50220800 CCTGTCCCTTCACCAGTCCTGGG + Exonic
955094427 3:55783056-55783078 ACTTTCCTTACAGTTGTCCCCGG + Intronic
956044595 3:65181833-65181855 TGTGTTCCTTCAGCTGCCCCTGG - Intergenic
960609423 3:119541847-119541869 ATTGTCCCCTTAGCTGTCCTTGG + Intronic
961633511 3:128318500-128318522 CCTGTACCTTCTGCTGTCCTGGG - Intronic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
962731033 3:138283774-138283796 ACTGTCCTTCCAGCTGGCACAGG + Intronic
962868996 3:139472036-139472058 ACAGTGCCTTCTGGTGTCCCAGG + Intronic
963852375 3:150221518-150221540 ATTGTCCCTCTCGCTGTCCCCGG - Intergenic
963876670 3:150483636-150483658 CCTGTCCCCTTAGCTGCCCCAGG - Intergenic
966099162 3:176244955-176244977 GCTGACCTTTCAGCTGTGCCAGG + Intergenic
968479689 4:827585-827607 ACCGTCCCTTCCTCTCTCCCGGG + Intergenic
968487525 4:871072-871094 GCTGACCCAGCAGCTGTCCCAGG + Intronic
968900667 4:3430231-3430253 GCTGTCCCTTCCGCTGTCTGTGG + Intronic
971238776 4:24868670-24868692 ACCGTCCCTTCATCTTACCCAGG - Intronic
972730273 4:41788063-41788085 CTTCTCCCTTCAGCTGTCTCAGG - Intergenic
974415361 4:61599660-61599682 TCTGTCCCTCCAGCTTTCCTTGG - Intronic
974419671 4:61657211-61657233 ACTTTCCCTTAAGCTGACGCAGG + Intronic
976033528 4:80787871-80787893 ACTGACACTTCAGCTGTGTCAGG - Intronic
979328616 4:119405148-119405170 ACTATCCCTGCAGCTGTACCGGG + Intergenic
981675486 4:147338543-147338565 ACACTCACTTCAGCTGTACCAGG - Intergenic
983189934 4:164744513-164744535 ACTGCACCTGCAGCTGTACCTGG - Intergenic
984575109 4:181438717-181438739 ACGGCCCCTCCATCTGTCCCAGG - Intergenic
986152345 5:5139780-5139802 AGTGTCCCCACAGCTGTGCCCGG + Intergenic
989452082 5:41598202-41598224 ACTGACACTTCAGTTCTCCCTGG - Intergenic
990162896 5:52962863-52962885 ACTATACCATCAGCTTTCCCGGG - Intergenic
990606097 5:57411517-57411539 TGTGTCCCTTGAGCTATCCCAGG + Intergenic
993692392 5:91018317-91018339 ACAGTTCCTTCTGCTGTCCCGGG + Intronic
993850837 5:93006596-93006618 ACTGTCCCTTCAGCTTCCACAGG - Intergenic
996598216 5:125229629-125229651 ACTGTCCTTTTTTCTGTCCCAGG + Intergenic
998250834 5:140551118-140551140 ACTGTTCCTGCAGCAGTGCCAGG + Exonic
1000145912 5:158453081-158453103 ACTGTCCCTTTAGCCCTCCTAGG + Intergenic
1000836839 5:166165764-166165786 ACTGTACCGTCTGCTGTCCATGG + Intergenic
1001592672 5:172876727-172876749 CCTGTCCTTTCCGCTCTCCCTGG + Intronic
1002351214 5:178585061-178585083 ACCTTCCCTTCAGCTGTGGCCGG + Intronic
1002564196 5:180100726-180100748 ACTGTGGCTACAGCAGTCCCCGG + Intergenic
1004037550 6:11938575-11938597 ACTGTCCCTTCTGGTCTGCCAGG + Intergenic
1006848272 6:37078289-37078311 AAAGTGTCTTCAGCTGTCCCTGG + Intergenic
1006930579 6:37685690-37685712 ACTGTCGGTTCACATGTCCCTGG - Intronic
1007113671 6:39328330-39328352 AATCACCCTTCAGCTTTCCCTGG - Intergenic
1007498673 6:42279362-42279384 CCTGGCCCTGCAGCTGTCCTGGG + Intronic
1007749085 6:44061067-44061089 GCTGTCCCTCCAGGGGTCCCAGG - Intergenic
1008408750 6:51148290-51148312 CCTGTCCCGGCAGCTCTCCCAGG - Intergenic
1009637956 6:66290700-66290722 ACTATGCCATCAGCTGTCCTAGG - Intergenic
1012357263 6:98330337-98330359 ACTGTCCCTGCAGCTAGTCCTGG + Intergenic
1017936955 6:159014346-159014368 ACTGTACCACCAGCTTTCCCGGG - Intergenic
1018432738 6:163735764-163735786 GCAGTGCCTTCAGCTGTCCAGGG + Intergenic
1018688216 6:166320114-166320136 ACTGTCACGTCAGTTGTTCCTGG + Exonic
1018935584 6:168271875-168271897 TCTCTCACTTCTGCTGTCCCGGG - Intergenic
1019631192 7:2050685-2050707 TCTGCCCCTTCAGTTGTCCTTGG - Intronic
1021896209 7:25238398-25238420 ATTGTGCCCTCAGCTGCCCCTGG - Intergenic
1022781469 7:33588861-33588883 ACTGTCCTCTTTGCTGTCCCTGG - Intronic
1024147854 7:46535525-46535547 TCTCTACCTTCAGCTGTCCATGG + Intergenic
1024168098 7:46754954-46754976 CCTGTCCTTTCAGCTGGCCTTGG - Intronic
1024224806 7:47318316-47318338 TTTATCCATTCAGCTGTCCCTGG + Intronic
1024661400 7:51498640-51498662 CCTCTCCCATCAGCTGTGCCTGG - Intergenic
1024758675 7:52567923-52567945 ATTGTCCCTGCACCAGTCCCTGG - Intergenic
1025921565 7:65918002-65918024 ACTGTCACTGTAGCTGTCCCTGG - Intronic
1026943673 7:74303061-74303083 ACCCTCCCATCAGCTCTCCCAGG + Intronic
1027051799 7:75025450-75025472 CCTGTCCCCTCGGCTCTCCCTGG + Intergenic
1032036843 7:128527793-128527815 TCTGTCCCTTCACCTGTCCCAGG - Intergenic
1032125490 7:129189592-129189614 TCTGTCCCTCCAACTCTCCCGGG - Intronic
1033590257 7:142802813-142802835 GCTGTCACTTCAGATGTCCAAGG - Intergenic
1034358599 7:150474056-150474078 ACTGTCAGTTCTGATGTCCCCGG - Exonic
1034584745 7:152079372-152079394 ACTGGCTCATCAGCTGTCCCAGG + Exonic
1035282524 7:157786989-157787011 CCTGCCCCTCAAGCTGTCCCAGG - Intronic
1035675437 8:1452535-1452557 ACTGGGCCTCCAGCTCTCCCCGG - Intergenic
1036386639 8:8287475-8287497 TCTTTCCCTGCAGCTGTTCCTGG - Intergenic
1036557674 8:9874305-9874327 ACTGTCACTCCAGCTTTGCCAGG - Intergenic
1037729680 8:21513949-21513971 ACTGTTCTTACAGCTTTCCCTGG - Intergenic
1037839604 8:22234288-22234310 GCTGTGCCTTCACCTGTCGCCGG - Intergenic
1038000943 8:23390615-23390637 ACTGTACCTTCAGCCTTCCCAGG - Intronic
1043192329 8:77241435-77241457 ACTGTGCCTTCTAGTGTCCCTGG + Intergenic
1044277899 8:90323299-90323321 CCTTGCCCTTGAGCTGTCCCTGG - Intergenic
1045287466 8:100804370-100804392 AATGGCCCTTCAGCTGTGCATGG + Intergenic
1045553287 8:103191864-103191886 CCTGTCTCTGCAGCTTTCCCTGG - Intronic
1047313103 8:123708771-123708793 ACAGTCCCTCCAGCAGCCCCGGG + Intronic
1049564111 8:143329030-143329052 CCTGTCCTTTCAGCGGTCCATGG + Intronic
1050409832 9:5351482-5351504 AATGGCCCTTGAGCTGTCTCAGG + Intergenic
1051994685 9:23200884-23200906 ACTATACCATCAGCTCTCCCAGG + Intergenic
1053020531 9:34691072-34691094 ACTCTCCCTTCAGCCTTACCTGG + Exonic
1057226307 9:93295091-93295113 CCTGTGCTTTCAGATGTCCCAGG + Intronic
1058147216 9:101425452-101425474 ACTGTTCCTGCAGCTGTTCCTGG - Exonic
1059309905 9:113381091-113381113 ACTGTCACCTCAGCAATCCCTGG - Intergenic
1059518763 9:114920287-114920309 ACTGTCCCTGTATATGTCCCTGG - Intronic
1059799675 9:117737591-117737613 AGTGTCCCCTCTGCTGTTCCAGG - Intergenic
1060747053 9:126144396-126144418 CCTGTCACTGCAGCTGTCCAGGG - Intergenic
1062119198 9:134824939-134824961 CCTGTCCCTTCCGCTGTGCCTGG - Intronic
1186454351 X:9699468-9699490 ACTATTCTATCAGCTGTCCCTGG + Intronic
1187891262 X:23937132-23937154 CCTCTCCCTTCAGTTGTTCCTGG - Intronic
1189146376 X:38659285-38659307 ACTGTTCTGTCAGCTTTCCCAGG - Intronic
1189288308 X:39867501-39867523 CCAGTCCCTTCAACTGTCCCTGG + Intergenic
1194855355 X:98920744-98920766 ACGGTCCCTTCAAGTGTTCCAGG - Intergenic
1195576968 X:106462228-106462250 ACTTTCCCTTAAGCTCTCACAGG - Intergenic