ID: 1077210119

View in Genome Browser
Species Human (GRCh38)
Location 11:1367011-1367033
Sequence GGGCCCGGGGTAATAGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077210115_1077210119 -6 Left 1077210115 11:1366994-1367016 CCAAGAGTCGGCAAAATGGGCCC No data
Right 1077210119 11:1367011-1367033 GGGCCCGGGGTAATAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077210119 Original CRISPR GGGCCCGGGGTAATAGAAGT TGG Intergenic