ID: 1077213578

View in Genome Browser
Species Human (GRCh38)
Location 11:1384607-1384629
Sequence CTGTAGCTACAGAAGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077213578_1077213583 25 Left 1077213578 11:1384607-1384629 CCCTCTGCCTTCTGTAGCTACAG No data
Right 1077213583 11:1384655-1384677 AAATAGAATCATACAGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077213578 Original CRISPR CTGTAGCTACAGAAGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr