ID: 1077212078

View in Genome Browser
Species Human (GRCh38)
Location 11:1375717-1375739
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077212062_1077212078 29 Left 1077212062 11:1375665-1375687 CCTTGGGGATACGGGACTGGCGC No data
Right 1077212078 11:1375717-1375739 TCCGGGTCCTGCTGGGTTCTTGG No data
1077212071_1077212078 -7 Left 1077212071 11:1375701-1375723 CCCGGCCCGAGGAGCCTCCGGGT No data
Right 1077212078 11:1375717-1375739 TCCGGGTCCTGCTGGGTTCTTGG No data
1077212072_1077212078 -8 Left 1077212072 11:1375702-1375724 CCGGCCCGAGGAGCCTCCGGGTC No data
Right 1077212078 11:1375717-1375739 TCCGGGTCCTGCTGGGTTCTTGG No data
1077212067_1077212078 7 Left 1077212067 11:1375687-1375709 CCTGTGAGGCAGGGCCCGGCCCG No data
Right 1077212078 11:1375717-1375739 TCCGGGTCCTGCTGGGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077212078 Original CRISPR TCCGGGTCCTGCTGGGTTCT TGG Intergenic