ID: 1077212071

View in Genome Browser
Species Human (GRCh38)
Location 11:1375701-1375723
Sequence ACCCGGAGGCTCCTCGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077212071_1077212078 -7 Left 1077212071 11:1375701-1375723 CCCGGCCCGAGGAGCCTCCGGGT No data
Right 1077212078 11:1375717-1375739 TCCGGGTCCTGCTGGGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077212071 Original CRISPR ACCCGGAGGCTCCTCGGGCC GGG (reversed) Intergenic