ID: 1077213583

View in Genome Browser
Species Human (GRCh38)
Location 11:1384655-1384677
Sequence AAATAGAATCATACAGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077213576_1077213583 29 Left 1077213576 11:1384603-1384625 CCACCCCTCTGCCTTCTGTAGCT No data
Right 1077213583 11:1384655-1384677 AAATAGAATCATACAGCACATGG No data
1077213581_1077213583 -3 Left 1077213581 11:1384635-1384657 CCTTTTCCATAATATCATAGAAA No data
Right 1077213583 11:1384655-1384677 AAATAGAATCATACAGCACATGG No data
1077213578_1077213583 25 Left 1077213578 11:1384607-1384629 CCCTCTGCCTTCTGTAGCTACAG No data
Right 1077213583 11:1384655-1384677 AAATAGAATCATACAGCACATGG No data
1077213580_1077213583 18 Left 1077213580 11:1384614-1384636 CCTTCTGTAGCTACAGTTTTGCC No data
Right 1077213583 11:1384655-1384677 AAATAGAATCATACAGCACATGG No data
1077213577_1077213583 26 Left 1077213577 11:1384606-1384628 CCCCTCTGCCTTCTGTAGCTACA No data
Right 1077213583 11:1384655-1384677 AAATAGAATCATACAGCACATGG No data
1077213579_1077213583 24 Left 1077213579 11:1384608-1384630 CCTCTGCCTTCTGTAGCTACAGT No data
Right 1077213583 11:1384655-1384677 AAATAGAATCATACAGCACATGG No data
1077213582_1077213583 -9 Left 1077213582 11:1384641-1384663 CCATAATATCATAGAAATAGAAT No data
Right 1077213583 11:1384655-1384677 AAATAGAATCATACAGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077213583 Original CRISPR AAATAGAATCATACAGCACA TGG Intergenic
No off target data available for this crispr