ID: 1077210625

View in Genome Browser
Species Human (GRCh38)
Location 11:1369550-1369572
Sequence ATGGAGGACCAGAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077210620_1077210625 -3 Left 1077210620 11:1369530-1369552 CCTGCTGCTCTGGTCATTTCATG No data
Right 1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG No data
1077210618_1077210625 3 Left 1077210618 11:1369524-1369546 CCCACACCTGCTGCTCTGGTCAT No data
Right 1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG No data
1077210619_1077210625 2 Left 1077210619 11:1369525-1369547 CCACACCTGCTGCTCTGGTCATT No data
Right 1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077210625 Original CRISPR ATGGAGGACCAGAAGGAGGC AGG Intergenic
No off target data available for this crispr