ID: 1077212067

View in Genome Browser
Species Human (GRCh38)
Location 11:1375687-1375709
Sequence CGGGCCGGGCCCTGCCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077212067_1077212070 -10 Left 1077212067 11:1375687-1375709 CCTGTGAGGCAGGGCCCGGCCCG No data
Right 1077212070 11:1375700-1375722 GCCCGGCCCGAGGAGCCTCCGGG No data
1077212067_1077212075 -1 Left 1077212067 11:1375687-1375709 CCTGTGAGGCAGGGCCCGGCCCG No data
Right 1077212075 11:1375709-1375731 GAGGAGCCTCCGGGTCCTGCTGG No data
1077212067_1077212076 0 Left 1077212067 11:1375687-1375709 CCTGTGAGGCAGGGCCCGGCCCG No data
Right 1077212076 11:1375710-1375732 AGGAGCCTCCGGGTCCTGCTGGG No data
1077212067_1077212078 7 Left 1077212067 11:1375687-1375709 CCTGTGAGGCAGGGCCCGGCCCG No data
Right 1077212078 11:1375717-1375739 TCCGGGTCCTGCTGGGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077212067 Original CRISPR CGGGCCGGGCCCTGCCTCAC AGG (reversed) Intergenic