ID: 1077206738

View in Genome Browser
Species Human (GRCh38)
Location 11:1348429-1348451
Sequence CTGCTTAAGCAGTGGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077206738_1077206742 -10 Left 1077206738 11:1348429-1348451 CCAGCCACCCACTGCTTAAGCAG No data
Right 1077206742 11:1348442-1348464 GCTTAAGCAGAAAGAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077206738 Original CRISPR CTGCTTAAGCAGTGGGTGGC TGG (reversed) Intergenic
No off target data available for this crispr