ID: 1077212062

View in Genome Browser
Species Human (GRCh38)
Location 11:1375665-1375687
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077212062_1077212078 29 Left 1077212062 11:1375665-1375687 CCTTGGGGATACGGGACTGGCGC No data
Right 1077212078 11:1375717-1375739 TCCGGGTCCTGCTGGGTTCTTGG No data
1077212062_1077212068 2 Left 1077212062 11:1375665-1375687 CCTTGGGGATACGGGACTGGCGC No data
Right 1077212068 11:1375690-1375712 GTGAGGCAGGGCCCGGCCCGAGG No data
1077212062_1077212066 -5 Left 1077212062 11:1375665-1375687 CCTTGGGGATACGGGACTGGCGC No data
Right 1077212066 11:1375683-1375705 GGCGCCTGTGAGGCAGGGCCCGG 0: 1
1: 0
2: 3
3: 59
4: 528
1077212062_1077212069 11 Left 1077212062 11:1375665-1375687 CCTTGGGGATACGGGACTGGCGC No data
Right 1077212069 11:1375699-1375721 GGCCCGGCCCGAGGAGCCTCCGG No data
1077212062_1077212065 -10 Left 1077212062 11:1375665-1375687 CCTTGGGGATACGGGACTGGCGC No data
Right 1077212065 11:1375678-1375700 GGACTGGCGCCTGTGAGGCAGGG No data
1077212062_1077212075 21 Left 1077212062 11:1375665-1375687 CCTTGGGGATACGGGACTGGCGC No data
Right 1077212075 11:1375709-1375731 GAGGAGCCTCCGGGTCCTGCTGG 0: 1
1: 0
2: 2
3: 20
4: 249
1077212062_1077212076 22 Left 1077212062 11:1375665-1375687 CCTTGGGGATACGGGACTGGCGC No data
Right 1077212076 11:1375710-1375732 AGGAGCCTCCGGGTCCTGCTGGG No data
1077212062_1077212070 12 Left 1077212062 11:1375665-1375687 CCTTGGGGATACGGGACTGGCGC No data
Right 1077212070 11:1375700-1375722 GCCCGGCCCGAGGAGCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077212062 Original CRISPR GCGCCAGTCCCGTATCCCCA AGG (reversed) Intergenic