ID: 1077200647

View in Genome Browser
Species Human (GRCh38)
Location 11:1305837-1305859
Sequence CCACCGCGGTGCCGTCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 44}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077200647_1077200657 29 Left 1077200647 11:1305837-1305859 CCTCTCTGACGGCACCGCGGTGG 0: 1
1: 0
2: 2
3: 3
4: 44
Right 1077200657 11:1305889-1305911 AGATCTCACTGCAGAAGGCAGGG 0: 1
1: 0
2: 0
3: 24
4: 264
1077200647_1077200658 30 Left 1077200647 11:1305837-1305859 CCTCTCTGACGGCACCGCGGTGG 0: 1
1: 0
2: 2
3: 3
4: 44
Right 1077200658 11:1305890-1305912 GATCTCACTGCAGAAGGCAGGGG 0: 1
1: 0
2: 4
3: 25
4: 282
1077200647_1077200656 28 Left 1077200647 11:1305837-1305859 CCTCTCTGACGGCACCGCGGTGG 0: 1
1: 0
2: 2
3: 3
4: 44
Right 1077200656 11:1305888-1305910 GAGATCTCACTGCAGAAGGCAGG 0: 1
1: 0
2: 4
3: 46
4: 470
1077200647_1077200653 24 Left 1077200647 11:1305837-1305859 CCTCTCTGACGGCACCGCGGTGG 0: 1
1: 0
2: 2
3: 3
4: 44
Right 1077200653 11:1305884-1305906 TCCCGAGATCTCACTGCAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077200647 Original CRISPR CCACCGCGGTGCCGTCAGAG AGG (reversed) Intronic
901066501 1:6497087-6497109 GCACCGCGGTGGGGGCAGAGCGG + Exonic
906662590 1:47593441-47593463 CCACCGCGGTCCAGCCAGGGCGG - Intergenic
914702933 1:150150342-150150364 CCGCCGCGGCGCCGACGGAGCGG - Intronic
1067098701 10:43319325-43319347 GCACTGCGGTGCCCTCAGTGTGG + Intergenic
1076543901 10:131231190-131231212 CCGCCGTGCTGCAGTCAGAGTGG - Intronic
1076571911 10:131438691-131438713 CCACCACAGTGTCCTCAGAGCGG + Intergenic
1077143945 11:1036557-1036579 ACACTGCGGTGCCCTCAGAGGGG - Intronic
1077200647 11:1305837-1305859 CCACCGCGGTGCCGTCAGAGAGG - Intronic
1077341539 11:2028454-2028476 CCCCCGCGGTGTCGTCAGAGGGG - Intergenic
1077663162 11:4086814-4086836 TCACAGCGGTGCTGTCAGAAGGG - Intronic
1083992865 11:66257712-66257734 CTACCTCGGTGGCGTCGGAGGGG - Intronic
1084172944 11:67409411-67409433 ACAGCGTGGTGCTGTCAGAGCGG + Exonic
1089281920 11:117380729-117380751 CCAGCGCTGTGCCTTCAGGGTGG + Intronic
1202824525 11_KI270721v1_random:83643-83665 CCCCCGCGGTGTCGTCAGAGGGG - Intergenic
1091493007 12:949330-949352 CCACCGCGGTGCGGACAGCCAGG - Intronic
1103882183 12:124174736-124174758 CCACGGCTGTGCAGTCAGGGTGG - Intronic
1106242034 13:27920354-27920376 CCACCGCGGGGTCGTCGGCGAGG - Exonic
1113789919 13:113022768-113022790 CCACCGCGGCGGCGGCTGAGGGG + Intronic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1126341426 15:47645271-47645293 TCACCCTGGTGCCTTCAGAGAGG - Intronic
1128351870 15:66896274-66896296 CCACAGCAGTGCCGACAGACTGG - Intergenic
1128519542 15:68366422-68366444 CCACCGTGATGCCATCAGATGGG - Intronic
1128941397 15:71790625-71790647 CCACCTCAGTGACCTCAGAGGGG + Intergenic
1141557798 16:84847287-84847309 CGACCGCGGTGACTTCACAGAGG + Intronic
1145279571 17:21457812-21457834 CCACCGGGGTGAGGGCAGAGAGG - Intergenic
1164109309 19:22140222-22140244 CCACCGCGGGGAGGACAGAGGGG - Intergenic
926272910 2:11380028-11380050 CCACAGCAGAGCCCTCAGAGTGG + Intergenic
940517216 2:154697811-154697833 ACAGCGCGGTGCCCTCAGGGAGG + Intergenic
948455337 2:238102069-238102091 GCACCACGCTGCCGTCAGTGGGG + Exonic
1169278474 20:4248828-4248850 CCACCGCCGGGCCCTCCGAGGGG + Exonic
1170578650 20:17682084-17682106 CCGCCGCGGAGCCGGGAGAGAGG + Exonic
1175909331 20:62397118-62397140 CCACCTCAGTGCCGTCACGGGGG + Intronic
1179576457 21:42311243-42311265 CCACTGCAGTGCGGTCACAGCGG - Intergenic
1185286252 22:50001115-50001137 GCATCGCGCAGCCGTCAGAGGGG + Exonic
950050706 3:9986872-9986894 GCACCTCAGTGGCGTCAGAGCGG + Exonic
950056152 3:10026401-10026423 GCGCCTCGGTGGCGTCAGAGCGG + Exonic
962269187 3:133965747-133965769 CCAGTGCGGTGCTGTCAGGGTGG - Intronic
964612398 3:158628122-158628144 CCACTGCGGTGGCCTCAGGGAGG - Intergenic
997471271 5:134118369-134118391 CCACATAGGTGCCCTCAGAGAGG - Intronic
1005928971 6:30466617-30466639 CCGCCGCGGCGCCGACAGCGAGG + Intergenic
1010941346 6:81921466-81921488 CCACCAGGGTGGAGTCAGAGAGG + Intergenic
1022336260 7:29424774-29424796 CCACCGCGCTGCCTTCAGATGGG + Intronic
1035046351 7:155969877-155969899 CCAGCCCGGTACCTTCAGAGAGG - Intergenic
1046945506 8:119970879-119970901 CCACCGGGGAGCCCTCGGAGGGG + Intronic
1061044820 9:128159508-128159530 CCACTGGGGTGCAGGCAGAGAGG + Intergenic
1061387406 9:130298755-130298777 CCAACTCAGTGCAGTCAGAGGGG + Intronic
1186044450 X:5519780-5519802 CCACTGGGGTGGCATCAGAGGGG + Intergenic
1189855803 X:45223880-45223902 CCACCGGGGTGGTGTCAGAGAGG - Intergenic
1198343924 X:135741238-135741260 CCACGGTGGTGCCTCCAGAGCGG - Intergenic
1198360805 X:135893179-135893201 CCATGGCGGTGTCCTCAGAGTGG + Intronic