ID: 1077207702

View in Genome Browser
Species Human (GRCh38)
Location 11:1352463-1352485
Sequence TGGGAGGCCTAGAAGGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077207702_1077207714 12 Left 1077207702 11:1352463-1352485 CCACTCCCCTTCTAGGCCTCCCA No data
Right 1077207714 11:1352498-1352520 CCCCCACCAATTCCCCTTCCAGG No data
1077207702_1077207720 24 Left 1077207702 11:1352463-1352485 CCACTCCCCTTCTAGGCCTCCCA No data
Right 1077207720 11:1352510-1352532 CCCCTTCCAGGCCTCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077207702 Original CRISPR TGGGAGGCCTAGAAGGGGAG TGG (reversed) Intergenic
No off target data available for this crispr