ID: 1077212072

View in Genome Browser
Species Human (GRCh38)
Location 11:1375702-1375724
Sequence GACCCGGAGGCTCCTCGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077212072_1077212078 -8 Left 1077212072 11:1375702-1375724 CCGGCCCGAGGAGCCTCCGGGTC No data
Right 1077212078 11:1375717-1375739 TCCGGGTCCTGCTGGGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077212072 Original CRISPR GACCCGGAGGCTCCTCGGGC CGG (reversed) Intergenic