ID: 1077208839

View in Genome Browser
Species Human (GRCh38)
Location 11:1358650-1358672
Sequence CTGCTTTTCTAGGTCAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077208835_1077208839 -6 Left 1077208835 11:1358633-1358655 CCTCCAGTCCAGGCGAGCTGCTT No data
Right 1077208839 11:1358650-1358672 CTGCTTTTCTAGGTCAACACTGG No data
1077208836_1077208839 -9 Left 1077208836 11:1358636-1358658 CCAGTCCAGGCGAGCTGCTTTTC No data
Right 1077208839 11:1358650-1358672 CTGCTTTTCTAGGTCAACACTGG No data
1077208833_1077208839 14 Left 1077208833 11:1358613-1358635 CCTGTGAGTCGGTGTGGCAACCT No data
Right 1077208839 11:1358650-1358672 CTGCTTTTCTAGGTCAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077208839 Original CRISPR CTGCTTTTCTAGGTCAACAC TGG Intergenic
No off target data available for this crispr