ID: 1077212051

View in Genome Browser
Species Human (GRCh38)
Location 11:1375633-1375655
Sequence TGTCCGCCGGGCTCACCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077212051_1077212063 17 Left 1077212051 11:1375633-1375655 CCACCTGGTGAGCCCGGCGGACA No data
Right 1077212063 11:1375673-1375695 ATACGGGACTGGCGCCTGTGAGG No data
1077212051_1077212058 -6 Left 1077212051 11:1375633-1375655 CCACCTGGTGAGCCCGGCGGACA No data
Right 1077212058 11:1375650-1375672 CGGACAGGATCGTGTCCTTGGGG No data
1077212051_1077212056 -8 Left 1077212051 11:1375633-1375655 CCACCTGGTGAGCCCGGCGGACA No data
Right 1077212056 11:1375648-1375670 GGCGGACAGGATCGTGTCCTTGG No data
1077212051_1077212066 27 Left 1077212051 11:1375633-1375655 CCACCTGGTGAGCCCGGCGGACA No data
Right 1077212066 11:1375683-1375705 GGCGCCTGTGAGGCAGGGCCCGG 0: 1
1: 0
2: 3
3: 59
4: 528
1077212051_1077212061 6 Left 1077212051 11:1375633-1375655 CCACCTGGTGAGCCCGGCGGACA No data
Right 1077212061 11:1375662-1375684 TGTCCTTGGGGATACGGGACTGG No data
1077212051_1077212059 0 Left 1077212051 11:1375633-1375655 CCACCTGGTGAGCCCGGCGGACA No data
Right 1077212059 11:1375656-1375678 GGATCGTGTCCTTGGGGATACGG No data
1077212051_1077212065 22 Left 1077212051 11:1375633-1375655 CCACCTGGTGAGCCCGGCGGACA No data
Right 1077212065 11:1375678-1375700 GGACTGGCGCCTGTGAGGCAGGG No data
1077212051_1077212057 -7 Left 1077212051 11:1375633-1375655 CCACCTGGTGAGCCCGGCGGACA No data
Right 1077212057 11:1375649-1375671 GCGGACAGGATCGTGTCCTTGGG No data
1077212051_1077212060 1 Left 1077212051 11:1375633-1375655 CCACCTGGTGAGCCCGGCGGACA No data
Right 1077212060 11:1375657-1375679 GATCGTGTCCTTGGGGATACGGG No data
1077212051_1077212064 21 Left 1077212051 11:1375633-1375655 CCACCTGGTGAGCCCGGCGGACA No data
Right 1077212064 11:1375677-1375699 GGGACTGGCGCCTGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077212051 Original CRISPR TGTCCGCCGGGCTCACCAGG TGG (reversed) Intergenic