ID: 1077207527

View in Genome Browser
Species Human (GRCh38)
Location 11:1352045-1352067
Sequence TGGGAGGCCTAGAAGGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077207527_1077207539 12 Left 1077207527 11:1352045-1352067 CCACTCCCCTTCTAGGCCTCCCA No data
Right 1077207539 11:1352080-1352102 CCCCCACCAATTCCCCTTCCAGG No data
1077207527_1077207545 24 Left 1077207527 11:1352045-1352067 CCACTCCCCTTCTAGGCCTCCCA No data
Right 1077207545 11:1352092-1352114 CCCCTTCCAGGCCTCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077207527 Original CRISPR TGGGAGGCCTAGAAGGGGAG TGG (reversed) Intergenic
No off target data available for this crispr