ID: 1077203344

View in Genome Browser
Species Human (GRCh38)
Location 11:1325627-1325649
Sequence AGATAGCTGGAAAAGATGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077203342_1077203344 13 Left 1077203342 11:1325591-1325613 CCACAGTTACGTTAAAATTAGAA No data
Right 1077203344 11:1325627-1325649 AGATAGCTGGAAAAGATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077203344 Original CRISPR AGATAGCTGGAAAAGATGAC TGG Intergenic
No off target data available for this crispr