ID: 1077210119 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:1367011-1367033 |
| Sequence | GGGCCCGGGGTAATAGAAGT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1077210115_1077210119 | -6 | Left | 1077210115 | 11:1366994-1367016 | CCAAGAGTCGGCAAAATGGGCCC | No data | ||
| Right | 1077210119 | 11:1367011-1367033 | GGGCCCGGGGTAATAGAAGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1077210119 | Original CRISPR | GGGCCCGGGGTAATAGAAGT TGG | Intergenic | ||