ID: 1077199678

View in Genome Browser
Species Human (GRCh38)
Location 11:1299669-1299691
Sequence CAGTATGTGCATCTTGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077199678_1077199679 14 Left 1077199678 11:1299669-1299691 CCATGTACAAGATGCACATACTG 0: 1
1: 0
2: 0
3: 11
4: 119
Right 1077199679 11:1299706-1299728 AAGTCTAAATGCCCGTGTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077199678 Original CRISPR CAGTATGTGCATCTTGTACA TGG (reversed) Intronic
906800422 1:48732413-48732435 CTTTATGAGCATCTTGTTCAGGG - Intronic
908834156 1:68211755-68211777 CACCATGTGGATCTTGGACATGG + Intronic
909667872 1:78155631-78155653 CAGTATATGCATCTTTTTCATGG - Intergenic
910813405 1:91261951-91261973 CAGTATGTTAATTTTGTAAAGGG - Intronic
911404206 1:97415802-97415824 TAGCATGTGCAGCTTGTACAGGG + Intronic
911404545 1:97420257-97420279 CAGTATCTGCATCTGGAAGACGG - Intronic
912415141 1:109503146-109503168 CAGTATTTTCATGTTGTAAATGG - Intergenic
914751184 1:150536139-150536161 CAGTATGTGCTTCTTGGAAGAGG + Intergenic
918741773 1:188140784-188140806 TAGTATTTGCTCCTTGTACATGG - Intergenic
919125027 1:193382987-193383009 CAGTATGTGCTTCTGGTGCCAGG + Intergenic
920698839 1:208202601-208202623 CTGTCTGTGGATTTTGTACATGG - Intronic
923118994 1:230972745-230972767 CAGTATGTAGATCTTTTAAAAGG + Intronic
1063351622 10:5362088-5362110 CAGCATGAGCATGTTGTTCAGGG - Intergenic
1064128410 10:12685413-12685435 GAGTTTCTGCATCTTTTACAAGG + Intronic
1068775783 10:60866286-60866308 CAATGTGTGCATCTAGTCCATGG - Intergenic
1070366197 10:75739389-75739411 CAGCATATGAATTTTGTACATGG - Intronic
1073422200 10:103433719-103433741 CAGAATGTGCATCTCTTCCAGGG - Intronic
1074687862 10:115976473-115976495 CAGTGTGTGCATCTTGCCCTTGG + Intergenic
1075207923 10:120462746-120462768 CAGAATCTGCATTTTGAACAGGG + Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1081026201 11:38018658-38018680 CAGTTTTTGGATCTTGTATAAGG - Intergenic
1081245188 11:40757296-40757318 TAGGATGGGCATCTTGTAGATGG + Intronic
1081711259 11:45217448-45217470 CAGAATTTGCATCTTGTCCTAGG - Intronic
1082979797 11:59108926-59108948 TAGTATGTTCATATTTTACATGG + Intronic
1087441783 11:98193861-98193883 GAGTATGTGTAACTTGTTCAAGG + Intergenic
1090795092 11:130128485-130128507 AAGTCAGTGCATCTTGTTCAGGG + Intronic
1092455196 12:8636825-8636847 CAGCAGCTGCATCTTGTCCATGG - Intergenic
1093056772 12:14563881-14563903 CAGTATGTTCATTCTTTACACGG - Intronic
1104908134 12:132226298-132226320 CAGTATGTGCAGCGTGTATATGG - Intronic
1107847915 13:44537091-44537113 CAGTAAGTGCATTTTTTTCATGG + Intronic
1110083767 13:71350631-71350653 CAGAATGTGAAACTTTTACAGGG - Intergenic
1114319295 14:21533804-21533826 CAGCATTTGCATGTTGTATATGG + Intronic
1117245758 14:53885129-53885151 CTGTATGTGCATGTTTTACTTGG - Intergenic
1117879176 14:60292775-60292797 AAATATGAGCATTTTGTACAAGG - Intronic
1125033584 15:35097498-35097520 CAGCATGTGCATTTGGGACAGGG - Intergenic
1127175550 15:56351534-56351556 CAGTATCTGCATATTGTGTAAGG + Intronic
1129556347 15:76514048-76514070 CAGTGTGTGCATCCTGTGCTTGG - Intronic
1131672283 15:94632405-94632427 CAGAAGGTGAATCTTGTACAAGG - Intergenic
1135804674 16:25532015-25532037 CAGAATCTGCATCTTTAACAAGG + Intergenic
1140124384 16:72107696-72107718 CACGATGAGCATCTTGGACAGGG - Exonic
1141044343 16:80703113-80703135 GTGTATGTGCATATTCTACATGG - Intronic
1141454510 16:84131285-84131307 CAGTTTCTACCTCTTGTACAGGG - Exonic
1143776261 17:9201124-9201146 CAGAATTTGCATCTTGAAGAAGG + Intronic
1145199206 17:20925826-20925848 CAGTATTTGCCTTTTGTAAATGG + Intergenic
1146051796 17:29560057-29560079 CAGTGGGTGCATCTGGCACAAGG + Intergenic
1150629887 17:66872169-66872191 CAGTCTGTGAATTTTGTATACGG + Intronic
1151036478 17:70805960-70805982 CCGTATGGCCATCTTGTTCATGG + Intergenic
1156202100 18:34845188-34845210 CAGTATGTTCAAATTATACAAGG - Intronic
1156396950 18:36707347-36707369 CAGGTTGTGCATCTTCTACTGGG - Intronic
1156705735 18:39879293-39879315 CAGTCTCTGCATCCTGTAAAAGG + Intergenic
1157715175 18:49880050-49880072 CAGTTTGTTCATCTACTACATGG - Intronic
1160157273 18:76443163-76443185 CAGGAGGTGCACCTTCTACATGG + Exonic
927813675 2:26195185-26195207 CAGCAGCTGCATCTTGTCCACGG + Exonic
929469057 2:42172731-42172753 CAGTATATACATTTTGCACATGG - Intronic
931396912 2:61895808-61895830 CAGTCTGTGCATCTGGTAATAGG + Intronic
931648720 2:64449709-64449731 CAGTATCTGCATCATGAAGAGGG - Intergenic
935315326 2:101827751-101827773 CAGTATCTTCATATTGAACATGG + Intronic
936733498 2:115411441-115411463 CTGTATTTGCATCTTGGTCAAGG + Intronic
937739180 2:125329469-125329491 CAGCATGTTCATCTTTTAAATGG - Intergenic
938966113 2:136389990-136390012 CCTTATTTGCATCTTGTGCAGGG + Intergenic
941437980 2:165495557-165495579 TCATATGTGCATCTTTTACAAGG - Intronic
941448409 2:165629435-165629457 CAGTTTGTGCATCTCATTCACGG + Intronic
942204163 2:173602899-173602921 CAGTATTTGCATTTTGAACTGGG + Intergenic
943482095 2:188431704-188431726 AAGTATGAGCATGTTGTAAATGG - Intronic
944500347 2:200352987-200353009 CAGCATCTACATGTTGTACATGG + Intronic
946885687 2:224220236-224220258 CAGTTTGTCCAGCTTTTACAAGG + Intergenic
1170069898 20:12355165-12355187 CAGTATGTATTTCTTGTTCATGG + Intergenic
1173741024 20:45402048-45402070 CAGCATCTGCATCTTGCACCTGG + Intronic
1175786215 20:61713234-61713256 CAGGATGTGCACCTTGAACCTGG - Intronic
1177194959 21:17894432-17894454 CAGTATGTGCATCTTATTGTGGG + Intergenic
949820148 3:8107150-8107172 CAGGATCTGCAGCTTGTAGATGG + Intergenic
950469692 3:13176942-13176964 CAGTATGTACCTGTTGTACCTGG - Intergenic
951421100 3:22486019-22486041 CATTCTGTGCTACTTGTACAGGG + Intergenic
953272322 3:41457706-41457728 CTTTGTGTGCATCTTGTACAGGG + Intronic
958450033 3:94261137-94261159 TAATATCTCCATCTTGTACAGGG + Intergenic
958525354 3:95251743-95251765 CAGTATGTGTAAGATGTACATGG + Intergenic
959228229 3:103614217-103614239 ATGTGTGTGCATCTTTTACATGG - Intergenic
962061254 3:131929940-131929962 CTGCATGTGGATCTTATACATGG - Intronic
966399109 3:179529999-179530021 GAGTATGTGCCTCTTCTCCAGGG - Intergenic
966559568 3:181304908-181304930 CACTATGAGCATCTTTTACAAGG - Intergenic
969160702 4:5256131-5256153 CAGTATCTGCATCTCTAACATGG - Intronic
976331632 4:83838401-83838423 AAGTATGTGAGTCTTGTTCAGGG - Intergenic
981110179 4:140925995-140926017 AAGAATGTTCATCTTGCACATGG + Exonic
984840773 4:184065362-184065384 CGGTATGAGCACCTTGTACAGGG + Intergenic
985321473 4:188716518-188716540 CAGTATGTTCATCTATAACATGG - Intergenic
986830334 5:11570001-11570023 TAGTATGTGCATCTTGTCTTAGG - Intronic
988983645 5:36596282-36596304 CAGTAAGTGCCTCTTGAAAAGGG + Intergenic
993969992 5:94407583-94407605 CAGTATGTGCATTTTGTGTCCGG - Intronic
996619528 5:125483238-125483260 CAGTAGGTACATGTTGTAAAAGG + Intergenic
999207903 5:149863277-149863299 GAGTATGTGCCTCTGGTGCAAGG + Intronic
999273030 5:150309081-150309103 CATTATCTGCATCTTGCCCATGG + Intronic
1001403821 5:171461995-171462017 TAGGATGTGCATTTTGTAGATGG + Intergenic
1008685519 6:53921975-53921997 CAGCATGTACATCTTTTAAATGG - Intronic
1011930904 6:92711272-92711294 CAGCATCTGCAACTTGTACTGGG - Intergenic
1015834124 6:137401118-137401140 TAGAATGTGCATCTTGAATAAGG - Intergenic
1016512533 6:144859701-144859723 CAGTATGTGCTTCTGGAACAGGG - Intergenic
1017095377 6:150800208-150800230 CAGTTTGTGCATCATATAAAAGG + Intronic
1018535374 6:164813363-164813385 CAGTATGTGCTTCTGGAACTGGG + Intergenic
1020342664 7:7129424-7129446 CAGCACATGCAACTTGTACAAGG + Intergenic
1022577613 7:31513550-31513572 AATTTTGTGCATCTTGTATATGG + Intergenic
1024341295 7:48264340-48264362 CAGTTTGTGAATTTTGTAAAAGG - Intronic
1029105461 7:98171647-98171669 CAGGAAGTGCAGCTTGTGCATGG - Exonic
1030171198 7:106604559-106604581 CAGTATTGGAATCTTGTAGAAGG + Intergenic
1030441157 7:109591682-109591704 CAGTATGTTACTCTTGAACAAGG - Intergenic
1031271269 7:119652606-119652628 CAGAATGTGAACCTTGTGCAGGG + Intergenic
1032433374 7:131880773-131880795 CAGGATGTTCTTCTTGTACCTGG + Intergenic
1035626312 8:1073664-1073686 CTGTGTGTGCATTTTGTAGATGG + Intergenic
1036040655 8:5076616-5076638 CTGTATATGCATCTCATACATGG - Intergenic
1036419091 8:8579341-8579363 CAAAATGTCCATCTTGTTCAAGG + Intergenic
1036651633 8:10647793-10647815 CTGTTTGTACATCTTGTTCATGG - Intronic
1039558090 8:38491268-38491290 CAGTCTGTGCATTCAGTACAGGG - Intergenic
1041076286 8:54173060-54173082 AAGTGTGTGCATCATGGACAAGG - Intergenic
1048436775 8:134425587-134425609 CTGAATGTGCATCTGGGACATGG + Intergenic
1048876825 8:138843191-138843213 CAGCATCTGCATCTTGTGCCTGG - Intronic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1057888761 9:98852155-98852177 CAGTAACTCCATCTTGAACAGGG - Intergenic
1059670613 9:116488078-116488100 CATCATGTACATCCTGTACATGG - Intronic
1059943470 9:119381171-119381193 CAGTATCTTCATCTTCAACATGG + Intergenic
1061229738 9:129308257-129308279 CAGTTTCTCCATCTTGTACATGG - Intergenic
1186471061 X:9822520-9822542 CAGTATCCGCATCTGGTGCAGGG + Intronic
1190068205 X:47257753-47257775 CAGAATGTGCAACTTTTAAAAGG - Intergenic
1192151110 X:68712964-68712986 CAGTATGTGCAGCTTTTTGAAGG + Exonic
1194799874 X:98259597-98259619 CTGTATGTACACCTTTTACAAGG + Intergenic
1195463350 X:105152782-105152804 CAGAATGTGCTTCTTATAAAAGG + Intronic
1197387935 X:125823541-125823563 CTGTGAGTGCATCTTGTCCAAGG + Intergenic
1198137308 X:133766788-133766810 CATTATGTCCATCTTCTTCAAGG + Intronic
1198422830 X:136484897-136484919 GAGTATGTGCATTTTGAACAAGG - Intergenic
1199409765 X:147507815-147507837 CTGTATGTGTAGCTTGTTCATGG + Intergenic
1201267114 Y:12217943-12217965 CAGTAAGTGCATCCTGCACAGGG - Intergenic
1202175645 Y:22096658-22096680 AAGTATCTGCATCTTGGAAAAGG - Intergenic
1202215716 Y:22489725-22489747 AAGTATCTGCATCTTGGAAAAGG + Intergenic