ID: 1077216826

View in Genome Browser
Species Human (GRCh38)
Location 11:1398478-1398500
Sequence TCTCCACCCCCTGTATCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 277}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077216826_1077216836 15 Left 1077216826 11:1398478-1398500 CCTGGGGATACAGGGGGTGGAGA 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1077216836 11:1398516-1398538 GGGTTCTCAGAGACCTGGGGTGG 0: 1
1: 0
2: 1
3: 34
4: 277
1077216826_1077216829 -5 Left 1077216826 11:1398478-1398500 CCTGGGGATACAGGGGGTGGAGA 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1077216829 11:1398496-1398518 GGAGAGGCAGCCCCAAAGCTGGG 0: 1
1: 0
2: 1
3: 35
4: 301
1077216826_1077216833 10 Left 1077216826 11:1398478-1398500 CCTGGGGATACAGGGGGTGGAGA 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1077216833 11:1398511-1398533 AAGCTGGGTTCTCAGAGACCTGG 0: 1
1: 0
2: 1
3: 16
4: 241
1077216826_1077216834 11 Left 1077216826 11:1398478-1398500 CCTGGGGATACAGGGGGTGGAGA 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1077216834 11:1398512-1398534 AGCTGGGTTCTCAGAGACCTGGG 0: 1
1: 0
2: 2
3: 23
4: 278
1077216826_1077216837 23 Left 1077216826 11:1398478-1398500 CCTGGGGATACAGGGGGTGGAGA 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1077216837 11:1398524-1398546 AGAGACCTGGGGTGGCCAGATGG 0: 1
1: 0
2: 1
3: 33
4: 337
1077216826_1077216835 12 Left 1077216826 11:1398478-1398500 CCTGGGGATACAGGGGGTGGAGA 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1077216835 11:1398513-1398535 GCTGGGTTCTCAGAGACCTGGGG 0: 1
1: 0
2: 0
3: 31
4: 302
1077216826_1077216838 24 Left 1077216826 11:1398478-1398500 CCTGGGGATACAGGGGGTGGAGA 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1077216838 11:1398525-1398547 GAGACCTGGGGTGGCCAGATGGG 0: 1
1: 0
2: 1
3: 20
4: 220
1077216826_1077216839 25 Left 1077216826 11:1398478-1398500 CCTGGGGATACAGGGGGTGGAGA 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1077216839 11:1398526-1398548 AGACCTGGGGTGGCCAGATGGGG 0: 1
1: 0
2: 3
3: 29
4: 313
1077216826_1077216828 -6 Left 1077216826 11:1398478-1398500 CCTGGGGATACAGGGGGTGGAGA 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1077216828 11:1398495-1398517 TGGAGAGGCAGCCCCAAAGCTGG 0: 1
1: 7
2: 2
3: 29
4: 267
1077216826_1077216840 26 Left 1077216826 11:1398478-1398500 CCTGGGGATACAGGGGGTGGAGA 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1077216840 11:1398527-1398549 GACCTGGGGTGGCCAGATGGGGG 0: 1
1: 1
2: 3
3: 28
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077216826 Original CRISPR TCTCCACCCCCTGTATCCCC AGG (reversed) Intronic
900014871 1:141080-141102 TCTCCAGCCCCTCTTCCCCCTGG - Intergenic
900045137 1:499689-499711 TCTCCAGCCCCTCTTCCCCCTGG - Intergenic
900067334 1:741419-741441 TCTCCAGCCCCTCTTCCCCCTGG - Intergenic
900310457 1:2030906-2030928 CCTCGACCCACTGTTTCCCCTGG - Intergenic
900474609 1:2870264-2870286 TCTCCACCCAGTGCAGCCCCCGG + Intergenic
900660147 1:3778096-3778118 GCTCCAGCCCCAGTACCCCCAGG + Intergenic
905225600 1:36477002-36477024 TCTCCCACCCCTGTTTCACCTGG + Intronic
905236550 1:36554084-36554106 TTTACACCACCTGTATACCCAGG - Intergenic
906199078 1:43947622-43947644 GCTCCAGCCCCTGCAGCCCCCGG - Exonic
906542988 1:46602480-46602502 TCTCCCCTCCCTGTTTCCCTTGG - Intronic
909283965 1:73791096-73791118 TGTCCAACCCCTGCACCCCCAGG + Intergenic
915299054 1:154941752-154941774 TCTCCACCACCTGTCACCCCAGG + Intergenic
915517138 1:156420226-156420248 TCTCCTCCTCTTGTATCCTCTGG + Intronic
915606020 1:156951421-156951443 TCCCCACCCCCAGTATCTTCAGG - Intronic
918098844 1:181356303-181356325 TCTCCAGCCACTGTATTCCCTGG + Intergenic
918738456 1:188096886-188096908 TCCCCACCCCTAGAATCCCCAGG + Intergenic
919568923 1:199221779-199221801 GCTCCTCCACCTGTCTCCCCAGG - Intergenic
919880680 1:201898697-201898719 TCTCCAAGCCCTGCCTCCCCTGG - Intronic
921173129 1:212566572-212566594 CCTCCACCCCCTCTATGCCCTGG - Intronic
921220207 1:212968350-212968372 TCTCCATCCCCTTTCTCTCCTGG - Intronic
921313700 1:213870794-213870816 TCGCCACCCCATATATACCCTGG - Intergenic
922792619 1:228318468-228318490 TCTGAACCCCCTGAAACCCCCGG + Intronic
923402974 1:233633130-233633152 TCTCCACCCCATGTTTCTCCAGG - Intronic
923460505 1:234205895-234205917 CCACCACCCCCTGCACCCCCAGG - Intronic
1063766421 10:9146510-9146532 TCTCCACCCCCCTCAGCCCCAGG + Intergenic
1064236117 10:13577385-13577407 CCTCCACCCCCTGCAGGCCCCGG + Intergenic
1066139806 10:32492672-32492694 TTTCCCCCTCCTGTACCCCCTGG - Intronic
1066380259 10:34895236-34895258 TCACCACCCCCTGCCACCCCAGG - Intergenic
1067048468 10:42999072-42999094 GCTGCATCCTCTGTATCCCCAGG - Intergenic
1067224874 10:44369082-44369104 TCTCCACCTCCTGTTTCCTGAGG - Intergenic
1067932848 10:50580744-50580766 TCTCTCCCTCCTGTAACCCCTGG - Intronic
1070290136 10:75108636-75108658 TCTCCACCGTCTGTATCCAGAGG + Intronic
1071751847 10:88488057-88488079 TCTCCAGCCCTTGCATCCTCAGG - Intronic
1073060233 10:100729552-100729574 TCTCCAGCACCGGTGTCCCCAGG - Intergenic
1073292088 10:102418503-102418525 TCTCCTCTCCCTCTCTCCCCAGG + Intronic
1076089593 10:127670695-127670717 ACACCACCCCCTGCATCCTCAGG - Intergenic
1076903504 10:133351277-133351299 CCTCCACCCCATGCAGCCCCAGG + Intronic
1076971466 11:136180-136202 TCTCCAGCCCCTCTTCCCCCTGG - Intergenic
1077006667 11:361184-361206 TCTCCAGCCCCTGCATCGTCAGG - Intergenic
1077216826 11:1398478-1398500 TCTCCACCCCCTGTATCCCCAGG - Intronic
1077303828 11:1859026-1859048 TCTGAGTCCCCTGTATCCCCCGG + Intronic
1077533979 11:3110255-3110277 GCTCCACCTCCTCTAACCCCAGG - Intronic
1078130935 11:8613616-8613638 TCTCCAGCCTCTGTCTCCACTGG - Exonic
1078156804 11:8806814-8806836 TCCCCAGCCCCTGCCTCCCCAGG + Intronic
1081506820 11:43726325-43726347 TCCTCACCCACTCTATCCCCTGG - Intronic
1082029118 11:47592152-47592174 TGTCCATCCCCAGTAGCCCCTGG - Intronic
1082103108 11:48191008-48191030 TCTCCACACCCTGTTTGCCTGGG + Intergenic
1083883889 11:65561354-65561376 GCTCCACCTGCTGTACCCCCAGG - Intergenic
1084209366 11:67613990-67614012 TCTTCACCCCCTATTTCCCTGGG + Intergenic
1084432661 11:69120168-69120190 TCTCCCCACCCTGCTTCCCCAGG - Intergenic
1085464628 11:76715444-76715466 TCTCCTCACCATGAATCCCCAGG - Intergenic
1086515741 11:87611125-87611147 TTTCCACACCCTGCATCTCCTGG - Intergenic
1089191786 11:116659118-116659140 TCTCCACCCTCTGCCTCCCTGGG + Intergenic
1089323293 11:117640792-117640814 TCTCCATCCTCAGTTTCCCCTGG + Intronic
1089809030 11:121116289-121116311 TCTCCCTCCCCTGTATAGCCTGG + Intronic
1090827301 11:130396756-130396778 TCTCCACCCCTCCTATCCACTGG - Intergenic
1090984794 11:131756611-131756633 TCACCACCGCCTGGATCTCCAGG - Intronic
1092098886 12:5866704-5866726 TCTCAGCCCCCTGGATCCCCAGG - Intronic
1092278484 12:7081128-7081150 TGCCCACACCCTGTATCCCAAGG - Exonic
1092701176 12:11232498-11232520 ACTCCATCCCCTGTATTTCCTGG - Intergenic
1096576042 12:52553475-52553497 TCTTCACCTGCTGCATCCCCAGG - Intergenic
1097035249 12:56119594-56119616 TCTCCACCCCCAGTAAGACCTGG - Intronic
1097262992 12:57729915-57729937 TCTCATCTCCCTGCATCCCCAGG - Intronic
1097642415 12:62198334-62198356 CCTCCAACCCCTGTATCACAGGG + Intronic
1099989740 12:89709188-89709210 TCTCCTCCCCCTGCCTACCCCGG - Intronic
1101560487 12:105853121-105853143 TCCCCACCCCTGGTATCCCCAGG - Intergenic
1101843342 12:108342895-108342917 TCTCAAGTCCCAGTATCCCCAGG - Intergenic
1102973836 12:117191777-117191799 TTTCTCACCCCTGTATCCCCAGG - Intergenic
1104550882 12:129756112-129756134 TTTCCACTACCTCTATCCCCTGG - Intronic
1105700959 13:22935478-22935500 TCTCCAGCTTCTGGATCCCCTGG + Intergenic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106223670 13:27769124-27769146 TCTCCACCCTTTCTACCCCCTGG - Intergenic
1106682265 13:32020062-32020084 TCTTCACTCCCCGTAGCCCCTGG + Intergenic
1106980009 13:35268337-35268359 TCCCCACTCCCTGCAGCCCCTGG - Intronic
1107150485 13:37105382-37105404 ACTCCACGCCCTGTAACACCGGG - Exonic
1108435176 13:50395433-50395455 TCTCCACTCCCCCTATCCCCAGG - Intronic
1114266039 14:21073131-21073153 TCTCCACCACCTGGAACACCTGG - Exonic
1114658247 14:24329000-24329022 AATCCACCCCCAGTATCCTCAGG - Intronic
1115946855 14:38671742-38671764 ACTCCAGACCCTGTATGCCCGGG - Intergenic
1117677169 14:58166725-58166747 TCTCCACTCAGTGTATCCCAAGG - Intronic
1118724316 14:68617901-68617923 TACCCTCCCCCTGTATCCCTTGG - Intronic
1119133732 14:72197517-72197539 TCCCTACCCACTGTAGCCCCAGG - Intronic
1119205905 14:72793312-72793334 TCTCCCCTCCCTCTGTCCCCAGG - Intronic
1119557810 14:75566984-75567006 TCTCCACTCCCAGTCTCCCCAGG - Intergenic
1119662093 14:76459409-76459431 CCTCCACCCTCTGTTTCTCCAGG - Intronic
1121570494 14:94943166-94943188 TCTCCCTCCCCAGCATCCCCTGG + Intergenic
1122125574 14:99576771-99576793 GTTCCACCCTCTGAATCCCCAGG - Intronic
1122184631 14:99981578-99981600 TGTGCACCCACTGTATCTCCAGG - Intronic
1122247004 14:100410370-100410392 TCTCCACCCCCTGAGCCCACAGG - Intronic
1122877028 14:104672262-104672284 TCCCCAGCCCCTGTACCCCCAGG - Intergenic
1122891290 14:104733417-104733439 TCTGCCCCCCCTCTGTCCCCAGG + Intronic
1122973184 14:105160380-105160402 TCCCCACCCCCGGTAACACCTGG + Intronic
1123944426 15:25232178-25232200 TGTCCTCCTCCTGTACCCCCAGG + Intergenic
1125770287 15:42160722-42160744 TGTCCATCCGCTGGATCCCCAGG + Exonic
1125867083 15:43062427-43062449 TTTCCCCTCCCTCTATCCCCTGG - Intronic
1125919261 15:43515856-43515878 TCTCCACCTGCTGTATTCCTAGG - Intronic
1127703719 15:61527082-61527104 TCCCCACTCCCTGTTTCCTCTGG - Intergenic
1128470021 15:67944093-67944115 TCTCCACCCCCAGCCTTCCCGGG + Intergenic
1129153206 15:73702233-73702255 TCTCCACTCCCCCTACCCCCAGG + Exonic
1129315743 15:74742647-74742669 TCTCCCCACCCTGCATTCCCCGG - Intergenic
1129515022 15:76152115-76152137 TCACCAGCCACTGTATCCCCTGG + Intronic
1129999625 15:80035471-80035493 TCTCCACTCCCAGACTCCCCAGG + Intergenic
1131570991 15:93535826-93535848 TCTCCACCCACTTTTTCCCAAGG + Intergenic
1132585625 16:704886-704908 TCTCCACCCACCTAATCCCCAGG + Intronic
1132599285 16:766863-766885 TGTCCACCCACCGTGTCCCCAGG + Exonic
1132625176 16:888150-888172 GCTCCACCCCCTGCACCCCAAGG - Intronic
1134052798 16:11148707-11148729 GCTCCATCCCCTGTATGGCCAGG + Intronic
1134292500 16:12913668-12913690 TCTCCCCTCACTGTGTCCCCTGG + Intronic
1134452558 16:14372505-14372527 CCTCCCCCACCTGTATCCCAGGG + Intergenic
1138313331 16:56046975-56046997 TCTCCCACCATTGTATCCCCTGG - Intergenic
1138319340 16:56098537-56098559 ACTCCTCCCTTTGTATCCCCAGG - Intergenic
1138492755 16:57385930-57385952 CCTCCACCTCCTGGATCTCCTGG + Intergenic
1138527120 16:57615290-57615312 TCTCCACTCTCTGTATCCTGTGG - Intronic
1138572409 16:57884303-57884325 TCTCCACCGCCTGCCTCCCTTGG - Exonic
1139853102 16:69962321-69962343 TGTCCATCCCCAGTGTCCCCTGG + Intronic
1139882073 16:70185229-70185251 TGTCCATCCCCAGTGTCCCCTGG + Intronic
1140370436 16:74410276-74410298 TGTCCATCCCCAGTGTCCCCTGG - Intronic
1141239419 16:82251336-82251358 TCCCCATCCCCCTTATCCCCAGG + Intergenic
1142125269 16:88407101-88407123 TCTCCACCCTCTGCGGCCCCAGG + Intergenic
1142399712 16:89852524-89852546 CCTCCACCCCCCGGATCCCCTGG + Intronic
1142399727 16:89852563-89852585 TCCCCACCCCCTGGATCCCCTGG + Intronic
1142399744 16:89852602-89852624 CCTCCACCCCCCAGATCCCCTGG + Intronic
1142448785 16:90161342-90161364 TCTCCAGCCCCTCTTCCCCCTGG + Intergenic
1142458702 17:73947-73969 TCTCCAGCCCCTCTTCCCCCTGG - Intergenic
1143352092 17:6296528-6296550 TCTCCAAGCCCTGTGTCCCGAGG + Intergenic
1144135884 17:12294137-12294159 TCTCCAGCCCCTAGATCCCCAGG - Intergenic
1145159881 17:20567245-20567267 TCCCCATCCCCCGTATCACCCGG - Intergenic
1146464292 17:33074083-33074105 TCTCTGCTCCTTGTATCCCCAGG + Intronic
1147212615 17:38880682-38880704 TCTCCCTCCCCTGCATCCACTGG + Intronic
1147403621 17:40195373-40195395 TCTCCTCTCCCTGCAGCCCCTGG + Exonic
1147583272 17:41638592-41638614 CCAGCACCCCCTGTATACCCAGG + Intergenic
1148742699 17:49901892-49901914 TCTGCTCCTCCTGTGTCCCCCGG + Intergenic
1149814833 17:59713514-59713536 TCTCCTCTCCCTATCTCCCCAGG - Intronic
1150196554 17:63305097-63305119 TCACCACCCCCGCTACCCCCAGG + Intronic
1150229896 17:63544134-63544156 TCCTCACACCCTGTGTCCCCAGG + Intronic
1151236071 17:72720510-72720532 TCCCCACTCCCTGCCTCCCCAGG - Intronic
1152077915 17:78169968-78169990 TCTTCACCTCCTGGAACCCCTGG - Intronic
1152112543 17:78365311-78365333 TTTCCCCACCGTGTATCCCCAGG - Intergenic
1152274739 17:79349676-79349698 TCCTTTCCCCCTGTATCCCCGGG + Intronic
1153045377 18:851073-851095 TCTCTATCCCCTGTATTTCCAGG - Intergenic
1156360273 18:36378561-36378583 TGTCCAACCCCTGTCCCCCCTGG + Intronic
1156450138 18:37262245-37262267 TCCCCATCCCCTGCATCCCTGGG + Intronic
1158277535 18:55784607-55784629 TCTCCACCCCAAGTATCCTATGG + Intergenic
1160042842 18:75361052-75361074 TCTCCATGCCCAGTATCTCCTGG - Intergenic
1160556883 18:79731143-79731165 GCCCCACCCCATGTGTCCCCAGG - Intronic
1160648420 19:206460-206482 TCTCCAGCCCCTCTTCCCCCTGG - Intergenic
1160783588 19:889540-889562 TCTCCATCACCAGCATCCCCTGG - Intronic
1160783831 19:890785-890807 AATCCACCCTCTGTACCCCCAGG + Intronic
1161933411 19:7356158-7356180 TCTCAACCCCCAGGGTCCCCAGG + Intronic
1163095638 19:15055169-15055191 TCTCCACCTACTGTTTCACCGGG - Exonic
1163635169 19:18434094-18434116 TCCCCACCCCATGTCTGCCCAGG + Intronic
1165225783 19:34353584-34353606 TGTCCACCCCCAGAAACCCCAGG - Exonic
1165307660 19:35012200-35012222 TCGCCACCCCCTCTGCCCCCCGG + Intronic
1167250596 19:48396676-48396698 TCTCGGGCCCCTGTCTCCCCAGG - Intronic
1167467334 19:49657297-49657319 TAGCCACCCCCTCCATCCCCTGG + Intronic
1167650246 19:50724861-50724883 TCTCCACCTCCTGGCTCCCGCGG + Intronic
925060862 2:889034-889056 TCCACACCCCCTGGAGCCCCAGG + Intergenic
925666081 2:6257934-6257956 TCCCACCCCCCTGTATCCCCAGG + Intergenic
927284540 2:21343124-21343146 TCTTAACCCCCTGTGTCCCAGGG - Intergenic
927447775 2:23180350-23180372 TCCCCACCCCCTTCATCCCCTGG - Intergenic
927698308 2:25252152-25252174 TCCCCGCCCCCGGTCTCCCCGGG + Intronic
932453074 2:71828161-71828183 TCTACACCCTCTGCAGCCCCTGG + Intergenic
933990242 2:87628650-87628672 CCTCCACCCTCTGTCTCCCTTGG - Intergenic
933993050 2:87647385-87647407 TCTCCACCTCCCATGTCCCCTGG + Intergenic
934518754 2:95006137-95006159 TCTCCACCCCTTCTCTGCCCAGG - Intergenic
934713804 2:96531768-96531790 TTTCCATTCCCTGTGTCCCCAGG + Intergenic
936300808 2:111303494-111303516 TCTCCACCTCCCATGTCCCCTGG - Intergenic
936303604 2:111322174-111322196 CCTCCACCCTCTGTCTCCCTTGG + Intergenic
937141724 2:119607669-119607691 TCCCCACCCCCTGGAGCCCCTGG + Intronic
937923819 2:127152451-127152473 TCTCCACATCCTGTACCTCCCGG + Intergenic
937991666 2:127665578-127665600 TCTCCATGCCCTTTAGCCCCTGG - Intronic
944075658 2:195727863-195727885 TCTCCACCATCTCTGTCCCCTGG + Intronic
945034061 2:205689002-205689024 TCTCCACTCCCTGTACACACAGG - Intronic
945057603 2:205881763-205881785 TCTCTACCACCTTTAACCCCTGG - Intergenic
946415555 2:219538222-219538244 TGTCCACACCCCTTATCCCCAGG + Exonic
946852264 2:223919083-223919105 TCTCCATCTCCTGCATCCCTAGG + Intronic
947572303 2:231245821-231245843 TCTTCACCCCCTGTTCCCCCTGG + Intronic
947971842 2:234331458-234331480 TCTGCCCCTCCTGTGTCCCCAGG + Intergenic
947998479 2:234548153-234548175 ACTCCAATCCCTGTTTCCCCAGG + Intergenic
948853885 2:240721205-240721227 CCTCCAGCCCCTGTGGCCCCTGG + Intronic
948899047 2:240946890-240946912 TCTCCACCTCATGTGTCCCTGGG - Intronic
1170653470 20:18264310-18264332 TCTCCCCTCCCTCTAGCCCCTGG + Intergenic
1170712062 20:18800323-18800345 TCTCTACTCCCTGCACCCCCTGG + Intergenic
1170893297 20:20393830-20393852 TCTGCACCCCCCGCTTCCCCAGG + Intronic
1170926880 20:20733031-20733053 TCTCCACCCCTGGGATCTCCAGG - Intergenic
1172039657 20:32034977-32034999 TCCCCACCAGCTGGATCCCCTGG + Intergenic
1172525555 20:35599090-35599112 TCTCAACCTCCTGCAGCCCCTGG + Intergenic
1172882391 20:38210576-38210598 TCTCCCCTCACTGCATCCCCTGG - Exonic
1174373864 20:50112780-50112802 TCGCCAGCCCCGGTATCCTCAGG + Intronic
1175142509 20:56871554-56871576 TCTCCAGCCCCTGAGTCCCCAGG - Intergenic
1175327221 20:58138073-58138095 TCATCACCCCCTGTACCCCATGG + Intergenic
1175547183 20:59785935-59785957 TCTGCCTCCCCTGCATCCCCAGG + Intronic
1176161707 20:63652012-63652034 CCCCCACCCCCAGTATCCCCGGG + Intronic
1178849051 21:36197934-36197956 CCTCCACCTCCTGTACCTCCTGG - Intronic
1179074619 21:38108388-38108410 GCTCCAGCCCCTGTAGCCCAAGG - Intronic
1179252172 21:39679790-39679812 TCTCCCCCCTGTCTATCCCCAGG - Intergenic
1179676112 21:42983297-42983319 TCTCCCCTCCCTGAAGCCCCTGG + Intronic
1179904978 21:44418148-44418170 TCTCCACCCCCTCTGCACCCGGG - Intronic
1179941683 21:44643249-44643271 TCCCCACTCCCTGCACCCCCTGG - Intronic
1180146628 21:45923651-45923673 TCTCCATTCCATGTCTCCCCTGG - Intronic
1180877300 22:19180583-19180605 TCTCCACACCCAGTAGCCACTGG + Intronic
1181145291 22:20841640-20841662 TGTCCACACCCTCAATCCCCTGG + Intronic
1183244544 22:36683848-36683870 TCTCCACCCCCCGCGACCCCTGG + Intronic
1185182797 22:49372861-49372883 TCCCCACCCTCTCTGTCCCCAGG + Intergenic
950043447 3:9934398-9934420 TCTCCACGCCCTCTATCTGCAGG + Exonic
951704512 3:25530139-25530161 TATCTACCCCTTATATCCCCTGG + Intronic
952246688 3:31601583-31601605 TCTCCTCCTCCTAAATCCCCAGG - Intronic
955521278 3:59777880-59777902 TCTCTACCCCAGGTTTCCCCGGG + Intronic
965653365 3:170956926-170956948 TCTCCACTCCCTAAAGCCCCTGG + Intergenic
966777648 3:183556914-183556936 TCCCCACCCCCTGGATTCTCAGG - Intergenic
968369428 3:198213655-198213677 TCTCCAGCCCCTCTTCCCCCTGG + Intergenic
968804554 4:2763872-2763894 TCTGTACCCGCTGTGTCCCCCGG - Intergenic
968958798 4:3732366-3732388 TCTCCATCCTCTGTAAGCCCAGG - Intergenic
969154517 4:5198644-5198666 TCACCACCCCATGGATCACCAGG - Intronic
969313077 4:6365502-6365524 TCTGCACCCCCTTTATCCCATGG - Intronic
971257990 4:25031067-25031089 TCGCCACCCCCTCTCGCCCCGGG + Intergenic
980913522 4:139014481-139014503 TGTCCACACCCTCTATCCACAGG + Intergenic
981807966 4:148738830-148738852 TCTTCACCCCCATCATCCCCGGG - Intergenic
982915965 4:161209697-161209719 TCCCCACCCCCTCCATCCACTGG + Intergenic
986851421 5:11817691-11817713 TCTCCACGCTCTGTCTCCACAGG + Intronic
988289322 5:29265526-29265548 AATCCACCCTCTGTATCCACAGG + Intergenic
990493308 5:56322437-56322459 TCTACAACCCCTGCATCCCTTGG - Intergenic
997718731 5:136061650-136061672 TCTCCAGCCCCTGTCTTCCTTGG + Intronic
998873802 5:146578990-146579012 TCTCCTTCCCCTGTATCCTGGGG + Intergenic
999178721 5:149653388-149653410 TCTCCTCCACCTGCATCCTCAGG + Intergenic
999519475 5:152336087-152336109 TCTCCAGCCCCTGTCTTGCCTGG + Intergenic
1000036014 5:157448451-157448473 TCTCCACTCCCCTCATCCCCTGG + Intronic
1002728707 5:181319240-181319262 TCTCCAGCCCCTCTTCCCCCTGG + Intergenic
1004220569 6:13743180-13743202 TCTCCACACCCTGCAAGCCCAGG - Intergenic
1005257740 6:24022309-24022331 TCATCACCTCCTGTTTCCCCAGG + Intergenic
1006094321 6:31646468-31646490 TCTCCAGCCGCTGTAGCTCCTGG + Exonic
1006266726 6:32931793-32931815 TCTCCACTCTCTGAAACCCCTGG + Intergenic
1017071146 6:150576486-150576508 TCTCCTCCTCCTGTCTCCACGGG - Intergenic
1017796733 6:157851499-157851521 TTCCCACTCCCTGTAGCCCCTGG + Intronic
1018365611 6:163117001-163117023 TCTCCACTCCCTGTCACCCTCGG + Intronic
1019687315 7:2388907-2388929 TCTCCTCCTCCTGGAACCCCTGG - Intergenic
1019687338 7:2388995-2389017 TCTCCTCCTCCTGGAACCCCTGG - Intergenic
1019687410 7:2389245-2389267 TCTCCTCCTCCTGGAACCCCTGG - Intergenic
1020272954 7:6607815-6607837 TGTCCACCGCCTGGACCCCCGGG + Intronic
1020914485 7:14175429-14175451 CCTCCACCTCCTGCACCCCCAGG + Intronic
1022515546 7:30972692-30972714 TCTCCACCCCATCTCTCCCATGG - Intronic
1024785641 7:52903978-52904000 TCCCCACCCCCAGCAGCCCCTGG - Intergenic
1026955975 7:74376723-74376745 TCTCGACCTCCTGTTTGCCCTGG - Exonic
1029079308 7:97959461-97959483 TCTCACCCCCCTCTCTCCCCTGG - Intergenic
1029086921 7:98019039-98019061 TCTCCATCCCCCTTATCCCCAGG + Intergenic
1029154760 7:98508246-98508268 CCTCCACCACCTCTACCCCCAGG - Intergenic
1029333165 7:99877051-99877073 TCTCCACTCTCTGTTTCCTCAGG - Exonic
1030312175 7:108079864-108079886 GCACCACCCCCTGTATTTCCTGG + Intronic
1032156242 7:129470788-129470810 TCTCCAACCCCTTAATGCCCTGG + Intronic
1034536265 7:151727744-151727766 CCTTCAGGCCCTGTATCCCCTGG + Intronic
1035018882 7:155788796-155788818 TCTCCAGCCCCCGTGTCCTCTGG + Intergenic
1035191959 7:157177707-157177729 TCCTCACCCCCTGTCTCTCCTGG + Intronic
1037367083 8:18134670-18134692 TCTACACCTCCTTTTTCCCCTGG - Intergenic
1037689307 8:21169458-21169480 AGTCCATCCCCTCTATCCCCAGG - Intergenic
1038420265 8:27430071-27430093 TCTCCACCACCTATTTCTCCAGG + Exonic
1040610320 8:48977077-48977099 ACTCCACCCCCGGTATTCCTAGG - Intergenic
1041544412 8:59025717-59025739 TCTCCAGCTCCTGTTTCCCCAGG + Intronic
1041556834 8:59167101-59167123 TCCCCACACCCTTTAGCCCCTGG + Intergenic
1041699182 8:60768622-60768644 TCACCACCCCCACAATCCCCAGG - Intronic
1042969218 8:74390473-74390495 ACTCCACACCCTGTTTCCCTGGG + Intronic
1043571674 8:81610835-81610857 CCTCCACTCCGTGTATCCACAGG - Intergenic
1044626251 8:94236958-94236980 TTTCCATCCCCAGTCTCCCCAGG + Intergenic
1045006763 8:97922919-97922941 TTTCCTTCCTCTGTATCCCCAGG + Intronic
1045264545 8:100608324-100608346 TCTCCACCCCCCACAGCCCCTGG + Intronic
1048573188 8:135671647-135671669 TCTCCAGCCCCTGCCTCCTCAGG - Intergenic
1049313069 8:141943657-141943679 GCTCCACCCCCTGTGGCCCGTGG + Intergenic
1049444425 8:142623499-142623521 TCTCCACCCCTGGGCTCCCCCGG - Intergenic
1050075184 9:1855738-1855760 TCTCCTCCCTCTGTTTTCCCTGG + Intergenic
1050902927 9:10967902-10967924 TGGCCACCCCCTGTCCCCCCTGG + Intergenic
1052020702 9:23522353-23522375 CCTCCACCCCCTGTACTGCCAGG + Intergenic
1056965568 9:91160886-91160908 TCGCCCTCCCCAGTATCCCCTGG - Intergenic
1057935339 9:99233753-99233775 CCTCCACCCCATATATCTCCTGG - Intergenic
1059324952 9:113498383-113498405 TCTCGGCCCCCTGCTTCCCCTGG + Intronic
1060001438 9:119962481-119962503 TCCCAACCCCCTGTGTCCACAGG + Intergenic
1060220878 9:121763483-121763505 TCTCCACCTCCTGCCTCCCCAGG + Exonic
1060976026 9:127765593-127765615 GCTCCACCCCCTGCAGCCTCAGG + Intronic
1061073452 9:128326349-128326371 TCTCCAGCCCCTCCAGCCCCAGG + Intronic
1061134958 9:128728525-128728547 TCTCCACCCCCTGCAGGGCCTGG - Intergenic
1061409543 9:130411792-130411814 TCTCCCCTCCCTGCAGCCCCTGG - Intronic
1061818288 9:133208818-133208840 TCTGCACCCCATGGACCCCCGGG + Intronic
1061949786 9:133929819-133929841 TCCCCACCGCCAGTGTCCCCAGG + Intronic
1062039876 9:134399520-134399542 TCTCCACATCCAGAATCCCCAGG - Intronic
1062242164 9:135546540-135546562 TCTGCACCCCATGGACCCCCGGG - Intronic
1062445709 9:136593336-136593358 TCCCCAGCCCCAGTATACCCTGG + Intergenic
1062490799 9:136803990-136804012 TCTCCACCCCGGGTATACCCAGG - Intronic
1062665577 9:137669570-137669592 ACTCCACCCACTGTCTACCCAGG + Intronic
1062753767 9:138276339-138276361 TCTCCAGCCCCTCTTCCCCCTGG + Intergenic
1203576283 Un_KI270745v1:11118-11140 TCTCCAGCCCCTCTTCCCCCTGG + Intergenic
1185616007 X:1422512-1422534 TCTCCACCCACTTCATGCCCAGG + Intronic
1185953149 X:4458581-4458603 TCTCCATCCCCTGTACCTTCAGG + Intergenic
1188194888 X:27221449-27221471 TCTCCACCCTCAGTAGGCCCTGG + Intergenic
1189911307 X:45813047-45813069 TCCCCACCCCCAGTAGGCCCTGG + Intergenic
1190000872 X:46685320-46685342 TCTCCATCCCCTGTACTGCCAGG + Intronic
1191184197 X:57592420-57592442 TCTCGCCCCCCTGGAGCCCCGGG - Exonic
1191213195 X:57910039-57910061 TCTCGTCCCCCTGGAGCCCCGGG + Exonic
1191660184 X:63641498-63641520 TCCCCACCCTATGTATCTCCAGG - Intronic
1194390514 X:93312163-93312185 TCTCCAGTTCCTCTATCCCCAGG - Intergenic
1194998935 X:100623221-100623243 TCTGAACTCCCTGGATCCCCTGG + Intergenic
1195355949 X:104040152-104040174 GCTTCACCCCCTATTTCCCCCGG + Exonic
1197256669 X:124270666-124270688 TCTCTACCCTCTGGGTCCCCAGG - Intronic
1197485745 X:127049368-127049390 TCTCCACTCACTGCAACCCCTGG + Intergenic
1202040284 Y:20675336-20675358 TCTCCAGACCCTGTTTCCCTGGG - Intergenic