ID: 1077216934

View in Genome Browser
Species Human (GRCh38)
Location 11:1398869-1398891
Sequence CTGGGGGGGCTCCAGGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 605
Summary {0: 1, 1: 1, 2: 2, 3: 65, 4: 536}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077216934_1077216949 5 Left 1077216934 11:1398869-1398891 CCTGGAGCCTGGAGCCCCCCCAG 0: 1
1: 1
2: 2
3: 65
4: 536
Right 1077216949 11:1398897-1398919 CCGCTTATCTTTGGTGTCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 91
1077216934_1077216951 15 Left 1077216934 11:1398869-1398891 CCTGGAGCCTGGAGCCCCCCCAG 0: 1
1: 1
2: 2
3: 65
4: 536
Right 1077216951 11:1398907-1398929 TTGGTGTCTGGGGCGGAGACTGG 0: 1
1: 1
2: 0
3: 19
4: 205
1077216934_1077216942 -4 Left 1077216934 11:1398869-1398891 CCTGGAGCCTGGAGCCCCCCCAG 0: 1
1: 1
2: 2
3: 65
4: 536
Right 1077216942 11:1398888-1398910 CCAGCCCCTCCGCTTATCTTTGG 0: 1
1: 0
2: 1
3: 11
4: 117
1077216934_1077216952 22 Left 1077216934 11:1398869-1398891 CCTGGAGCCTGGAGCCCCCCCAG 0: 1
1: 1
2: 2
3: 65
4: 536
Right 1077216952 11:1398914-1398936 CTGGGGCGGAGACTGGCCCTTGG 0: 1
1: 0
2: 2
3: 34
4: 358
1077216934_1077216947 4 Left 1077216934 11:1398869-1398891 CCTGGAGCCTGGAGCCCCCCCAG 0: 1
1: 1
2: 2
3: 65
4: 536
Right 1077216947 11:1398896-1398918 TCCGCTTATCTTTGGTGTCTGGG 0: 1
1: 0
2: 0
3: 3
4: 105
1077216934_1077216946 3 Left 1077216934 11:1398869-1398891 CCTGGAGCCTGGAGCCCCCCCAG 0: 1
1: 1
2: 2
3: 65
4: 536
Right 1077216946 11:1398895-1398917 CTCCGCTTATCTTTGGTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 94
1077216934_1077216950 8 Left 1077216934 11:1398869-1398891 CCTGGAGCCTGGAGCCCCCCCAG 0: 1
1: 1
2: 2
3: 65
4: 536
Right 1077216950 11:1398900-1398922 CTTATCTTTGGTGTCTGGGGCGG 0: 1
1: 0
2: 1
3: 22
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077216934 Original CRISPR CTGGGGGGGCTCCAGGCTCC AGG (reversed) Intronic
900109634 1:1000070-1000092 CTAGGGCGGATCCCGGCTCCAGG + Exonic
900137648 1:1125179-1125201 CTGGAGGAGCTCCCGGCTCCCGG + Intergenic
900188358 1:1343244-1343266 GGGGGGGGGCTCCAAGCCCCAGG - Intronic
900617903 1:3573529-3573551 CTGGGGCTGCTGCAGGCTGCAGG + Intronic
900623523 1:3598068-3598090 CTGTGGGGTCTGCAGGCTGCAGG - Intronic
900977843 1:6028203-6028225 CTGTGTGGGCTCCTGGCTTCTGG + Intronic
901190493 1:7407244-7407266 CTTGGGGGGCTCATGGCTGCTGG + Intronic
901404786 1:9038786-9038808 CTGGTGCAGCTCCGGGCTCCTGG + Intronic
901405164 1:9040276-9040298 CTGAGTGGGGTGCAGGCTCCAGG + Intronic
901409353 1:9071830-9071852 CTGGCGGGCCTGCGGGCTCCGGG + Intronic
901615851 1:10538858-10538880 CTGGGAGGGCTCTCAGCTCCTGG + Intronic
902063736 1:13666563-13666585 CTGCGTGTGCCCCAGGCTCCAGG + Intergenic
902600986 1:17540018-17540040 CGGGAGGCGCTCCAGGCGCCAGG + Intronic
903742023 1:25563848-25563870 CTGGGGCTGCTCCAGGGACCAGG + Intronic
903800220 1:25961704-25961726 CTGGGGGAGACCCAGGCCCCGGG - Exonic
903856997 1:26343506-26343528 GTGTGGGGGCTCCAAGATCCTGG - Intronic
904036003 1:27558830-27558852 CTGGGTGGGCTCTGGGGTCCAGG + Exonic
904356703 1:29944930-29944952 CTGGGGGGGCCCAAGGCTGGGGG + Intergenic
904413640 1:30341603-30341625 CTGGCTGGGATCCAGGCTGCAGG - Intergenic
904592481 1:31622722-31622744 CTGGGGTGGTTCTGGGCTCCTGG - Intronic
904832400 1:33313496-33313518 CTGTGGTGGCTCCAGTCACCAGG + Intronic
905306136 1:37019605-37019627 TTGCGGGGGCTCCAGGATGCGGG - Intronic
905919889 1:41712392-41712414 CTGTGGGGTTTCCAGTCTCCTGG + Intronic
906244745 1:44265045-44265067 CTGGGTGGCCTCCTGGCTCAAGG - Intronic
906286141 1:44589014-44589036 CTGAGGGGCCCCCTGGCTCCAGG + Intronic
906526190 1:46494580-46494602 CTGGGAGAGTTCCAGGGTCCCGG - Intergenic
906567661 1:46812392-46812414 CTTGGAGGGTTCCAGGCTCAGGG + Intronic
907658942 1:56374186-56374208 CTGGGGGTGATCCGGGCTCAGGG - Intergenic
907846930 1:58217311-58217333 CTGGTCTGCCTCCAGGCTCCAGG - Intronic
911032463 1:93504408-93504430 CTGGGGAGGCTTCAGACTCATGG - Intronic
911092548 1:94029445-94029467 CTGGGGGGGCGGGAGGCCCCCGG + Exonic
915056279 1:153134020-153134042 CTGGGTGACCTCCAGGTTCCTGG - Intergenic
915543847 1:156584886-156584908 CCGGGAAGACTCCAGGCTCCAGG + Exonic
915936769 1:160094133-160094155 CTGGGGGGGCAGCAGACACCTGG + Exonic
917027766 1:170661619-170661641 CTGGCAGGGCTCTGGGCTCCCGG + Intergenic
920655081 1:207868794-207868816 CCGGGCGGGCCCCAGGCTCTGGG - Intergenic
920861005 1:209706723-209706745 CTGAGGCTGCTCCAAGCTCCAGG - Exonic
921046416 1:211481076-211481098 CTTGCTGGGCTGCAGGCTCCAGG - Intronic
921077711 1:211712905-211712927 GTGATGGGGCTCCAGGCTCTGGG + Intergenic
922048976 1:221972483-221972505 GTGGGGGGCCTCCAGGCTATAGG - Intergenic
922120480 1:222662469-222662491 CTGAGGGGACTTCAGGCTCTTGG - Intronic
922729106 1:227940831-227940853 CCGGGAGGGCAACAGGCTCCTGG + Intronic
922749626 1:228064431-228064453 CTTGGAGGCCTGCAGGCTCCGGG - Intergenic
922757220 1:228103098-228103120 GTGGGCGGGCTCCGGGCTCCGGG - Intronic
922798261 1:228352127-228352149 CTACGGGTGCCCCAGGCTCCAGG + Intronic
924570622 1:245234640-245234662 CTTGGGGTGCTCCAGTCTGCAGG + Intronic
924836000 1:247648102-247648124 CTGGCAGGGATCCAAGCTCCAGG - Intergenic
924878894 1:248136794-248136816 CTCAGGGGGCTCCAGGCCTCAGG + Intergenic
924878911 1:248136845-248136867 CTCAGGGGGCTCCAGGCCTCAGG + Intergenic
924881171 1:248164480-248164502 CTCGGGGGGCTCCAGTCCTCAGG + Intergenic
924881181 1:248164515-248164537 CTCAGGGGGCTCCAGTCTTCAGG + Intergenic
924881206 1:248164600-248164622 CTCAGGGGGCTCCAGTCTTCAGG + Intergenic
924881219 1:248164651-248164673 CTCAGGGGGCTCCAGTCTTCAGG + Intergenic
924881244 1:248164736-248164758 CTCAGGGGGCTCCAGTCTTCAGG + Intergenic
924881319 1:248164994-248165016 CTCAGGGGGCTCCAGTCTTCAGG + Intergenic
1062921212 10:1281271-1281293 CTGGGGGGTCCCCAGGCCTCAGG + Intronic
1063458756 10:6202716-6202738 CTGGGCGCGCTCCAGGCCCGGGG + Intronic
1064018086 10:11788134-11788156 GTGGGGGGGCTCCATGTTGCTGG - Intergenic
1065046891 10:21753382-21753404 CTGGAGAGGCTCCAGGCCCACGG + Intergenic
1065529341 10:26653091-26653113 CCGGGGGTGCTCCTGGCTCCTGG - Intergenic
1066654503 10:37685836-37685858 CTGGCCTGGCTCCTGGCTCCAGG - Intergenic
1067215784 10:44301570-44301592 CTGTGCTGGCTCCTGGCTCCTGG - Intergenic
1067275289 10:44828413-44828435 CTGGTGGAGCTTCAGGATCCTGG - Intergenic
1067289329 10:44929883-44929905 CAGCAGGGGCTCCAGGCTCAGGG - Intronic
1067336960 10:45374140-45374162 CCGGTCTGGCTCCAGGCTCCCGG - Intergenic
1069438351 10:68406711-68406733 CTGGGGGGCCCCCAGGCCTCTGG - Intronic
1069580148 10:69560163-69560185 TGGGGGGAGCTCCAGGCTTCTGG + Intergenic
1069820189 10:71222763-71222785 CTCTGGGGGTTGCAGGCTCCTGG - Intronic
1070055053 10:72926198-72926220 CTGGGTGGCCTGCAGGCTCTTGG + Intronic
1070755739 10:78992313-78992335 CTGGGGGGTCTCGGTGCTCCTGG - Intergenic
1070796360 10:79219219-79219241 CTGGGGAGGCACTGGGCTCCTGG - Intronic
1071337946 10:84617016-84617038 CTGGGAGAGCTGCAGGCACCTGG + Intergenic
1071601093 10:86959102-86959124 CTTCAGGGGCTCCAGGCTCAGGG - Intronic
1071729981 10:88238295-88238317 CTGGGGAGGCTGCTGGCTCAAGG - Intergenic
1072067844 10:91887534-91887556 CTGTGAGGGCCCCGGGCTCCGGG - Intergenic
1072618033 10:97062702-97062724 CTGGGGGAGCTGCAGGCAGCAGG + Intronic
1072626233 10:97114004-97114026 CTGGAGTGGCTTCAGGCACCTGG - Intronic
1074363987 10:112843696-112843718 CGTGGGGGTCTCCAGCCTCCTGG + Intergenic
1074974498 10:118569145-118569167 CTGGGCTGGCTTCAGGGTCCAGG - Intergenic
1075078363 10:119366655-119366677 CCAGGGGTGCTCCAGCCTCCAGG - Intronic
1075630153 10:123995723-123995745 CTGGGGCGGCTCGAGGTTCCTGG + Intergenic
1075728826 10:124624420-124624442 CTGAGGAGGGGCCAGGCTCCAGG + Intronic
1075870991 10:125772815-125772837 CTAGGGGGTCCCCAGCCTCCAGG + Intronic
1076528123 10:131125641-131125663 CAGGGTGGGCTGCAGGCCCCTGG + Intronic
1076673931 10:132137933-132137955 CTCGGGGAGCTCCTGTCTCCAGG - Intronic
1077076006 11:702447-702469 CTGCAGGGTCTCCAGGCACCTGG + Intronic
1077096061 11:799641-799663 GTGGGGGAGTTCCCGGCTCCTGG + Intronic
1077216934 11:1398869-1398891 CTGGGGGGGCTCCAGGCTCCAGG - Intronic
1077282363 11:1751435-1751457 AGGGGGGGACTCCAGGCTCAGGG + Intronic
1077407024 11:2387240-2387262 CTGGAAGGTCCCCAGGCTCCCGG - Intronic
1077458213 11:2693683-2693705 CTGGGTGCGCTCCAGCCTCATGG + Intronic
1078088384 11:8248391-8248413 CTGGTGGGTCTCCAGGCCCTGGG + Intronic
1078904393 11:15670884-15670906 GTGGGGGAGCCGCAGGCTCCCGG + Intergenic
1079241834 11:18727239-18727261 TTGGGTGGGATCCAGGGTCCAGG - Intergenic
1079870592 11:25793903-25793925 CAGGGGAGTCTCCAGGCCCCTGG + Intergenic
1080787285 11:35487096-35487118 CTGGTTGTGCTCCAGGCTGCAGG - Intronic
1081636760 11:44726975-44726997 GTCGCGGGGCTCCAGGCTGCGGG + Intronic
1081873877 11:46396042-46396064 CTGGAGGGGATCCAGGTTTCTGG + Intergenic
1082644360 11:55702607-55702629 CTGGAGTGGATCCAGACTCCAGG + Intergenic
1083304605 11:61755902-61755924 CTGGTGGGGCTCCAGAGGCCGGG - Intronic
1084183039 11:67455999-67456021 CTGTGGGAGCTCCAGGCTCTAGG + Intronic
1084273438 11:68040585-68040607 CTGGAGGGGCCCCAGCATCCAGG + Intronic
1084305271 11:68278604-68278626 CTGGGGGTGCACCACGCTCCTGG + Intergenic
1084379826 11:68804756-68804778 CGGGATGGGCTCCAGGCTCTAGG + Intronic
1084477800 11:69398812-69398834 CTGGGGGCTCTGCAGGCCCCCGG - Intergenic
1084701288 11:70787781-70787803 CTGGGGATGCTCCAGCCTCCAGG + Intronic
1085208079 11:74749086-74749108 TCCGGGGGGCTCCAGGCACCCGG - Exonic
1088178053 11:107076437-107076459 CGGGGGGGCTTCCAGGCTACAGG - Intergenic
1088635317 11:111814414-111814436 CTGGGGGAGCTCCTGGGTGCTGG + Intronic
1088991749 11:114960070-114960092 CTGGAGGTGCTGCAGTCTCCTGG + Intergenic
1089364349 11:117911921-117911943 CTGGTGGGGCTCTAGCCTGCTGG - Intronic
1090334698 11:125954583-125954605 CTTGGGAGGCTCCAGGCTGAGGG + Intergenic
1091369478 11:135046620-135046642 CTGGGGAGCCTCCAGGCCCTGGG - Intergenic
1091807722 12:3367660-3367682 CTTGGGGGGCATCAGGATCCTGG + Intergenic
1091919672 12:4294246-4294268 CTGTGAGGGCTCCAGGCTTGGGG + Intronic
1092820621 12:12350344-12350366 CCGCGGAGGCTCCGGGCTCCCGG + Exonic
1092950431 12:13498542-13498564 CTGAGGGAGGTACAGGCTCCAGG - Intergenic
1093353180 12:18128672-18128694 ATGAAGAGGCTCCAGGCTCCAGG - Intronic
1094377113 12:29801964-29801986 CTGGGGGCGCTGCAGGCGGCCGG + Intergenic
1095890878 12:47234641-47234663 CTGGGCTGCCTCCAGGCTCTTGG + Intronic
1095905119 12:47369447-47369469 CAGGCGGGGCTCCAGGCCCTGGG + Intergenic
1097264327 12:57737158-57737180 CAGGAGGGCCTCCTGGCTCCGGG - Exonic
1097777889 12:63668902-63668924 CTGGGGGTGCTGCAGGCGCTGGG - Intronic
1098750868 12:74292477-74292499 CTGAGGGGGCTCCCGGGTGCCGG - Intergenic
1100781371 12:98030128-98030150 CTTGGGAGGCTCCTGGCTACAGG - Intergenic
1101340818 12:103840904-103840926 CAGGAGGGGCCCCAGGCGCCGGG + Intronic
1101604728 12:106239519-106239541 CAGGAGGGACTCCAGGCTCTCGG + Exonic
1102020635 12:109679899-109679921 CTGGGAGGCCTCCAGGCTGCAGG + Intergenic
1102963913 12:117111876-117111898 CTGGGGGGCCTCAGGGCTCCAGG - Intergenic
1103005359 12:117416406-117416428 CTGACAGGGCTGCAGGCTCCTGG + Intronic
1103504225 12:121430505-121430527 GCGGGGGGGCTTCTGGCTCCTGG - Intronic
1103901642 12:124306546-124306568 CTGGTGCGGCTCCAGGTCCCGGG - Intronic
1103939330 12:124493297-124493319 CTGGGGGTGCTGCTGGCTTCTGG - Intronic
1104887134 12:132117321-132117343 CTCCGGGGGCTCCGTGCTCCTGG - Intronic
1104910143 12:132236345-132236367 GTGTGGGGGCTGCGGGCTCCAGG + Intronic
1104967262 12:132513892-132513914 GTGGGTGGGCTCCCGGCACCTGG + Intronic
1105293765 13:19071240-19071262 CTTGTGTGGCTCCAGGCTCTGGG + Intergenic
1105331550 13:19421328-19421350 CTAGTGGGGCTCTTGGCTCCTGG + Intergenic
1105880234 13:24599222-24599244 CTAGTGGGGCTCTTGGCTCCTGG - Intergenic
1105919598 13:24949644-24949666 CTAGTGGGGCTCTTGGCTCCTGG + Intergenic
1106776706 13:33016417-33016439 CTGCGCGGGAGCCAGGCTCCGGG - Exonic
1107482198 13:40794461-40794483 CTGGGGGAGCCTCAGGCTCTTGG - Intronic
1108532359 13:51339540-51339562 CTGCAGGACCTCCAGGCTCCAGG + Intronic
1110809104 13:79791819-79791841 CTGGGGGTGGTCCAGGCTTGGGG + Intergenic
1112291006 13:98143699-98143721 CTCGGGGGCCTCGGGGCTCCGGG + Intronic
1113461355 13:110484706-110484728 TGGGGGTGGCTCCAGGGTCCTGG - Intronic
1113588906 13:111484413-111484435 CTGGGTGCGCTCCATACTCCAGG - Intergenic
1113612522 13:111657259-111657281 CTGGAGAGTCTCCTGGCTCCTGG + Intronic
1114086564 14:19239970-19239992 CCAGGTGGGCACCAGGCTCCAGG + Intergenic
1114756758 14:25268774-25268796 CAGTGGGGCTTCCAGGCTCCAGG + Intergenic
1115738693 14:36363994-36364016 CTGTGGGGGCTGTAGGCTCCTGG + Intergenic
1116351595 14:43870683-43870705 CTGGGGGGCTTCCAGGCTATAGG + Intergenic
1116872781 14:50083908-50083930 CTGTGGGGCCTCCAGCCTCTTGG + Exonic
1117956015 14:61124376-61124398 CTTGGGGGACTCCAGGGCCCTGG + Intergenic
1118329201 14:64802572-64802594 CTGATGGTGCACCAGGCTCCAGG - Intronic
1118329688 14:64805658-64805680 CTGATGGTGCACCAGGCTCCAGG - Intronic
1118491937 14:66269506-66269528 CATGGGGGGCTCCAGGGTCATGG - Intergenic
1118525382 14:66634696-66634718 CTGGCTGGTCCCCAGGCTCCTGG + Intronic
1118630187 14:67695513-67695535 CTGGGGGGGCTCCAAGATGGCGG - Intronic
1122273916 14:100581451-100581473 CTGGAGGGGCTTCCGGCTCCTGG + Intronic
1122297581 14:100713967-100713989 CTGGGATGGGGCCAGGCTCCGGG + Intergenic
1122316948 14:100831346-100831368 CCTGGGAGGCTCCAGGCTGCCGG - Intergenic
1122881556 14:104692681-104692703 CTGGGAGGGCTCCGGGGTCCAGG - Intronic
1122897484 14:104767515-104767537 CTGTTGGGGCTGCAGGATCCTGG + Intronic
1122940496 14:104978900-104978922 CTGGGCGGGGTTCTGGCTCCAGG - Intergenic
1123060671 14:105592779-105592801 CTGGGGCTGCCCCAGGGTCCTGG + Intergenic
1123085146 14:105713750-105713772 CTGGGGCTGCCCCAGGGTCCTGG + Intergenic
1123989773 15:25674854-25674876 CTGGGGAGGCCCCAGGCCCCGGG - Intergenic
1124370461 15:29101830-29101852 CCAGGGCGGCTCCAGGATCCAGG + Intronic
1125516366 15:40323524-40323546 CCGGCGGGGCTCGCGGCTCCCGG + Intergenic
1125726351 15:41870193-41870215 CTGAGGGGGCTGCAGGGGCCTGG + Intronic
1125765166 15:42130739-42130761 CTGGAGGAGCTCAAGGCTGCAGG - Intergenic
1128700356 15:69799498-69799520 ATGGGGGCGTGCCAGGCTCCAGG - Intergenic
1128878373 15:71220930-71220952 CTGGGGAGGTTCCAGGCTAGGGG + Intronic
1129191771 15:73941726-73941748 CAGGGGGGACTCCAGGGCCCTGG - Intronic
1129410328 15:75347494-75347516 CTTGGGGGGTTCCAGGCTTTGGG - Intronic
1129606916 15:77029468-77029490 CTGGGGTGGGCCCTGGCTCCTGG + Intronic
1129724319 15:77893850-77893872 CGGGGGGAGATCCTGGCTCCAGG - Intergenic
1129755323 15:78094575-78094597 CTGGGGGAGCTGCAGGGTGCTGG + Intronic
1129755328 15:78094594-78094616 CTGGGGGAGCTGCAGGTTGCTGG + Intronic
1131231816 15:90665375-90665397 TTGGGGCGGCTGCACGCTCCGGG - Intergenic
1131461178 15:92618450-92618472 CTGTGGGGTCTCCTGGGTCCAGG + Exonic
1131649123 15:94379549-94379571 CTAGGGTGGTTCCTGGCTCCTGG + Intronic
1132091655 15:98952271-98952293 CTGGGGGGTAGCCAGGCTCCCGG - Intronic
1132146776 15:99433823-99433845 CTGGGGGGGCTCCAGCCTGTGGG + Intergenic
1132279600 15:100602015-100602037 TTGGGAGGGCGGCAGGCTCCAGG - Intronic
1132601330 16:774463-774485 CTGGAGGGGCTACAGGCCCTGGG - Exonic
1133034514 16:3027428-3027450 CTGGGGAGGAGCCAGGCACCTGG - Exonic
1134143532 16:11742445-11742467 CTAGCGGGGCCCCAGGGTCCGGG + Intronic
1135941677 16:26827500-26827522 CTGTGTTAGCTCCAGGCTCCAGG + Intergenic
1136282279 16:29220866-29220888 CTGGGAGGGCTCCGGCATCCAGG + Intergenic
1136428884 16:30185869-30185891 CGGAGGGGGCAGCAGGCTCCAGG - Intronic
1136460457 16:30407406-30407428 CTGGGGCGGCTCCAGGTGCTTGG + Exonic
1136610398 16:31362299-31362321 CAGGGTGGGGTCCAGGCTTCTGG + Intronic
1136626048 16:31462757-31462779 CTGGGCCGGCTGCAGGCTCTGGG + Exonic
1136872077 16:33816641-33816663 CAGGGGGTGCTCCAGACACCAGG + Intergenic
1137612550 16:49828693-49828715 CTGGGCGGGCGCCATGCTCCAGG + Intronic
1137615041 16:49841385-49841407 CTGAGGGTTCTCCAAGCTCCAGG + Intronic
1138023110 16:53502762-53502784 CTGGAGGGGCCCGCGGCTCCCGG - Intronic
1140219444 16:73033183-73033205 CTGGCAGGGCTCCAGGGTACTGG - Intronic
1140456125 16:75106584-75106606 TTGGGGGTGCTCCGGGCTCAAGG + Intronic
1141690086 16:85591626-85591648 CTGGGGGTGCTGGGGGCTCCTGG + Intergenic
1141828911 16:86498673-86498695 CTGGGGGGCCTCGGGGCACCGGG - Intergenic
1141928796 16:87186715-87186737 CCGGGAGGGCTCCATCCTCCGGG - Intronic
1142086649 16:88186784-88186806 CTGGGAGGGCTCCGGCATCCAGG + Intergenic
1142144200 16:88486016-88486038 CTGGGAGGGCTCGGGGCTTCAGG - Exonic
1142230340 16:88897130-88897152 CTGTGGGGGCTCCGGGATCTGGG + Intronic
1142253058 16:89001594-89001616 GGGTGGAGGCTCCAGGCTCCCGG + Intergenic
1142287531 16:89177505-89177527 CCTGGGGGTCGCCAGGCTCCCGG - Intronic
1142412315 16:89923066-89923088 CTGTGGGGGCGCCGGGCTCCAGG - Intronic
1203100095 16_KI270728v1_random:1299427-1299449 CAGGGGGTGCTCCAGACACCAGG - Intergenic
1142591639 17:1008757-1008779 CTGAGGGGGCTCCCCGGTCCTGG + Intronic
1142866463 17:2794483-2794505 CTGGGGTGGCTTCAGGCTGCTGG - Intronic
1143001017 17:3795067-3795089 CTGGATTGGCTCCTGGCTCCTGG - Intronic
1143400326 17:6638958-6638980 CTGGGGGTGATCCAGGGTCACGG - Intronic
1143416568 17:6755327-6755349 CAGGCAGGGCTCCAGCCTCCAGG - Intergenic
1143497837 17:7322614-7322636 CTGGGGTAGCTGCCGGCTCCAGG - Intronic
1143986368 17:10918098-10918120 CAGGGGGGCTTCCAGGCTACAGG - Intergenic
1144636307 17:16911321-16911343 GTGGCTGGGGTCCAGGCTCCTGG - Intergenic
1144958713 17:19032894-19032916 CCGCGGGGACTCCAGGCTCCAGG + Intronic
1144976446 17:19141630-19141652 CCGCGGGGACTCCAGGCTCCAGG - Intronic
1146208193 17:30922386-30922408 CTGGAAGGGCTCTAGGCTGCCGG - Intronic
1146637965 17:34519980-34520002 CTGTTGGGGCTTCATGCTCCAGG - Intergenic
1147475091 17:40703442-40703464 TTGGGGGAGCTTCAGGCTCTGGG - Exonic
1147795068 17:43036509-43036531 CTGGGGCGGCGCCGGGCTCTGGG - Intergenic
1148348433 17:46920490-46920512 CTGGGTGGGATCCAGGATCCAGG + Intergenic
1148579336 17:48733021-48733043 TGGGGGAGGCTCCGGGCTCCCGG - Intergenic
1148687838 17:49510479-49510501 CTGGAGGTGCCTCAGGCTCCTGG - Exonic
1148695610 17:49556416-49556438 CTGGGTGGGCCCCAGGCATCCGG - Intergenic
1148748783 17:49932600-49932622 TGGGGGGGGGTCCTGGCTCCAGG + Intergenic
1149661293 17:58335330-58335352 CCTGGAGGGCTCCAGGCTCATGG + Intergenic
1149996619 17:61409260-61409282 CTGGGGGGGCCCTTGGCTGCGGG + Exonic
1150078689 17:62216974-62216996 CTGTGGGGCCTGCTGGCTCCTGG + Intergenic
1150462102 17:65361675-65361697 CTGGGGAGGCCCCGGGCCCCAGG + Intergenic
1151605138 17:75131130-75131152 CTGGGCGGGCTCCTGGCTCCCGG - Intronic
1151659959 17:75513898-75513920 CTTGGAGGGCTCCCGGTTCCGGG + Exonic
1152224864 17:79088039-79088061 CCGGGCTGGCTCCAGGCTGCAGG - Intronic
1152327016 17:79647599-79647621 GTGGGATGGCCCCAGGCTCCCGG - Intergenic
1152387729 17:79985150-79985172 CTTGGGGGCTTCCAGGATCCAGG - Intronic
1152767673 17:82149854-82149876 CTGGGTGTGCTCCTGGTTCCGGG - Intronic
1152768012 17:82151402-82151424 CTGGGGGTGCGCCAGGTTCTGGG - Intronic
1152800322 17:82327912-82327934 CTGGGGGGGCCGCTGGCTGCAGG - Intronic
1152894033 17:82900148-82900170 ATGGGGGGGCTCCAGGGTGATGG - Intronic
1153006136 18:500333-500355 CTGGGGGCGCACCCGGCTCCCGG - Intronic
1153223535 18:2881418-2881440 GGGTGGGGGCTCCAGGCTCCAGG + Intronic
1153828835 18:8901557-8901579 CCAGTGGGGCTCCAGGCTCTGGG - Intergenic
1154316034 18:13304052-13304074 CAGGGGTGGATCCAGGGTCCTGG + Intronic
1155114649 18:22752262-22752284 CTGGGTGGTTTCCAGGCCCCTGG - Intergenic
1156148974 18:34222211-34222233 CTGGGGTGGCTCTAGTCTCATGG - Intronic
1156522141 18:37730803-37730825 CGGGGGGAGCTCCAGGCAGCAGG + Intergenic
1157576288 18:48746093-48746115 CTGTGGAGCCTCCAGGCTCTTGG - Intronic
1158277104 18:55780427-55780449 CGGGCGGGGCTGCAGGCGCCGGG - Intergenic
1159805772 18:72957073-72957095 ATGTGGGGGCTACAGGCCCCAGG + Intergenic
1160517859 18:79488409-79488431 CTGGGGAGGCAGCAGCCTCCTGG - Intronic
1160722603 19:604105-604127 CTGGGTGGGGTCAAGGCCCCAGG + Intronic
1160722620 19:604146-604168 CTGGGTGGGGTCAAGGCCCCAGG + Intronic
1160722646 19:604228-604250 CTGGGTGGGGTCAAGGCCCCAGG + Intronic
1160722663 19:604269-604291 CTGGGTGGGGTCAAGGCCCCAGG + Intronic
1160722677 19:604310-604332 CTGGGTGGGGTCAAGGCCCCAGG + Intronic
1160799032 19:959184-959206 TTCTGGGGGCTCCAGGTTCCTGG - Intronic
1160832584 19:1110654-1110676 CTGGGTGGGCTCGGGGCTCGTGG - Intronic
1160867543 19:1262474-1262496 GTGGGGCTGCACCAGGCTCCTGG - Intronic
1160904468 19:1445938-1445960 CTGGGGGGGCCCGAGGCGGCGGG - Intergenic
1160970358 19:1765202-1765224 CTGGGGGGTCCCCAAGGTCCAGG - Intronic
1160981027 19:1816659-1816681 CTGGGAGGGCTCCCAGCTCGTGG + Intronic
1161033849 19:2073046-2073068 CTGGGTGGCTCCCAGGCTCCTGG - Exonic
1161065043 19:2233351-2233373 CTGGGGGCTCACCAGGCCCCTGG + Exonic
1161086841 19:2339386-2339408 CAGGGTGGGCTCCGGGCACCTGG + Intronic
1161241915 19:3227577-3227599 CTGGAGGTGCACCCGGCTCCTGG + Intronic
1161550328 19:4909220-4909242 CTGGGGGTCCCCAAGGCTCCTGG + Intronic
1161800657 19:6415425-6415447 GTGGGGGTGCTCCGGGCTGCTGG + Exonic
1161916323 19:7231064-7231086 CTGGTGTGGCTCCTGGCTCCTGG - Intronic
1161979014 19:7620936-7620958 CTGGGCGGGCTCCACGGCCCTGG + Exonic
1162535921 19:11262663-11262685 CTGGGCGGGCCCCAGACTCCCGG + Intergenic
1162535993 19:11262891-11262913 CTAGGTGGACCCCAGGCTCCCGG + Intergenic
1162744286 19:12790173-12790195 CTGGGCGGGCTCCAAGCACCCGG + Intronic
1162796895 19:13091744-13091766 CTGGGCTGGCACCAGGCTTCAGG + Intronic
1163151796 19:15419303-15419325 CTGGCGGGTCTCCAGGGTACGGG - Intergenic
1163175859 19:15563725-15563747 CTGGGGTGGCTCCAGGGAGCTGG + Intergenic
1163190441 19:15673201-15673223 CTGGGGTGGCTCCAAGATGCTGG + Intronic
1163202742 19:15780230-15780252 CTGGGGTGTCTCCAGGCTGCTGG - Intergenic
1163411257 19:17156161-17156183 GTTGGGGGGCTCTAGGATCCAGG + Intronic
1163419668 19:17206918-17206940 CTGGGAGGGGGCCAGGCTGCTGG + Intronic
1163667179 19:18608680-18608702 CTGGGAGGACTTCAGGCTTCTGG + Intronic
1163822126 19:19502063-19502085 CGGTGGGGGCGCGAGGCTCCCGG - Intronic
1165058568 19:33194279-33194301 CAGCGCGGCCTCCAGGCTCCGGG + Intronic
1165061137 19:33205768-33205790 CTGGGCGGCCTCCAGGCTCACGG - Exonic
1165129508 19:33622926-33622948 CTGGGGCGGCTCCAGGGGGCGGG + Intronic
1165242923 19:34481873-34481895 CGGGGCGGGCTCCGGGCTTCGGG + Exonic
1165348015 19:35261130-35261152 CTGGTGGGGCTCAGAGCTCCAGG + Intronic
1166052059 19:40266205-40266227 CTGGCCAGGCCCCAGGCTCCAGG - Intronic
1166214973 19:41328910-41328932 CTGGGAGGGCCCCAGGTCCCTGG + Intronic
1166353867 19:42215794-42215816 CTGGGAGGGGTTCAGGCTGCCGG - Intronic
1166416294 19:42596629-42596651 CTGGGAAGGCTCCAGGCTGGAGG + Intronic
1166995096 19:46716387-46716409 CCGGGTGGGCTCCAGGCGGCCGG - Exonic
1167036015 19:46995434-46995456 ATGGGGGGCCTCCAGGGTGCTGG - Intronic
1167093018 19:47357784-47357806 CTGGGGAGGCTGCAGGCTGACGG - Intronic
1167102849 19:47414867-47414889 CTGGGGGGGCACCGGGGTACTGG + Intronic
1167498145 19:49831060-49831082 GTGGGGAGGCTCATGGCTCCAGG + Intronic
1167689137 19:50974940-50974962 CTGGGGGGGATCTGGACTCCTGG + Intergenic
1167712804 19:51122858-51122880 CTGAGGCAGCTCCAGGCCCCCGG - Intergenic
1167758210 19:51426525-51426547 CTGGGGCAGCTCCAGGACCCGGG + Intergenic
1168277429 19:55285363-55285385 CTGGAGGGGCTCCAGGGCCAGGG + Intronic
1168290636 19:55355330-55355352 CTGGGAGTGCTGCAGGCTGCAGG + Exonic
1168317047 19:55489011-55489033 CTGGTGGGGATCCAGGCTGTTGG + Exonic
1168596584 19:57682455-57682477 CTGGGGGGGATTCAGGAGCCTGG + Intronic
925019579 2:558073-558095 CTCGTGGGTCTCCAGCCTCCTGG + Intergenic
925171262 2:1751545-1751567 CGGGCAGGGCACCAGGCTCCTGG + Intergenic
925562526 2:5212639-5212661 CCTTGGGGGCTCCAGCCTCCTGG - Intergenic
926312679 2:11686010-11686032 CTGGGGGGTTTCCAGGCGGCTGG - Intronic
926593106 2:14760371-14760393 CTGGGGTCGCCTCAGGCTCCCGG - Intergenic
926914098 2:17877278-17877300 CTTGGTGGGCTCCAGGCCTCAGG + Intergenic
927697209 2:25246646-25246668 CTGGGGGGCTTCCAGCCTTCTGG - Exonic
927849026 2:26487345-26487367 CTGGGAGGGCACCAGGCTCAGGG + Intronic
930003550 2:46878878-46878900 CTGGGTGGGCTACAGGCTGTAGG + Intergenic
932104811 2:68932671-68932693 CTGGCCTGGCTCCAGGCACCAGG + Intergenic
932445450 2:71778119-71778141 CTTGGGCAGCTCCAGGCTCCAGG + Intergenic
932447948 2:71792077-71792099 CTGGGTGGGCTGGGGGCTCCAGG - Intergenic
932763813 2:74457820-74457842 CTGGGGGGGCCCGAGGGTCCTGG + Exonic
933692408 2:85189667-85189689 CTGGGAGGGCTCCAGCCCCGGGG - Intronic
934561112 2:95313732-95313754 CAGGGTGGGCTCCAGGCCTCAGG + Intronic
936011841 2:108930081-108930103 CTGAGAGCGCACCAGGCTCCAGG + Intronic
936015711 2:108957472-108957494 CTGGGGGGCCTCCATGAGCCCGG - Intronic
936521034 2:113212365-113212387 CTGGGGCGGCTCCGGGCGTCTGG + Intergenic
937119791 2:119433204-119433226 CTGGGGAGGCCACAGGCTCCAGG + Intronic
937326148 2:120990419-120990441 CTGGGGGGCCTCCAGGAGCTGGG - Exonic
937328146 2:121004596-121004618 GGGGGGGTGCCCCAGGCTCCAGG + Intergenic
937340782 2:121089138-121089160 CTGCCCGGGCTTCAGGCTCCAGG - Intergenic
937465655 2:122131146-122131168 CTGGGTGGTTTCCAGGTTCCTGG + Intergenic
937915534 2:127097084-127097106 CTGTGGGGACCCCTGGCTCCAGG - Intronic
937972900 2:127564312-127564334 CGGGGAGGGCTCCAGGGCCCTGG - Intronic
940259799 2:151767639-151767661 CTGAGGGGACTTCAGCCTCCAGG + Intergenic
944992443 2:205253539-205253561 CAGGGGAGGCTCCAGGCTGTGGG - Intronic
945225885 2:207530509-207530531 CCGGGGCGGCTCCGGGTTCCCGG - Intronic
946361727 2:219223016-219223038 CTGGGGGGGCACCAGTGCCCTGG - Intronic
947744936 2:232502599-232502621 CTGGGGGTGCTGCAGGCCCCAGG - Intergenic
947761028 2:232604161-232604183 CAGGGTGGGCTGGAGGCTCCAGG - Intergenic
948187279 2:236031428-236031450 CAAGGCTGGCTCCAGGCTCCTGG - Intronic
948208213 2:236173837-236173859 CCCGGGGGGTTCCAGCCTCCAGG - Intergenic
948323028 2:237086091-237086113 CTGGGGCGGCACCAGTTTCCAGG + Intronic
948367858 2:237470069-237470091 CTGGGGCTGCTCCAGCCCCCTGG - Intergenic
948822649 2:240557788-240557810 GCGGGGGGGCGCCAGGCTCGCGG - Intronic
948853800 2:240720891-240720913 GTGAGTGAGCTCCAGGCTCCCGG - Intronic
948902542 2:240963807-240963829 CTGGGTGGGCAGCAGGCTGCAGG - Intronic
948903661 2:240967972-240967994 CTGGGGCTGCCCCAGGGTCCCGG - Intronic
1168860724 20:1044317-1044339 GTGGAGGGGCTCCAGCCTCAGGG + Intergenic
1169123458 20:3110979-3111001 GTGAGGGGGCTGCAGGCTGCAGG - Intronic
1169266403 20:4169886-4169908 CTGGGGAGGCTCCAGACTTTTGG + Intronic
1169340208 20:4790586-4790608 CTGCAGGGGCTTCAGGCCCCTGG + Exonic
1169492654 20:6084135-6084157 CTGGTGCGCCTCCAGGATCCGGG + Exonic
1171457294 20:25279179-25279201 CTGCACGGGCTCCAGGCTCTGGG - Intronic
1171878356 20:30598636-30598658 CTTGTGTGGCTCCAGGCTCTGGG + Intergenic
1172786748 20:37473569-37473591 CAGGGAGGGCTCCTGACTCCTGG - Intergenic
1172915526 20:38440646-38440668 GTGAAGGGGCTCCAGGCCCCAGG - Intergenic
1173251379 20:41365939-41365961 CAGAGCGGGCTCCTGGCTCCGGG - Intronic
1174267926 20:49345354-49345376 TTGAGGAGGCTCCAGCCTCCTGG + Intergenic
1174306174 20:49615792-49615814 CTGGGGCGGCTCCTGGCTGCCGG - Intergenic
1174604875 20:51754096-51754118 CCTGTGGGGCTCCAGGCTCCAGG - Intronic
1175205753 20:57309898-57309920 CTGGTGGGGCTCCACGCAGCAGG + Intergenic
1175909615 20:62398541-62398563 CTGGGAACTCTCCAGGCTCCAGG + Intronic
1175959437 20:62627874-62627896 CTGGGGGTGTTCCTGCCTCCTGG - Intergenic
1176286574 21:5022106-5022128 CTGGGAGAGCGCCAGGCCCCTGG - Intergenic
1176293661 21:5059354-5059376 CTGGGGGAGATCCTGGCTCACGG + Intergenic
1176410648 21:6447874-6447896 GTGGGCAGGCTCCAGGCTCCAGG + Intergenic
1176707360 21:10126110-10126132 CCAGGTGGGCACCAGGCTCCAGG - Intergenic
1176741450 21:10607262-10607284 CTAGTGGGGCTCTTGGCTCCTGG - Intergenic
1177156591 21:17507102-17507124 CGGGCGGGGTTCCAGGCTCTAGG - Intergenic
1177905410 21:26966840-26966862 CTGTGGAGGTTCCAAGCTCCGGG + Intergenic
1178534847 21:33403197-33403219 CCCGCGGGGCTCCAGTCTCCAGG + Exonic
1178749415 21:35286262-35286284 CTGGGGGGGCCCCAAGCCCAAGG - Intronic
1179170426 21:38968831-38968853 CTGGGGGACCTCTGGGCTCCAGG + Intergenic
1179464508 21:41562706-41562728 CTAGGTGGACTCCAGGCTACAGG - Intergenic
1179686142 21:43056196-43056218 GTGGGCAGGCTCCAGGCTCCAGG + Intronic
1179717679 21:43298142-43298164 CTGAGGGGACTGCAGGCTCCAGG + Intergenic
1179828390 21:43981309-43981331 CGTGGGGGGATCCTGGCTCCAGG - Intronic
1179863599 21:44204294-44204316 CTGGGGGAGATCCTGGCTCACGG - Intergenic
1179870607 21:44241369-44241391 CTGGGAGAGCGCCAGGCCCCTGG + Intergenic
1179886451 21:44316159-44316181 CAGGGAGGGCTCCTGGCACCCGG + Intronic
1179950868 21:44708195-44708217 CAGGGGGGACTGCAGGCTCCTGG + Intronic
1179996815 21:44977946-44977968 CTCTGGGGCCTCCTGGCTCCAGG + Intergenic
1180000141 21:44991794-44991816 CAGCAGGGGCTCCAGGGTCCGGG + Intergenic
1180159519 21:45992824-45992846 CTGGGGTGGTTCCCAGCTCCAGG - Intronic
1180706586 22:17814099-17814121 CTGGAGTGGCCCCAGGATCCTGG + Intronic
1180833716 22:18919397-18919419 CTGTGGGGTCTCCAAGCCCCAGG + Intronic
1180927981 22:19569261-19569283 AGGAGGAGGCTCCAGGCTCCAGG - Intergenic
1181044435 22:20207857-20207879 CTGTGGGGCCTCCATGCCCCAGG + Intergenic
1181256719 22:21567678-21567700 GTGCGGGGGCTCCAGCCGCCCGG + Intronic
1181340680 22:22177202-22177224 CTGGTGGGGCTGCAAGGTCCAGG + Intergenic
1181630431 22:24148313-24148335 CTGGGGTAGCCCCAGGCTCTTGG - Intronic
1181968626 22:26673440-26673462 GTCTGGGGGTTCCAGGCTCCTGG + Intergenic
1182260938 22:29072948-29072970 CCGGGCGGGCCCCAGGCTGCAGG + Intergenic
1182349477 22:29691188-29691210 CTGGGGGGACTCCACTCCCCAGG + Intronic
1182358359 22:29732924-29732946 CTGGGTGGCCTCCTGGCACCAGG - Intronic
1182361373 22:29748385-29748407 CTGGCTGGGGGCCAGGCTCCTGG - Intronic
1183227726 22:36561916-36561938 CTGGGAGGGCTCAAGGCTGAGGG - Intergenic
1183425862 22:37739129-37739151 CTGGAGGGTCTCCAGGGTCCTGG + Intronic
1183508795 22:38223314-38223336 TTGGGGTGGCCCCAGGCCCCAGG + Intronic
1183631701 22:39037084-39037106 CTGGGGGGCTTCCAGGCTACAGG + Intergenic
1183637585 22:39073917-39073939 TTGGGGGGCTTCCAGGCTACAGG + Intronic
1183677881 22:39309925-39309947 CTGGGGTGGGACAAGGCTCCTGG - Intergenic
1184090293 22:42289772-42289794 CGGGGCAGGCTGCAGGCTCCTGG - Intronic
1184341679 22:43889649-43889671 CTGGGGGGCGTTCAGCCTCCTGG - Intronic
1184458350 22:44623994-44624016 CTGGGGGGGTCCCAGGCTATGGG + Intergenic
1184630075 22:45770569-45770591 CTGGGAGGACTCCAGAGTCCAGG - Intronic
1184663562 22:45976372-45976394 CTGTTTGGGCTCCAGGCCCCGGG - Intronic
1184760798 22:46542907-46542929 CTGGGAGGGCTGCTGACTCCAGG + Intergenic
1184796901 22:46738062-46738084 CCGCGCGGGCTCCAGGCTCACGG + Exonic
1184837615 22:47033212-47033234 CTGAGGGGGCTCCACCATCCAGG - Intronic
1184837762 22:47034007-47034029 CTGCGGGGGCTTCAGCCTCAGGG + Intronic
1185012673 22:48324023-48324045 CTGTGGGTGCTGCAGGCTGCAGG - Intergenic
1185071861 22:48661046-48661068 GTGTGGGGTCTCCAGGCCCCAGG + Intronic
1185114307 22:48922762-48922784 GTGCTGGGGCTGCAGGCTCCGGG - Intergenic
1185119134 22:48955345-48955367 TCGGGAGGGCTCCAGGCTCCAGG + Intergenic
1185279044 22:49962178-49962200 CGCGGGGGCCTCCAGGCTCCCGG - Intronic
1185287889 22:50010650-50010672 CTGGGTGGGCTTCAGAGTCCAGG - Intronic
1203283802 22_KI270734v1_random:144695-144717 CTGTGGGGTCTCCAAGCCCCAGG + Intergenic
949495646 3:4629133-4629155 CTGTGGGGGCAGCAGGGTCCAGG - Intronic
950621325 3:14207832-14207854 CTGGGTGGGCTCCTGCCACCAGG - Intergenic
950673498 3:14540830-14540852 CTGGAGGGTCTCCAAGCTCAAGG - Intronic
950965201 3:17141267-17141289 GTGGGGGCCCTCCAGGCTCTGGG - Intergenic
951208218 3:19946854-19946876 CTGGGGGGTCTCTGGGCTCCTGG - Intronic
952825033 3:37517623-37517645 CTGGAGGGGCTCCGTGCACCAGG - Intronic
952885654 3:38009753-38009775 CTCGGGGGGCTCCTGCCCCCTGG - Exonic
952906649 3:38143594-38143616 CTGGGGAGGCTACAGCATCCAGG - Intergenic
953449218 3:42992151-42992173 CTGGAGAGGCTCCTGGCTCCTGG + Intronic
953453148 3:43020709-43020731 CTGGGTTGGCTCCAGGCTGGAGG + Intronic
953810385 3:46107775-46107797 CTGAGGTTGCTGCAGGCTCCAGG + Intergenic
953841620 3:46394340-46394362 CAGGGGCTGCTACAGGCTCCTGG + Intergenic
953845855 3:46425702-46425724 GATGGGGGGCTCCAGGCTTCAGG - Intergenic
953876471 3:46669625-46669647 CTGGGGGTGTCACAGGCTCCTGG + Exonic
953975240 3:47377270-47377292 CTGGCGAGGCTCCAGGATTCAGG - Intergenic
954300566 3:49698849-49698871 CTGGGGAGGCCCCAGGGGCCAGG - Intronic
954379591 3:50212597-50212619 GTGTGGGGTCTCCAGGATCCAGG + Intronic
954649808 3:52154244-52154266 CGGGCGGGGCGCCAGGTTCCAGG - Intronic
955147621 3:56335885-56335907 GTGGGTGGGCTCCAGCCTTCAGG + Intronic
955281158 3:57596573-57596595 CCCGGGCGGCTCCAGGCTCCGGG + Intronic
955406155 3:58627016-58627038 CTGGGTGGGCTGCAGGGGCCAGG + Exonic
955996391 3:64684935-64684957 CTAGGGGCACTCCAGGCTCTGGG + Intronic
957255021 3:77825638-77825660 CTGAGGGGCTTCCAGGCTGCTGG + Intergenic
961490940 3:127256369-127256391 CAGGTGGGGCTCCAGGCCCTGGG - Intergenic
961514184 3:127422730-127422752 GTTGGGGGGGCCCAGGCTCCTGG - Intergenic
961528817 3:127526909-127526931 CAGGGGAGGGTCCAGCCTCCAGG + Intergenic
962552305 3:136507438-136507460 CTGGTGGGGGTCGAGGCTGCAGG - Intronic
962837061 3:139198828-139198850 CTGGAGGGGCACCAGGTTCAGGG + Intronic
966974375 3:185071602-185071624 CGGGGCGGACTCCAGGCCCCCGG + Intergenic
967558991 3:190896002-190896024 CTGTGGTGGCCCCAGGGTCCTGG - Intergenic
968323455 3:197791577-197791599 CCGGGGCGGCTCCCGGCGCCGGG - Intronic
968431379 4:561108-561130 CTGGGGGAGGTGCAGGCACCTGG + Intergenic
968506341 4:973027-973049 GTGGGGCCGCTCCAGGCTGCGGG - Intronic
968518120 4:1023369-1023391 CCGGGGGGTCTGCAGGCCCCGGG - Intronic
968542179 4:1173179-1173201 CTGGGGAAGCTCCTGGCTCCCGG + Intronic
968554439 4:1240123-1240145 CTGGGGGGACTCCTGGGTGCTGG + Intronic
968554495 4:1240288-1240310 CTGGGGGGACTCCCGGGTGCTGG + Intronic
968606817 4:1539410-1539432 CTGGGGGGGCTCCAGGCCCCTGG - Intergenic
968704045 4:2069873-2069895 CTGGGGGACCCCCAGACTCCAGG - Intergenic
968746799 4:2364588-2364610 CCGGGTGGGCTCCAGGTTCTTGG + Intronic
968844157 4:3030622-3030644 CTGGAGGGGCGGCAGGCTCTAGG + Intronic
968923103 4:3532695-3532717 TCGTGCGGGCTCCAGGCTCCGGG - Intergenic
969306271 4:6327844-6327866 CTGGGGGAGCTCCAGGATGTTGG + Intronic
969307035 4:6331777-6331799 GTGGGGGGGCTCCATGACCCCGG - Intronic
969475745 4:7421704-7421726 CAGCGGGGGCTCCAGACCCCAGG - Intronic
969525461 4:7701877-7701899 CTGGGGGTACCCCAGGCTCCAGG - Intronic
969530628 4:7728470-7728492 CTGGGGAGGCTCTAGGCTCTGGG - Intronic
972826857 4:42768496-42768518 CTGGGGAGCTACCAGGCTCCAGG - Intergenic
974801286 4:66822631-66822653 TTGGGGTGGGTCCAGGGTCCAGG + Intergenic
976860292 4:89657372-89657394 CTGTGGGGGCTGCAGACCCCAGG + Intergenic
977162934 4:93658962-93658984 CTGGGGAGACTCCAGGGCCCTGG + Intronic
977845211 4:101759684-101759706 CTGGTGGGCCTCCAGGATCATGG + Intronic
983334896 4:166379050-166379072 CTCCCGGGGCACCAGGCTCCAGG - Intergenic
984961116 4:185099613-185099635 GTGCTGGGGCTCCAGGCTCCAGG - Intergenic
984973588 4:185210431-185210453 CGCGGCGGGCTCCGGGCTCCGGG + Intronic
985275151 4:188231095-188231117 CTGGGCTAGCTCCAGGCCCCAGG + Intergenic
985705043 5:1395582-1395604 CTGTGGCTGCTCCAGGCCCCCGG - Intronic
985713227 5:1441987-1442009 CTGGAGGGGCTCCCAGCACCTGG - Intronic
985818284 5:2142842-2142864 CTTGGGGAGCTCCAGCTTCCGGG + Intergenic
985860372 5:2466013-2466035 CTGGGAGGTCTCCAGGCAGCAGG - Intergenic
986063281 5:4212016-4212038 GTGGGGGGGATTCAGGCTCAGGG - Intergenic
986171710 5:5319696-5319718 CGGCGGTGGCTCCAGGTTCCTGG - Exonic
986552508 5:8974210-8974232 CTGGGAGAGCCCCAGGCTCCTGG + Intergenic
987308943 5:16664462-16664484 CTGGCGGGGCCACAGGCTTCAGG + Intronic
991507126 5:67337079-67337101 CAAAGGGGGCTGCAGGCTCCTGG - Intergenic
997295059 5:132763947-132763969 CTTGGGGGGCTCAGGGCTCGGGG + Intronic
997658954 5:135575648-135575670 CTGTGGGGGCTCCAGCCTGGAGG + Intronic
999062936 5:148654549-148654571 CTGGGCTGACTGCAGGCTCCTGG + Intronic
999248801 5:150169401-150169423 CTGGGGGTTCCCAAGGCTCCAGG + Intronic
999748302 5:154608612-154608634 CAGGGGCTGCTCCAGGCCCCCGG + Intergenic
1001051064 5:168414667-168414689 ATGAGGGGGCTCCGGGCCCCTGG + Intronic
1001652858 5:173327941-173327963 CTGGGTGGGCGCCTGGCTCCCGG + Intronic
1002079289 5:176727999-176728021 GTGGGGGTGCTCCTGGCTCCAGG + Intergenic
1002795948 6:471103-471125 CCGGCGGGGCTCGAGGCTGCAGG + Intergenic
1003886840 6:10529394-10529416 TGGGGGGATCTCCAGGCTCCAGG + Exonic
1004732008 6:18367450-18367472 CTGTGGAGGCTCCAAGTTCCAGG + Intergenic
1005328959 6:24730875-24730897 CTGGGGGGGCTTCAGAATCATGG - Intergenic
1006173504 6:32108696-32108718 CTCTGGGGGCTCCAGGCTCCAGG - Intronic
1006634589 6:35452675-35452697 CTGGGGGTGCTCCGGGCGCTGGG + Exonic
1006805836 6:36788417-36788439 CCGTGAGGGCTCGAGGCTCCAGG + Intronic
1006806385 6:36792294-36792316 GTGGGGCAGCTCCAGGCTCGGGG - Intronic
1006921117 6:37627823-37627845 TTGGGGGGGTTCCAGGGACCTGG + Intergenic
1010289386 6:74117486-74117508 CTGGGAGGCCTGCTGGCTCCAGG + Intergenic
1011194335 6:84766395-84766417 CTAGTGGGTCTCCAAGCTCCGGG + Intergenic
1012393499 6:98769737-98769759 CTGGGGGAGCTCCAGGGACAAGG + Intergenic
1013536348 6:111066482-111066504 CTGGGGAGGCTCCAGGAAGCAGG - Intergenic
1015626039 6:135181583-135181605 CGCGCGGGGCGCCAGGCTCCCGG + Intronic
1016683720 6:146858079-146858101 CTGGTGGGGCTCCTTGCTGCAGG - Intergenic
1017717261 6:157221894-157221916 CTGGGGGGACTGCGGGCGCCTGG - Intergenic
1018135106 6:160771565-160771587 CTTGGGGAGCCCCAGGCCCCTGG - Intergenic
1018151173 6:160940712-160940734 CTGTGGGAGCTCTAGGATCCAGG - Intergenic
1018391798 6:163346617-163346639 TTGGCGGGGCTCCAGGCCTCTGG - Intergenic
1019163276 6:170083042-170083064 GTGGGGGGGGTCCAGGCTGGTGG - Intergenic
1019274374 7:168163-168185 GTGGGGGAGCTCCAGGCTGCCGG + Intergenic
1019313382 7:373622-373644 ATGGTGGGGAACCAGGCTCCAGG - Intergenic
1019348716 7:543231-543253 CAGGGGTGGCTCCGGGATCCTGG - Intergenic
1019492816 7:1323083-1323105 CTGCGATGGCTGCAGGCTCCGGG - Intergenic
1019761454 7:2815701-2815723 CACGGGGAGCACCAGGCTCCAGG - Intronic
1019913506 7:4116071-4116093 CTTGGGGGGCCCAGGGCTCCCGG + Intronic
1020010647 7:4804078-4804100 CTGGGGGAGCTCCAGTTACCCGG - Intronic
1020112729 7:5456562-5456584 GTGGGGGGGCTCCAGGCAGAGGG + Intronic
1020256022 7:6503599-6503621 ATGTGCGGGCTCCAGGCGCCGGG + Exonic
1022468112 7:30665018-30665040 CCTGGGGGGCTCTGGGCTCCGGG - Intronic
1022701257 7:32762286-32762308 CTGGGGGTGCTGCAGGCGCTGGG - Intergenic
1024210622 7:47200352-47200374 CTGGGAGGGCTGTAGGCACCTGG - Intergenic
1024256887 7:47546059-47546081 TGGGGGAGGCTCCAGGCTACAGG - Intronic
1025634916 7:63313635-63313657 CTGGTGGGACTCCAGGCTCTGGG - Intergenic
1025647779 7:63434535-63434557 CTGGTGGGACTCCAGGCTCTGGG + Intergenic
1026304917 7:69132401-69132423 CTCAGGGGGCTGCAGGCACCAGG - Intergenic
1026939577 7:74279552-74279574 CTGGGTGGGCTCCAGGGGCCTGG + Intergenic
1027256084 7:76431545-76431567 CTGGTGTGGGTCCAGGCTCTCGG + Intronic
1028373295 7:90119016-90119038 CTGGGGGTGCTGCAGGCGCTGGG + Intergenic
1028923421 7:96331232-96331254 CTGATGGGGCTCCAGGCTGAGGG - Intergenic
1029111908 7:98217052-98217074 CCCGGAGGGCTCCAGGTTCCCGG + Exonic
1029367616 7:100126875-100126897 CTGGCTGGGCTCCAGCCTCCTGG - Exonic
1029481005 7:100812952-100812974 CGGGGGCGGCTCAAGGCCCCAGG - Exonic
1029739516 7:102483535-102483557 CTGGGGGGGCTCCGAGCGCTTGG + Exonic
1029757517 7:102582714-102582736 CTGGGGGGGCTCCGAGCGCTTGG + Exonic
1029775455 7:102681775-102681797 CTGGGGGGGCTCCGAGCGCTTGG + Intergenic
1034089794 7:148353097-148353119 CTGCCGGGGCTCCAGGACCCAGG - Intronic
1034632826 7:152543951-152543973 CTGGGGGGCCTCTGGGCTCTGGG + Intergenic
1035080261 7:156209786-156209808 CTGGGGTGGATCCAGGACCCTGG - Intergenic
1035396803 7:158540227-158540249 CTTGGTGGGCCCGAGGCTCCTGG - Intronic
1035470077 7:159104205-159104227 CAGGCTGGGCTCCTGGCTCCAGG - Intronic
1036676689 8:10839807-10839829 CTGGGCGGGCTGGAGACTCCAGG + Exonic
1037481899 8:19313570-19313592 CTGGAGAGCCTCCAGGCGCCCGG + Intergenic
1037914018 8:22761115-22761137 CTGGGGAGGCTCCAGGCTTTGGG - Intronic
1038711766 8:29953451-29953473 CTGGTGGGTTTCCAGGCACCTGG + Intergenic
1039079763 8:33722902-33722924 CTGAGGGGGCTCCCGGGTGCCGG + Intergenic
1039618205 8:38974055-38974077 CTGGGGGAGAACCTGGCTCCGGG + Intergenic
1041191957 8:55363784-55363806 CTGTGAGGGGTCTAGGCTCCAGG + Intronic
1042040535 8:64584488-64584510 CTGGGAGGGCTCCAGCTTCAAGG - Intergenic
1047177546 8:122555785-122555807 CTGGAGGAGATCAAGGCTCCAGG + Intergenic
1047181043 8:122588420-122588442 CTGGGGGGGCCTCAGGCTTCAGG - Intergenic
1047764665 8:127980640-127980662 CTGGGGAAGTTCCAGGCTCCTGG - Intergenic
1048306264 8:133286864-133286886 CTGTGGGGGCTGCAGGCCTCGGG + Intronic
1048952430 8:139507579-139507601 CTGGGAGGGGTCCAAGCTCAGGG - Intergenic
1049214012 8:141399430-141399452 CTGGGGGTGCCCGGGGCTCCCGG + Intronic
1049309329 8:141925009-141925031 GTGGGCGGGCCCCAGGCTGCAGG - Intergenic
1049425572 8:142536524-142536546 CTGGGGAGGGGCCAGGCTCAGGG + Intronic
1049427248 8:142542972-142542994 CTGGGTCAGCTGCAGGCTCCAGG - Intronic
1049449859 8:142654804-142654826 CTGGGGCAGCTCAAGGCTCTTGG - Intergenic
1049595984 8:143483584-143483606 CTAGGCGGGCTCCCGGCTCCTGG + Intronic
1049645092 8:143732602-143732624 CTGGGAGGGCTCCTGGCCACGGG - Intronic
1049675640 8:143887695-143887717 CTCGGGGGGCTCCAAGCCCCTGG + Intergenic
1050345263 9:4679789-4679811 CGAGGGAGGCTCCAGGGTCCCGG - Exonic
1052170893 9:25395096-25395118 CTGTGGGGGCCACAGGCTCTTGG + Intergenic
1053142244 9:35689502-35689524 CTGGGGAAGCCCCAGGCCCCTGG - Intronic
1053296927 9:36922013-36922035 CTGGGTGCACTCCAGGCTCTTGG + Intronic
1053520132 9:38769079-38769101 CTGGGGAGGCCCCAGGCTGTGGG - Intergenic
1053644548 9:40112830-40112852 CCAGGTGGGCACCAGGCTCCAGG - Intergenic
1053761434 9:41352021-41352043 CCAGGTGGGCACCAGGCTCCAGG + Intergenic
1054325571 9:63710710-63710732 CCAGGTGGGCACCAGGCTCCAGG - Intergenic
1054350206 9:64013566-64013588 CCAGGTGGGCACCAGGCTCCAGG + Intergenic
1054356398 9:64067239-64067261 CTGGGGGGGCTACAGCCCCGAGG - Intergenic
1054540027 9:66263139-66263161 CCAGGTGGGCACCAGGCTCCAGG + Intergenic
1056299935 9:85230371-85230393 CTGGGTTTGCTCCAGGCTGCTGG - Intergenic
1057486261 9:95486861-95486883 GTGGGGGAGCTCTAGGTTCCTGG - Intronic
1058581891 9:106467443-106467465 GGGAGGGGGCTCCAAGCTCCAGG - Intergenic
1059104727 9:111501560-111501582 CTGGAGGGGGTCAAGGCTGCAGG - Intergenic
1059346352 9:113631610-113631632 CTGGAGGGGTCTCAGGCTCCGGG + Intergenic
1060055468 9:120409246-120409268 CTGAAGGTGCTCCAGGCTCACGG + Exonic
1060593729 9:124835319-124835341 CTGGCGGGGAGCCAGGCTACAGG - Intergenic
1060965770 9:127711628-127711650 CTGTGGGGGCTGCAGGGTGCTGG + Intronic
1061088336 9:128412165-128412187 CTGGGGGTGCCCCAGGGCCCAGG - Intronic
1061318587 9:129813791-129813813 CTGGGTGGCCTGCAGGCACCAGG + Exonic
1061407063 9:130398341-130398363 CTGAGGGGGTGCCAGGCTCAGGG + Intronic
1061490010 9:130939427-130939449 CTGTGGGGTCTCCAGCCCCCGGG + Intergenic
1061609880 9:131739548-131739570 CTGCGGGGGCGCCAGGGGCCGGG - Intronic
1061742675 9:132718555-132718577 GTGGGGGGCCTCCAGGCTATAGG - Intergenic
1061860707 9:133467357-133467379 ATGGGAGGGCTGCAGGCTGCGGG - Intronic
1061893389 9:133634477-133634499 CTGGGTGGCCACCAGGCTGCTGG + Intergenic
1062142395 9:134966840-134966862 ATGGGTGAGCTGCAGGCTCCAGG - Intergenic
1062234503 9:135501400-135501422 CTGGGCGAGCTCGGGGCTCCGGG - Intronic
1062381699 9:136290018-136290040 CACTGGGGACTCCAGGCTCCCGG + Exonic
1062460390 9:136660365-136660387 CTGTGGTGGCTCCAGGCTATGGG + Intronic
1062506000 9:136876875-136876897 CTGGGGGCCCTCCAGCCTCAGGG - Intronic
1062520140 9:136954376-136954398 CTCAGGGGTCTCCAGGCTCCTGG + Intronic
1062733262 9:138120857-138120879 GTGGGTGGGGTCCCGGCTCCTGG - Exonic
1202792107 9_KI270719v1_random:94990-95012 CCAGGTGGGCACCAGGCTCCAGG - Intergenic
1203770488 EBV:47633-47655 GCGGGGGTTCTCCAGGCTCCTGG + Intergenic
1185449502 X:275054-275076 CTGCGGGGACACCAGCCTCCTGG - Intergenic
1186739054 X:12497966-12497988 CTGGGTGGGCACCAGGCTGGGGG + Intronic
1187303449 X:18073934-18073956 CTCAGGGGGCTCCAGGTGCCAGG + Intergenic
1187806764 X:23129207-23129229 GGGGTGGGGCTCCAGGCTCCAGG - Intergenic
1189310445 X:40014142-40014164 CCTGGGGAGCTCCAGTCTCCAGG + Intergenic
1192237597 X:69305923-69305945 GGGAGGGGGCTCCAGGCCCCAGG + Intergenic
1197772481 X:130098089-130098111 TCAGGGGGGCTCCAGGCTGCGGG - Intronic
1202599778 Y:26581493-26581515 CTAGTGGGGCTCTTGGCTCCTGG - Intergenic