ID: 1077212070

View in Genome Browser
Species Human (GRCh38)
Location 11:1375700-1375722
Sequence GCCCGGCCCGAGGAGCCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077212062_1077212070 12 Left 1077212062 11:1375665-1375687 CCTTGGGGATACGGGACTGGCGC No data
Right 1077212070 11:1375700-1375722 GCCCGGCCCGAGGAGCCTCCGGG No data
1077212067_1077212070 -10 Left 1077212067 11:1375687-1375709 CCTGTGAGGCAGGGCCCGGCCCG No data
Right 1077212070 11:1375700-1375722 GCCCGGCCCGAGGAGCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077212070 Original CRISPR GCCCGGCCCGAGGAGCCTCC GGG Intergenic