ID: 1077216430

View in Genome Browser
Species Human (GRCh38)
Location 11:1397066-1397088
Sequence TGTGCTCTGCAGGAAGTTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 165}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077216422_1077216430 15 Left 1077216422 11:1397028-1397050 CCCCTTGGGGCTCACATGGCTGG 0: 1
1: 0
2: 1
3: 14
4: 167
Right 1077216430 11:1397066-1397088 TGTGCTCTGCAGGAAGTTAACGG 0: 1
1: 0
2: 3
3: 13
4: 165
1077216424_1077216430 14 Left 1077216424 11:1397029-1397051 CCCTTGGGGCTCACATGGCTGGT 0: 1
1: 0
2: 1
3: 6
4: 114
Right 1077216430 11:1397066-1397088 TGTGCTCTGCAGGAAGTTAACGG 0: 1
1: 0
2: 3
3: 13
4: 165
1077216425_1077216430 13 Left 1077216425 11:1397030-1397052 CCTTGGGGCTCACATGGCTGGTC 0: 1
1: 0
2: 1
3: 21
4: 190
Right 1077216430 11:1397066-1397088 TGTGCTCTGCAGGAAGTTAACGG 0: 1
1: 0
2: 3
3: 13
4: 165
1077216417_1077216430 30 Left 1077216417 11:1397013-1397035 CCAGCATCTGTCAGGCCCCTTGG 0: 1
1: 0
2: 0
3: 20
4: 186
Right 1077216430 11:1397066-1397088 TGTGCTCTGCAGGAAGTTAACGG 0: 1
1: 0
2: 3
3: 13
4: 165
1077216426_1077216430 -9 Left 1077216426 11:1397052-1397074 CCTCTGTGCTGCCCTGTGCTCTG 0: 1
1: 2
2: 9
3: 64
4: 531
Right 1077216430 11:1397066-1397088 TGTGCTCTGCAGGAAGTTAACGG 0: 1
1: 0
2: 3
3: 13
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077216430 Original CRISPR TGTGCTCTGCAGGAAGTTAA CGG Intronic
901535753 1:9882107-9882129 TGAGCTCTGCAGGAAGGCAGGGG + Intronic
905093229 1:35446645-35446667 AGTAGTCTGCTGGAAGTTAAGGG - Intronic
906539198 1:46572064-46572086 TTTGGTATGCAGGAAGTCAAGGG + Exonic
906548466 1:46640185-46640207 TATGGCCTGAAGGAAGTTAAAGG - Intronic
907554028 1:55329135-55329157 TGGGCTCTGGAGGAAGGCAAGGG + Intergenic
908728421 1:67200984-67201006 CATGCTCTGCAGGAACTTTAGGG - Intronic
911323789 1:96445418-96445440 TGTACTCTTCTGGAACTTAAGGG - Intergenic
915831833 1:159138458-159138480 TGTACTATGGAGGAATTTAAAGG - Intronic
922554283 1:226521155-226521177 TCAACTCTGCAGGAAGTTCATGG - Intergenic
922858062 1:228792000-228792022 TCTGCTCAGCTGTAAGTTAAGGG + Intergenic
923368621 1:233288071-233288093 TGTCCTCTGCAAGAAGAAAATGG - Intronic
924508480 1:244709124-244709146 TGTGCTCGGCAGGAACATGACGG + Intergenic
1068481210 10:57590980-57591002 TGTGCTCTGCAAGAAGCTGAAGG - Intergenic
1070444253 10:76479533-76479555 TGTGCTCTGCAGGACATTAAAGG - Intronic
1070979230 10:80630909-80630931 TGGGCTCTGCTGGAAGTCAGGGG + Intronic
1075574181 10:123566535-123566557 TGCGCCCTGTAGGAAGTCAAGGG + Intergenic
1076015833 10:127027137-127027159 TGTGTGCCGCAGGCAGTTAAAGG + Intronic
1077216430 11:1397066-1397088 TGTGCTCTGCAGGAAGTTAACGG + Intronic
1077216851 11:1398584-1398606 TGCGCTCTGCAGAAAGTTAATGG - Intronic
1080612414 11:33915932-33915954 TGTGCAGTGCATGGAGTTAATGG - Intergenic
1084033662 11:66495194-66495216 TGTGTTCTGCAGGACGAAAAAGG + Exonic
1087059484 11:93963770-93963792 TTTCCTCTGCAAGAGGTTAATGG + Intergenic
1088546253 11:110962411-110962433 TCTGCTTTGCAGGCAGATAAAGG - Intergenic
1088811168 11:113393684-113393706 AATGCTGTGCAGGAAGTTCATGG - Exonic
1089464113 11:118672986-118673008 TCTGCTTTTCTGGAAGTTAAAGG - Intronic
1089798966 11:121007901-121007923 TGAGCTCAGCAGGAAGATGAGGG + Intergenic
1091335101 11:134760534-134760556 TGTGCACAGCAGGAAGGTCATGG + Intergenic
1092523578 12:9295929-9295951 GGTGCGCTGGAGGAAGTTCAGGG - Intergenic
1092543718 12:9435970-9435992 GGTGCGCTGGAGGAAGTTCAGGG + Intergenic
1093615440 12:21216775-21216797 TGTGCTCTGCAGAGGGTAAAAGG + Intronic
1094056764 12:26275964-26275986 TGGGTGCTGCAGGAAGTTCAGGG + Intronic
1094509225 12:31086081-31086103 GGTGCGCTGGAGGAAGTTCAGGG - Intronic
1095666085 12:44800287-44800309 TCAGCTCTGCCTGAAGTTAAAGG + Intronic
1097985143 12:65775212-65775234 TGTGCTCTGCAAGATGTTTCAGG + Intergenic
1098457078 12:70686624-70686646 CTTGCTCTGGAGGAAGCTAATGG + Intronic
1100618070 12:96247172-96247194 TGGGTTCTGCAGGGAATTAATGG - Exonic
1101006033 12:100401564-100401586 TGGTCTCTGGATGAAGTTAAAGG + Intronic
1101201236 12:102438586-102438608 TTTGTTCCTCAGGAAGTTAATGG - Intronic
1101957337 12:109222929-109222951 TGTGCTCTGCAGATGGTGAAAGG - Intronic
1104123540 12:125821634-125821656 CATGCTATGAAGGAAGTTAAAGG - Intergenic
1104293576 12:127491473-127491495 TGTGCTCTTCCTGAAGTTAAAGG + Intergenic
1106326717 13:28698366-28698388 TGTGCTCTGCAGCTAGCTAGAGG + Intergenic
1108420961 13:50249016-50249038 GGTGCTCTAAAGGAAGTGAAGGG + Intronic
1110300682 13:73923301-73923323 TGGACTCTGCAGGAATTCAAAGG + Intronic
1110982820 13:81923217-81923239 TGTGCAGTGCAGTAAGTTCAAGG - Intergenic
1112644091 13:101309929-101309951 CATGCTCTTCTGGAAGTTAATGG + Intronic
1112710497 13:102121771-102121793 TGTGTTCTGAACAAAGTTAATGG + Intronic
1113758803 13:112833274-112833296 TGAGGTCTGCAGTAAGTTAGAGG + Intronic
1117344250 14:54817401-54817423 TGTGCTCTGCTGGAACTGGACGG - Intergenic
1122301395 14:100733239-100733261 TGGGCTCTGAAGGAATTTCAAGG - Intronic
1123687150 15:22806852-22806874 TCTGCCCTGCAGGAAGTGCATGG - Intronic
1124007531 15:25806792-25806814 TCGGCTGTGCAGGGAGTTAAAGG + Intronic
1124882999 15:33659444-33659466 TGTGCACTGGAGGAAGCTACTGG + Intronic
1126037194 15:44557698-44557720 TGTTCTCTTCAGGAGGTTGAAGG + Intronic
1126290442 15:47070542-47070564 TGCTCTCTGCAGTAAGCTAAGGG - Intergenic
1127361343 15:58247422-58247444 TGGGCTCTGGAGGAGCTTAAAGG + Intronic
1127563163 15:60160760-60160782 TGTCCTGTGCAGAAAGTTCAAGG - Intergenic
1128091985 15:64925491-64925513 TGTGGTCTGCAGGGAGTAGAGGG - Intronic
1128193205 15:65724539-65724561 TTTGTTCTGTAGGAAGTTTAGGG - Intronic
1129203261 15:74018966-74018988 TGTCCTCTGAATGAAGGTAAAGG + Intronic
1129883509 15:79022805-79022827 TTAGCTCTGCAGGAGGTTATGGG + Intronic
1130149627 15:81301433-81301455 TGAGCTCAGCAGGGAGATAACGG - Exonic
1137840025 16:51632201-51632223 TGTGCTTAGAGGGAAGTTAAAGG + Intergenic
1140801683 16:78494248-78494270 TGTTCTCTGCAGGAACTAGACGG - Intronic
1141343116 16:83221677-83221699 TGGGCTCTGCAGGAGGTGCAGGG + Intronic
1142744346 17:1948246-1948268 AGTGCTCTGCAGGAAGCCCAGGG + Intronic
1144100334 17:11937263-11937285 TGTCCTCTGCAGGGAGTCCATGG - Intronic
1144554489 17:16269715-16269737 TGTACTCTGCATGAATCTAATGG + Intronic
1144578840 17:16446713-16446735 TGAGCTCTGCTGGAACCTAAGGG - Intronic
1151333229 17:73423555-73423577 TGTGGTCTGCAGGCAGGTGACGG + Intronic
1154166718 18:12020683-12020705 TATGCTTTGCAGGAAATTGAGGG - Intronic
1154214918 18:12408481-12408503 TGAGCTCTGGAGGAAGCTAAAGG + Intronic
1155900190 18:31380071-31380093 TGGACTCTGCAGGAATTTGAAGG - Intronic
1158560760 18:58511812-58511834 TGTCCTCTTCATGAAGTGAAGGG - Intronic
1159926701 18:74276043-74276065 TGGGCTGTGCAGGAAGCTGAGGG - Intronic
1162026761 19:7898766-7898788 GGGGCCCTGCAGGAGGTTAAAGG + Exonic
1164921653 19:32092989-32093011 TGTGCTCAGCAGTAAATGAAAGG + Intergenic
925182703 2:1827300-1827322 TGTGATCTGCAGGAGGTGGAAGG - Intronic
926310532 2:11671825-11671847 TGTGATCTTAAGGAAATTAAGGG + Intergenic
926877978 2:17506478-17506500 TGTGCCCTCCTGGAATTTAAAGG - Intergenic
931772163 2:65506867-65506889 TATTCTCTGGAGGAAGTTAATGG - Intergenic
932758961 2:74427132-74427154 TGTGAACTCCAGGAAGCTAATGG - Intronic
932787063 2:74615139-74615161 TTTTCTCTGCAGCAAGTGAAAGG - Exonic
933989463 2:87623661-87623683 TGTTCTCTGCTGAATGTTAAAGG - Intergenic
934979216 2:98826478-98826500 AGTGTTCTGAAGGAAGTGAACGG + Intronic
937585911 2:123549469-123549491 TGTGTTCTTCAGGAAATTAAGGG + Intergenic
938650907 2:133382500-133382522 TGTGGTGTGCAGAGAGTTAAGGG - Intronic
940129218 2:150362426-150362448 TGTGCTCTGCTGGCAGATCAGGG + Intergenic
940283342 2:152009674-152009696 ATTGCACTGCAGGAAATTAATGG - Intronic
943865721 2:192922822-192922844 TGAGCTCTTCAGGAGGGTAAAGG - Intergenic
947270989 2:228335269-228335291 TGTTCTCTGAAAGAAGCTAATGG - Intergenic
1168904036 20:1390010-1390032 TGTGCTCTGCCAGAAGGTCACGG + Intronic
1169010368 20:2245175-2245197 TGTTCTGTGCAGGAAGTGGAGGG + Intergenic
1174367890 20:50067453-50067475 TGTTCTCTGCAGGAAGCTAGAGG + Intergenic
1175744804 20:61448537-61448559 TGTGCTCTCTGGGAAGATAATGG + Intronic
1178232412 21:30801856-30801878 TGCAGTTTGCAGGAAGTTAATGG - Intergenic
1178272805 21:31208414-31208436 TCAGCTCTGCAGAATGTTAATGG + Intronic
1180133400 21:45843201-45843223 TGTGCTCAGCAGGAAGAATAGGG + Intronic
1181729445 22:24833954-24833976 TGTGCTCTGGAGAAAGCTAGGGG + Intronic
1182792238 22:32962460-32962482 TGTTCTCTGCATGTATTTAATGG - Intronic
1183441075 22:37823480-37823502 TGTGCCCAGCAGGAAGATTAGGG - Exonic
949365847 3:3279823-3279845 GGTGCTGTGTAGGAAATTAAAGG + Intergenic
950820304 3:15750030-15750052 TGTGCTCAGCCTGAATTTAAGGG - Intronic
953011122 3:39026503-39026525 AGAGGTCTGCAGGATGTTAAAGG - Intergenic
954704281 3:52470847-52470869 TGTTCTCTGCAGGAGATAAATGG + Exonic
955772072 3:62395153-62395175 GGTGCACAGCAGGAAGTTGAAGG + Intergenic
956252562 3:67249988-67250010 TGAGCACTGTAGGAAGTTGAGGG + Intergenic
958069143 3:88586731-88586753 TGTTCACTGCTGGAAGTTATAGG + Intergenic
959128669 3:102323099-102323121 TGTAGTCTTCAGGAAGTTTATGG + Intronic
959372605 3:105547224-105547246 ACTGCTCTGCAGGAGGTTGAAGG + Exonic
960347647 3:116554363-116554385 TGAGGTGTGCAGGAAGTTATCGG + Intronic
961815774 3:129549318-129549340 TGGGCTCAGCAGGAAGGCAAAGG + Exonic
963942665 3:151110685-151110707 AGTGTTCTATAGGAAGTTAAAGG + Intronic
966239341 3:177738983-177739005 TGTGCTCTAAAGGATGTTACTGG + Intergenic
968685039 4:1952306-1952328 TGTCCTCTGCAGGCAGCTCAGGG - Intronic
973884581 4:55307380-55307402 TCTGCTCTTCAGGAAGTTGTAGG - Intergenic
975197271 4:71540617-71540639 TGTGCCCTGAAGGAGTTTAATGG + Intronic
980627151 4:135388334-135388356 TGTACTCTGAAGGAAAGTAATGG + Intergenic
981258349 4:142690248-142690270 GGTGCTGTGCAGGTAGATAAAGG + Intronic
985662307 5:1163422-1163444 TGTGCTCTGCAGTAAGCTCTGGG + Intergenic
986535705 5:8784737-8784759 TGAGCTCAGCTGAAAGTTAAGGG - Intergenic
986997410 5:13622963-13622985 TGTGCTCTTTATGCAGTTAAAGG + Intergenic
987296727 5:16559441-16559463 TGCTCTCTGCAGGAAGTGGATGG - Intronic
987997010 5:25295708-25295730 TGTGCTTTGCAAAATGTTAATGG - Intergenic
988440193 5:31225062-31225084 TGTGCATTGCAGGATGTTAGTGG - Intronic
988866260 5:35338605-35338627 TGTGGACTGTAGGAATTTAATGG - Intergenic
992557766 5:77919986-77920008 TCTGCTCTGAAGGAAGTTCTAGG - Intergenic
994375091 5:99009913-99009935 TGTGCTCTGGATGCAGTTCATGG - Intergenic
996516224 5:124372589-124372611 TGTGCACTGCTTGAAGTTAGGGG - Intergenic
996926225 5:128829639-128829661 TTTGCTCTGAAGGAACTTAATGG - Intronic
997242236 5:132315815-132315837 TGTGCTCTGCAGGAAATTACTGG + Intronic
997714735 5:136033773-136033795 TGTGCTGTGCAGAAGGTTATTGG + Exonic
999078813 5:148824270-148824292 TCTGCTATGAAGGATGTTAAAGG + Intergenic
1001485613 5:172117548-172117570 CTTGCTGTGCAGGAAGTTGAGGG + Exonic
1003893307 6:10583254-10583276 AGTTCACTGTAGGAAGTTAAGGG + Intronic
1004215566 6:13700991-13701013 TGTGTTCTGGAGGAAGATACCGG - Intronic
1004245912 6:13975066-13975088 TGTGCTCAGCAGGGAATGAATGG + Intronic
1008658744 6:53643992-53644014 TGACCTCTGCAGGAAGATCAGGG - Intergenic
1008982117 6:57496351-57496373 TAGGCTCAGCAGGAAGTTAAAGG + Intronic
1009170178 6:60389187-60389209 TAGGCTCAGCAGGAAGTTAAAGG + Intergenic
1010509267 6:76697847-76697869 TGTGATCTGCAGGAAGGGAGTGG + Intergenic
1011121760 6:83962079-83962101 GGTGGTATGCAGGAAGTAAATGG - Exonic
1011488972 6:87871566-87871588 TCTGCCCTCCAGGAAGTTATAGG + Intergenic
1012043144 6:94236322-94236344 TGTGTTCTTCAGCAAGTGAATGG + Intergenic
1013752551 6:113423900-113423922 TGTGCTCTGGAAGAAATTGAAGG - Intergenic
1013896723 6:115097553-115097575 TGTCCTCTGCAGGACGTGAACGG - Intergenic
1014691310 6:124566588-124566610 TTTTCTCTGCAGGATATTAATGG + Intronic
1017986330 6:159446011-159446033 TGTGATCTGCAGGTAGTGGAAGG - Intergenic
1018773899 6:166997334-166997356 TGGGGTCTGCAGGAAGTTTCAGG - Intergenic
1018856041 6:167676063-167676085 TATGCTCTGAAGGAAGCTAAGGG - Intergenic
1019173729 6:170149236-170149258 TGTACACTGCAGGCAGTGAAGGG - Intergenic
1019713408 7:2527583-2527605 TGTGGTCAGCAGGAAGAGAAAGG - Exonic
1022521586 7:31011420-31011442 TATGCTTTTCAGGAAGTTACTGG - Intergenic
1022725921 7:32981500-32981522 TTTGCTCTACTGGAAGCTAAAGG - Intronic
1023623650 7:42096067-42096089 TGTGCACTGCAGGGAGCTGACGG + Intronic
1023884656 7:44345134-44345156 TGGTCTCTGGAGGAAGTTAATGG - Intergenic
1025047680 7:55706149-55706171 TTTGCTCTACTGGAAGCTAAAGG + Intergenic
1025730029 7:64100556-64100578 GGCGCCCTACAGGAAGTTAAAGG + Intronic
1032458444 7:132092031-132092053 TATCCTCTGCAGGAAGCTGAGGG + Intergenic
1033259363 7:139829295-139829317 CGTGCTCTGCAGGTAGAAAAGGG - Exonic
1033765596 7:144486824-144486846 TGTGCTCAGCACCAAGCTAAAGG - Intronic
1035882894 8:3261649-3261671 AGTTCTCTGCAGGAATCTAAAGG + Intronic
1039667256 8:39547467-39547489 AGTGCTCTGGAGGAAGTGACAGG + Intergenic
1040481895 8:47834136-47834158 TGAGCTCTGCAGTAATTTAGTGG + Intronic
1041178762 8:55226378-55226400 TTTGCTATGCGTGAAGTTAAAGG + Intronic
1042617010 8:70660749-70660771 GGTGCTATGCAGGAAAATAAAGG - Exonic
1044242650 8:89904357-89904379 TGTGCACGGCAGGAAGCAAATGG - Intronic
1046573260 8:115993237-115993259 TGTGCTCAAAAGGAAGTTGAGGG + Intergenic
1049182191 8:141228694-141228716 TGTGCTCTTCAGGAAGCTTCCGG - Intronic
1055863447 9:80783066-80783088 TATGTTCTGCAGGCACTTAAAGG + Intergenic
1056137319 9:83642986-83643008 GGTCCTCTGCAGGATGTTCAGGG - Intronic
1056494504 9:87142533-87142555 TATACTCAGCATGAAGTTAATGG + Intergenic
1056925556 9:90831227-90831249 TGTGAACTACAGGAAGTTGAGGG + Intronic
1057866644 9:98686909-98686931 TGGGCTCTGCTGGAAGTACAGGG - Intronic
1057917177 9:99065744-99065766 TGTCCTCTGCAGGAAGGAAAGGG + Intronic
1062532956 9:137009712-137009734 CGTGCTCACCAGGAAGTCAAAGG + Intronic
1187178603 X:16920301-16920323 TGTGCTTTCCAGGATGCTAAAGG - Intergenic
1188099340 X:26063520-26063542 TCTGATATGCAGGAAGTTTATGG + Intergenic
1189634004 X:42985663-42985685 TGAGCTCTGCAGGAGGTAATGGG + Intergenic
1190701998 X:52996077-52996099 TGGACGCTGCAGGAAGGTAATGG - Intergenic
1199297086 X:146171594-146171616 TGTGCTCTGCAGAATTTCAAGGG - Intergenic
1199823138 X:151471017-151471039 TGTGCTCTGGATGGAGTCAAAGG - Intergenic