ID: 1077199679

View in Genome Browser
Species Human (GRCh38)
Location 11:1299706-1299728
Sequence AAGTCTAAATGCCCGTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077199678_1077199679 14 Left 1077199678 11:1299669-1299691 CCATGTACAAGATGCACATACTG 0: 1
1: 0
2: 0
3: 11
4: 119
Right 1077199679 11:1299706-1299728 AAGTCTAAATGCCCGTGTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077199679 Original CRISPR AAGTCTAAATGCCCGTGTGA AGG Intronic
906887710 1:49669433-49669455 AAGTTCAAATGCCAGTGTGTGGG + Intronic
910277405 1:85464455-85464477 AAATAAAAATGCCCGTGAGACGG + Intronic
912573888 1:110646350-110646372 AAGTCTAAATCCAATTGTGATGG - Intergenic
915876220 1:159614236-159614258 AACTCTACATGCCCATGTCAAGG + Intergenic
915918040 1:159952844-159952866 AAATGTAAATGCCCCTGAGAGGG - Intronic
921965059 1:221079419-221079441 TATTCTAAAAGCCTGTGTGAAGG - Intergenic
923216167 1:231850085-231850107 AAGAGTAAATGCCTGTGGGAGGG + Intronic
923403291 1:233636603-233636625 AAGTTTAGATGCCTGTGTGATGG + Intronic
1065270633 10:24029832-24029854 GATACTACATGCCCGTGTGAGGG - Intronic
1065556858 10:26924453-26924475 AAGTCTAAATCACCGTTTGTAGG + Intergenic
1067364204 10:45610031-45610053 AAATCTAATTCCCAGTGTGATGG + Intergenic
1072507271 10:96080916-96080938 ATGCCTAAATGCCAGTGGGAAGG + Intergenic
1073225824 10:101917917-101917939 AAACCTAAATGCCAGTGTGGGGG - Intronic
1075640940 10:124064352-124064374 CAGTCAAAGTGCCTGTGTGATGG + Intronic
1077199679 11:1299706-1299728 AAGTCTAAATGCCCGTGTGAAGG + Intronic
1077634560 11:3833493-3833515 AACTCTGAATGCCAGTATGAGGG - Intronic
1078897471 11:15609730-15609752 AAGTCTGAATGTTCTTGTGAAGG - Intergenic
1080236870 11:30080024-30080046 AAATCTAAATGCCCCTTTGATGG + Intergenic
1089109553 11:116044480-116044502 AAGTCTAATCCCCAGTGTGATGG - Intergenic
1097923800 12:65105796-65105818 AAGTTTAATTGCCAGTGTGGCGG - Intronic
1105627321 13:22125439-22125461 AAGTCTAAATCCCAATGTGATGG - Intergenic
1111391311 13:87598238-87598260 TAGTCTAAATGCTCATGTGAAGG + Intergenic
1113670718 13:112173882-112173904 TAGTCTAAATATCCCTGTGAGGG - Intergenic
1123881605 15:24681453-24681475 AAGCCTAACTTCCAGTGTGATGG + Exonic
1129549650 15:76433994-76434016 AAATCTCAAGGCCCATGTGATGG - Intronic
1130363679 15:83213314-83213336 AACTCTAATCGCCAGTGTGATGG + Intergenic
1134934535 16:18235081-18235103 AAGTCTAACCCCCAGTGTGATGG - Intergenic
1137357284 16:47778839-47778861 AACTCTCAATGCCCCAGTGAAGG + Intergenic
1140767498 16:78174072-78174094 AACCCTAATTGCCCATGTGATGG - Intronic
1141511391 16:84514431-84514453 AAGTGGAAAGGCCCGGGTGAAGG - Intronic
1148597414 17:48867699-48867721 AAGTCTTTAGGCCAGTGTGATGG + Intergenic
1150930866 17:69583726-69583748 AAATGTAGATGCTCGTGTGAAGG + Intergenic
1158959369 18:62575777-62575799 AACTCTAAAGGCCCTTTTGAAGG + Intronic
931838134 2:66121192-66121214 AAATCTAATTGCCGTTGTGATGG - Intergenic
940372800 2:152921527-152921549 AAATCTAATCGCCAGTGTGATGG - Intergenic
949078853 2:242080442-242080464 AAATCCTAATCCCCGTGTGACGG + Intergenic
1169910818 20:10646285-10646307 GTGACTAAATGCCCATGTGAGGG - Intronic
1174578793 20:51556393-51556415 AAGTCTAAAGGCCATTGTTACGG - Intronic
1179606513 21:42519229-42519251 AATTCTAAATGCCCCTTTGAGGG - Intronic
1180523972 22:16236540-16236562 AAGACCAAATCTCCGTGTGATGG + Intergenic
1181348625 22:22239297-22239319 AATCCTAAATGCCAGTGTGATGG - Intergenic
1182164558 22:28160233-28160255 AAGAATAAATGCCTGTGGGATGG + Intronic
1185209352 22:49560651-49560673 AAGTGTAATAGCCAGTGTGATGG + Intronic
951494605 3:23312358-23312380 AAATCTAAATGCTTGTGGGAAGG - Intronic
960809706 3:121616004-121616026 AAGTCTAATTCCCAGTGTGAGGG - Intronic
962833230 3:139162219-139162241 AAGTCTAAATGTCTTAGTGATGG + Intronic
963577448 3:147078691-147078713 AATTCTAACTCCCAGTGTGATGG + Intergenic
963987272 3:151610926-151610948 AAGTTTAATTGTCCTTGTGATGG - Intergenic
967169137 3:186810517-186810539 AAGTTTAATTGCCAGTGTGGAGG + Intergenic
970520796 4:16881847-16881869 AAGCATAAATGCCCCAGTGATGG - Intronic
971506446 4:27371373-27371395 AAGTGTAATTGCCATTGTGATGG - Intergenic
973726424 4:53781430-53781452 AATTCTAAATGTCCCTTTGAAGG + Intronic
974094185 4:57344262-57344284 GAGTCTAGATGCCTGTGTGGAGG + Intergenic
983969245 4:173851048-173851070 AATTCTAATTCCCAGTGTGATGG + Intergenic
984142707 4:176022953-176022975 AAATCTAAATTCCCCTGAGATGG + Intergenic
986201899 5:5586785-5586807 AAATCTAATTGCCAGCGTGATGG - Intergenic
986542146 5:8856444-8856466 AAGTCTAGATGCCCATGAGCAGG - Intergenic
987718201 5:21598363-21598385 AAATCTAATTCCCAGTGTGATGG - Intergenic
989543415 5:42644333-42644355 AGGTCTAACTGCCAGTGTGTAGG + Intronic
993980134 5:94534800-94534822 GAGCCTAAATGCCATTGTGAAGG + Intronic
997707802 5:135974922-135974944 CAGTCTAAATGTCACTGTGAAGG - Intergenic
1001074975 5:168619545-168619567 CAGTCTAAATGCCACTTTGAAGG + Intergenic
1005429434 6:25739374-25739396 AATTCTAACTTCCAGTGTGATGG - Intergenic
1005432981 6:25777853-25777875 AAGTCTCAATACCCGGGAGAGGG - Intronic
1010930889 6:81801675-81801697 AAGTCTAATCCCCAGTGTGATGG + Intergenic
1011626170 6:89285540-89285562 ATCTCTAAGTGCCCGGGTGATGG - Intronic
1016651561 6:146467130-146467152 AAGTCTTAATCCCAATGTGATGG - Intergenic
1030735196 7:113039784-113039806 AAGCCTAACTGCCAATGTGAAGG - Intergenic
1033636279 7:143214232-143214254 AAATCCAAATGCAAGTGTGAAGG + Intergenic
1034359282 7:150479982-150480004 CAGTCTAAATGACAGTCTGAAGG - Intergenic
1035126639 7:156612529-156612551 GAGACTAAATGCCCTTGTAAAGG + Intergenic
1035537115 8:400461-400483 AAATCCTAATCCCCGTGTGATGG + Intergenic
1040702387 8:50082723-50082745 AAGCCTAAATGCATGTGTGGAGG - Intronic
1040951695 8:52943395-52943417 CAGTCTACATGCTCGTATGAAGG - Intergenic
1043815601 8:84797299-84797321 AAGTTTAATTGCCATTGTGATGG - Intronic
1045140382 8:99274118-99274140 AAGTTTAAATGCCTTGGTGAAGG + Intronic
1045297590 8:100885635-100885657 AAGTCTAATCCCCAGTGTGATGG + Intergenic
1046456244 8:114466769-114466791 AACTCAAAATGCCACTGTGATGG + Intergenic
1046883260 8:119333619-119333641 TAGTCTGAGTGCCCGGGTGATGG - Intergenic
1051434700 9:17018466-17018488 AAGGCTGAATGGCCCTGTGATGG + Intergenic
1051533385 9:18130198-18130220 AGGTGAAAATGCCCCTGTGAAGG - Intergenic
1185545001 X:936318-936340 AAATCTAAAAGCCCATCTGATGG + Intergenic
1185966410 X:4609800-4609822 CAGTCTACATGCTCTTGTGAAGG + Intergenic
1198516362 X:137412158-137412180 AAGCCTCACTGCCCGAGTGAGGG - Intergenic
1198741688 X:139849740-139849762 AAATTTAAATGCCACTGTGATGG + Intronic
1199206788 X:145158746-145158768 AAAGCTAAATGCATGTGTGAAGG + Intergenic