ID: 1077217788

View in Genome Browser
Species Human (GRCh38)
Location 11:1402231-1402253
Sequence CAGGCACAGCAGGCTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 0, 2: 8, 3: 57, 4: 454}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077217782_1077217788 -10 Left 1077217782 11:1402218-1402240 CCCCGGGGCGGGGCAGGCACAGC 0: 1
1: 0
2: 2
3: 52
4: 288
Right 1077217788 11:1402231-1402253 CAGGCACAGCAGGCTGTGGTGGG 0: 1
1: 0
2: 8
3: 57
4: 454
1077217768_1077217788 25 Left 1077217768 11:1402183-1402205 CCTTGCGCTCTCCAGAGGCGGTG 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1077217788 11:1402231-1402253 CAGGCACAGCAGGCTGTGGTGGG 0: 1
1: 0
2: 8
3: 57
4: 454
1077217774_1077217788 14 Left 1077217774 11:1402194-1402216 CCAGAGGCGGTGGGTGTCGGGGC 0: 1
1: 0
2: 1
3: 15
4: 195
Right 1077217788 11:1402231-1402253 CAGGCACAGCAGGCTGTGGTGGG 0: 1
1: 0
2: 8
3: 57
4: 454
1077217765_1077217788 30 Left 1077217765 11:1402178-1402200 CCTGACCTTGCGCTCTCCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 148
Right 1077217788 11:1402231-1402253 CAGGCACAGCAGGCTGTGGTGGG 0: 1
1: 0
2: 8
3: 57
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077217788 Original CRISPR CAGGCACAGCAGGCTGTGGT GGG Intronic
900393958 1:2445535-2445557 CTGGCAGAGCTGGCTGTGGGTGG + Intronic
900395391 1:2451233-2451255 CAGCCAAGGCAGGCGGTGGTGGG + Intronic
900422561 1:2561936-2561958 CAGCCACTGCAGGCTGGGGCAGG + Intronic
902718123 1:18286686-18286708 CAGGCACAGCAGGCTGTCCTGGG + Intronic
903477680 1:23631050-23631072 CAGACTCAGGAGGCTGAGGTGGG + Intronic
904372308 1:30057441-30057463 CCGCCACAGCAGTCTGTGGGGGG - Intergenic
904462255 1:30687023-30687045 CAGGCAAAGGAGGCTGAGGAGGG - Intergenic
904509984 1:30996878-30996900 CAGGCACTGCAGTCAGTGCTAGG - Intronic
904928859 1:34070383-34070405 CAGCCACAGGAGCCTGTGGAGGG - Intronic
905136515 1:35804680-35804702 CAGCCACAGCAGGAAGTGGAGGG + Intergenic
905694535 1:39965135-39965157 GAGGCACAGCAGACTGGGCTGGG + Intronic
906125820 1:43426407-43426429 CAGGCACAGCACCATGTCGTTGG - Intronic
906479543 1:46191104-46191126 CAGGCCCTGCAGGAGGTGGTGGG + Intronic
906888661 1:49682290-49682312 CAGGTACAGGAGGCTGAGGCAGG + Intronic
906988568 1:50713046-50713068 CAGCTACAGGAGGCTGAGGTGGG + Intronic
907328131 1:53654015-53654037 CAGACACAGGAGGCTGTGAGAGG + Intronic
907458129 1:54588813-54588835 TGGGCAGAGGAGGCTGTGGTTGG + Intronic
907472895 1:54685824-54685846 GAGGCACAGCACGCTATAGTTGG + Intronic
908375974 1:63541674-63541696 CAGCCTCAGGAGGCTGAGGTAGG - Intronic
908460914 1:64347775-64347797 CAGGCACGGAAGGCTGAGGAAGG + Intergenic
912234101 1:107830274-107830296 CAGGAACTGGAGGCTGTAGTGGG - Intronic
912244222 1:107943996-107944018 CAGGCACAGCTGTTTGTGATGGG - Intronic
912465076 1:109866829-109866851 CAGACTCAGCAGGGTCTGGTAGG + Intergenic
913089946 1:115469833-115469855 GAGCCCCAGCAGGCTGTGGTGGG + Intergenic
914048776 1:144114375-144114397 CGGGCAGAGCTGGCTGTGGCTGG - Intergenic
914130408 1:144851073-144851095 CGGGCAGAGCTGGCTGTGGCTGG + Intergenic
914450162 1:147784540-147784562 GAGGCACAGCTGGCTGTTCTGGG - Intergenic
915281951 1:154829023-154829045 CAGGCTCAGCAGGTTGGGGTTGG - Intronic
916717964 1:167461048-167461070 CAGGCACGGCAGGCTTTGTGGGG - Intronic
918190574 1:182170180-182170202 CAGCTACAGGAGGCTGAGGTGGG + Intergenic
919741560 1:200984138-200984160 GAGGCACAGCAGGCAGGGGCTGG + Intronic
920183747 1:204148074-204148096 AAGCCTCAGCAGGCTGAGGTTGG + Intronic
921404829 1:214767241-214767263 CAGGCTCAGCAGCCTGTTGGAGG + Intergenic
922675761 1:227547941-227547963 AGAGCCCAGCAGGCTGTGGTGGG - Intergenic
923018341 1:230144126-230144148 GAGGCAGAGCAGGTTGGGGTAGG + Intronic
923058580 1:230449109-230449131 GAGGCACAGCAGGGTGAGGAGGG - Intergenic
923800777 1:237206154-237206176 CAGGCCCTGCAGACTGTGGCTGG - Intronic
923965923 1:239139018-239139040 CAAGCACAGGATGTTGTGGTGGG + Intergenic
924454086 1:244204226-244204248 CAGGCAGGGCAGGCTGCTGTAGG - Intergenic
1062956657 10:1544559-1544581 CGGGCACAGCAGGTGGTGGCAGG + Intronic
1062971688 10:1653600-1653622 CAGGCACAGAAGGCGTTGGGTGG - Intronic
1064001065 10:11664230-11664252 CAGGCAGAGAAGGCTGCGGTGGG + Intergenic
1065571347 10:27073305-27073327 CACGCACATCATGCTGTCGTGGG - Intronic
1067024971 10:42836899-42836921 CAGGCACAGCAGGGGGTAGAGGG - Intergenic
1067385810 10:45817175-45817197 AAGGTACAGCTGGCTGAGGTCGG - Exonic
1067449241 10:46371199-46371221 AAGGTACAGCCGGCTGAGGTCGG + Exonic
1067588129 10:47489566-47489588 AAGGTACAGCCGGCTGAGGTCGG - Exonic
1067635254 10:47997657-47997679 AAGGTACAGCCGGCTGAGGTCGG - Intergenic
1067691528 10:48505011-48505033 CAGAGAAAGCAGGGTGTGGTGGG - Intronic
1067746207 10:48938458-48938480 CTGGCAGAGCAGCCTGTGGCTGG - Intronic
1067746451 10:48940053-48940075 CAAGAGCAGCAGGCTGTGGCAGG + Intronic
1069604116 10:69729184-69729206 CCGGTACAGCAGGCTCCGGTGGG + Intergenic
1069694097 10:70374164-70374186 CAGGCACTCCAGGCAGTGGCAGG - Intronic
1069867810 10:71514474-71514496 CAGGAACAGCAGGGAGTGGGAGG + Intronic
1070307411 10:75247931-75247953 AAGGCACAGGAGGCTTTGGCTGG - Intergenic
1070353500 10:75616146-75616168 CAGGCAAGGCAGGCTGTGCAGGG + Intronic
1070551748 10:77495697-77495719 CAGGCACAGCCTGCCGTGCTGGG + Intronic
1070668650 10:78362896-78362918 CAGGCCCAGCAGGCTGTCTATGG - Intergenic
1071098482 10:82008043-82008065 CAGGCACAGCTGGTTTTGGGGGG + Intronic
1071609861 10:87022374-87022396 AAGGTACAGCTGGCTGAGGTCGG + Exonic
1072736609 10:97883419-97883441 CAGAGACAGCAGCCTGGGGTGGG + Intronic
1073198724 10:101717301-101717323 CAGCTACAGGAGGCTGTGGTGGG - Intergenic
1073316519 10:102585016-102585038 CAGGCACAGCAGCCTGGCCTGGG - Intronic
1073890489 10:108096061-108096083 TTGGCCCAGCAGGCTGTGCTTGG + Intergenic
1074101448 10:110357618-110357640 CAGGCAAACCAGCCTGTGGGAGG - Intergenic
1075188570 10:120285464-120285486 CAGTCAGAGGAGGCTTTGGTGGG - Intergenic
1075674924 10:124289766-124289788 CGGTCACAGCAGGGTGTGGAGGG - Intergenic
1076696206 10:132248574-132248596 CGGGCACAGGAGCCCGTGGTCGG + Intronic
1076769725 10:132656438-132656460 CAGGCACAGCTGGCGGGGGCAGG - Intronic
1076811778 10:132890154-132890176 CGGGCAGAGGAGGCTGTGGAGGG - Intronic
1076811795 10:132890221-132890243 CGGGCAGAGGAGGCTGTGGAGGG - Intronic
1076823264 10:132952608-132952630 CAGGTACTGCAGGGTGTGGCAGG + Intergenic
1077217788 11:1402231-1402253 CAGGCACAGCAGGCTGTGGTGGG + Intronic
1077368749 11:2171901-2171923 CAGGCACAGCAGGCAGGGGTGGG - Intergenic
1078742446 11:14079928-14079950 CAGGCACAGCAGTCTAAGATGGG - Exonic
1080634969 11:34115847-34115869 GAGGCCCATCAGGATGTGGTGGG + Exonic
1081396906 11:42596857-42596879 CAGCAACAGAAGGCTGGGGTGGG + Intergenic
1082627407 11:55501827-55501849 CAGCTGCAGCAGGCTGTGATGGG + Intergenic
1083625438 11:64069686-64069708 CAGGCAGAGCAGGCGGTGGTGGG + Intronic
1083682938 11:64359558-64359580 CAGGCAAGGCAGGCTGTGCCGGG - Intronic
1083745997 11:64736759-64736781 CAGGCTCAGCAGGTCGGGGTTGG + Exonic
1084124601 11:67090844-67090866 CAGTCCCAGGAGGCTGAGGTGGG + Intergenic
1084198383 11:67539385-67539407 CAAGTCCAGCAGGTTGTGGTCGG - Intergenic
1084604549 11:70164927-70164949 CAAGCACAGCAGCCTGTAGGCGG + Intronic
1084873472 11:72113368-72113390 CAGGCACAGCATTCTGTTGCTGG + Intergenic
1085041746 11:73330920-73330942 CTGGCACAGCAGGTGGGGGTGGG + Intronic
1085475413 11:76785733-76785755 CAGGCACAGCAGGGTGCGGTTGG + Intronic
1086850370 11:91800447-91800469 TTGGCCCAGCAGGCTGTGCTTGG - Intergenic
1087442699 11:98207182-98207204 GCGGCCCAGCAAGCTGTGGTTGG + Intergenic
1090254676 11:125275161-125275183 AAGGTAAAGCAGGCTCTGGTGGG + Intronic
1090909508 11:131106168-131106190 CAGGCTCAGCACACTGTAGTTGG + Intergenic
1091454517 12:596808-596830 CAGCTACAGGAGGCTGAGGTGGG + Intronic
1091649421 12:2298839-2298861 CAGGCACAGAAGGGTGGGCTGGG - Intronic
1091669862 12:2445245-2445267 CAAGCACAGCTGGCTATGGATGG - Intronic
1091829200 12:3537603-3537625 CAGGCAGAGCAGGTTGGGGTGGG - Intronic
1092834352 12:12473328-12473350 CAGCCTCAGCAGGCTATTGTTGG - Intergenic
1093402918 12:18768187-18768209 CAAGTACAGCAGGTTGTGTTAGG - Intergenic
1093473072 12:19525599-19525621 AAGGCACAGGAGGCTGAGGCAGG - Intronic
1096209053 12:49748357-49748379 CAGGGACAGCAGGGGCTGGTAGG - Intronic
1096483349 12:51958394-51958416 CAAGCACATCAGGCCGAGGTGGG + Intronic
1096627918 12:52906577-52906599 CAGGCAGGGCATGCTGTGGGTGG + Intronic
1098339575 12:69438020-69438042 CAGGTACAGGAGGCTGAGGCAGG + Intergenic
1101642908 12:106601362-106601384 CAGGGACAGGAGACTGGGGTGGG + Intronic
1101985283 12:109441295-109441317 AAGGGACAGCAGGCTGAGTTTGG + Intronic
1102035469 12:109768522-109768544 CTGGTACAGGAGGCTGTGGATGG - Exonic
1102366643 12:112342343-112342365 CAGGCTCAGGAGGCTGAGGTGGG + Intronic
1102677772 12:114669642-114669664 CAGGGACTGCAGGCTGTGTGGGG + Intergenic
1103154655 12:118674226-118674248 CAGGCCTTGCTGGCTGTGGTGGG + Intergenic
1103739722 12:123083104-123083126 CAGCTACAGGAGGCTGTGGTGGG + Intronic
1103781588 12:123402385-123402407 CAGGCGCTGCAGTCTGTGCTGGG - Intronic
1103916714 12:124379554-124379576 CCGTCACACCAGGCTGTGGTGGG - Intronic
1103948086 12:124538151-124538173 CAGGCTGAGCTGGCTGGGGTTGG - Intronic
1104421893 12:128642840-128642862 CAGAAGCAGCAGGCTGTGGTTGG + Intronic
1104713018 12:130998060-130998082 CAGGCATGGCAGGCTGAGGCAGG + Intronic
1104724952 12:131070301-131070323 CAGCCACAGAAGGCTCTGGAAGG - Intronic
1104785276 12:131444731-131444753 CAGGGACACCGGGCTGTGGAGGG - Intergenic
1104802099 12:131560862-131560884 CAGCCACAGAAGGCTCTGGAAGG + Intergenic
1105830951 13:24162324-24162346 CAGGCGGGGCAGGCTGTGGCTGG - Intronic
1106086398 13:26546202-26546224 CAGGCACAACAGGCTGCTGTGGG - Intergenic
1106602806 13:31201426-31201448 CCGGCAGAGAAGGCTGTAGTTGG + Intronic
1106621328 13:31373787-31373809 CAGGCACAGCAGGCTTGGGCTGG + Intergenic
1107512942 13:41103230-41103252 CAGCTACAGGAGGCTGAGGTGGG + Intergenic
1108571033 13:51751420-51751442 GTGGCACAGCAGGGTGGGGTGGG + Intronic
1110609549 13:77473860-77473882 CTGGCACATCAGGCAGGGGTAGG + Intergenic
1112268325 13:97946387-97946409 CATACACAGGAGGCTGAGGTAGG - Intergenic
1113412734 13:110104816-110104838 CAGGCAGAGAAGCCTGAGGTGGG - Intergenic
1113932262 13:113974640-113974662 CAGCCCCTGCAGGCAGTGGTGGG + Intergenic
1114643595 14:24241193-24241215 CAGGCACAGCAGGTTTCGCTGGG - Exonic
1114692449 14:24596232-24596254 CAGACAGAGCAGCCTGTGGAGGG - Intergenic
1115670147 14:35601564-35601586 TAGGAAGAGCAGGCTTTGGTTGG + Intronic
1117610711 14:57480100-57480122 CAGGAACAGCAAGCTTAGGTTGG + Intronic
1117686975 14:58263269-58263291 GATGCACAGCTGGGTGTGGTGGG - Intronic
1118554155 14:66995589-66995611 CAAGCACAGCAGAATGTAGTAGG - Intronic
1119139676 14:72255036-72255058 GAGACACAGCAGGCTGTGCTGGG + Intronic
1120949082 14:90024313-90024335 CAGGTGCAGCAGGCAGAGGTGGG - Intronic
1121662615 14:95646641-95646663 CAGACACAGGCGGCTGTGGGTGG + Intergenic
1121695679 14:95909956-95909978 GAGCCCCAGCAGGCGGTGGTGGG + Intergenic
1121742709 14:96265324-96265346 CAGCTACAGGAGGCTGAGGTGGG - Intronic
1122134256 14:99623779-99623801 CAGGTACAGCAGGCTCGGGAGGG - Intergenic
1122277758 14:100603955-100603977 CAGGGGCAGCAGCCTGTGGGAGG - Intergenic
1122446610 14:101774177-101774199 CTGGCACAGCTGGCTGTGGGTGG + Intronic
1122454820 14:101842030-101842052 CTGACACAGCAGGGTTTGGTGGG - Intronic
1122575342 14:102738413-102738435 CAGGCACAGCCCGCAGTGGCAGG + Intergenic
1122992891 14:105246971-105246993 AAGGATCAGCAGGTTGTGGTGGG - Intronic
1124913511 15:33946299-33946321 CAGGCAAAGGAGGCAGAGGTAGG + Intronic
1126595706 15:50382654-50382676 CAGGTTCTGCAGGCTGTGGCTGG - Intergenic
1126813076 15:52428301-52428323 TGGGGAAAGCAGGCTGTGGTTGG - Intronic
1128269163 15:66293691-66293713 CGGGCAGAGCGGGCTGTGGCAGG - Exonic
1128550349 15:68594346-68594368 TAGGAACAGCAAGCTGTGGGTGG + Intronic
1129786831 15:78315278-78315300 GAGACACAGAAGGCTGTGGATGG - Intergenic
1129952946 15:79608016-79608038 CAGGAACAGCAGGCTGAGGATGG - Intergenic
1131156896 15:90081058-90081080 CAGCCTCAGCAGGCTGGGGTGGG + Exonic
1131385309 15:92001470-92001492 CGGGCACAGGAGGCTGGGGCAGG - Intronic
1131389341 15:92034336-92034358 CAGAGAGAGCAGGCTGGGGTGGG + Intronic
1131674591 15:94659334-94659356 AATGCTCAGCAGGCTGTGGTCGG - Intergenic
1132459248 16:42261-42283 CAGCCGCAGCAGGCTGTGAGAGG + Intergenic
1132576472 16:666645-666667 AAGGCGCAGCATGCTGCGGTGGG - Intronic
1132676820 16:1124441-1124463 CAGGCCCAGGAGGCCCTGGTTGG + Intergenic
1132773072 16:1575439-1575461 CACGCTCAGGAGGCTGAGGTGGG + Intronic
1132780406 16:1621348-1621370 TCTGCACAGCAGGCTGTGGCAGG + Intronic
1132863997 16:2084784-2084806 CAGGCCGAGCGGGCTGGGGTGGG + Intronic
1132865106 16:2089429-2089451 CAGGTACAGCGGGCTGTGCCCGG - Exonic
1133207237 16:4240990-4241012 CAGGGAGAGCAGGCAGTGGGTGG - Intronic
1133814746 16:9188104-9188126 CTCCCACAGCAGGCTGAGGTGGG + Intergenic
1134507899 16:14823018-14823040 CAGGCTCAGCAGGCTGGTGGCGG + Intronic
1134536618 16:15031534-15031556 CAGACACAGCTGGCTGTAGCAGG - Intronic
1134695600 16:16221781-16221803 CAGGCTCAGCAGGCTGGTGGCGG + Exonic
1134976229 16:18572905-18572927 CAGGCTCAGCAGGCTGGTGGCGG - Intergenic
1135137352 16:19895019-19895041 CAGACAGGGCAGGCTGAGGTGGG + Intergenic
1135152705 16:20023159-20023181 CTGGTTCAGCAGGCTGGGGTGGG + Intergenic
1135475489 16:22770916-22770938 CAGGCAGGGAAGGCTGTGGAAGG + Intergenic
1135509199 16:23067962-23067984 AAAGCACAGGAGGCTTTGGTGGG + Exonic
1135861301 16:26058491-26058513 CAGGCACAGCAGGAGGTGAACGG + Intronic
1137687387 16:50395828-50395850 GATACACAGCAGGCTGAGGTGGG + Intergenic
1137789921 16:51166299-51166321 CAGGCACTGCTGGCTGGGGAGGG + Intergenic
1137880280 16:52038945-52038967 CAGGCACTGAACACTGTGGTGGG - Intronic
1138899377 16:61250547-61250569 CAGGCACAGCAGGAGGTGAGTGG - Intergenic
1139852459 16:69959424-69959446 CAGGCACCACAGGGTGTGGGAGG - Intronic
1139881430 16:70182332-70182354 CAGGCACCACAGGGTGTGGGAGG - Intronic
1140371079 16:74413172-74413194 CAGGCACCACAGGGTGTGGGAGG + Intronic
1141826545 16:86484657-86484679 CGGGTACAGCAGCCTATGGTTGG + Intergenic
1142118998 16:88376796-88376818 CAGGCACAGCAGGCAGCTGGTGG - Intergenic
1142522201 17:512908-512930 CTGGAAGAGCAGGCTGTGATGGG + Exonic
1142604610 17:1074564-1074586 CAGGCACAGCCAGCTGGGATTGG + Intronic
1143781223 17:9230662-9230684 CAGGCCCAGGAGGCTCTGGGGGG + Intronic
1143867761 17:9936265-9936287 CACACACAGCAGCCTGTGGGAGG + Intronic
1143884388 17:10055119-10055141 CAGGCACAGTGGCCTGGGGTAGG + Intronic
1144865190 17:18331086-18331108 CAGACACTGTAGCCTGTGGTAGG + Intronic
1145798201 17:27667921-27667943 TATGCACAGAAGGCTGTGGCTGG + Intergenic
1145948386 17:28795537-28795559 GATGCCCAGGAGGCTGTGGTGGG - Intronic
1147012139 17:37458786-37458808 CATGCTCAGGAGGCTGAGGTGGG - Intronic
1147796872 17:43050159-43050181 CAGGCACAGGAGGCAAAGGTGGG + Intronic
1147963116 17:44179725-44179747 AAGGCACCGCGGGCTGGGGTCGG + Intergenic
1147963985 17:44183564-44183586 AAGGCTGAGCTGGCTGTGGTCGG - Intergenic
1148352590 17:46951392-46951414 CAGGCTCAGAAAGCTGGGGTGGG - Intronic
1148742697 17:49901882-49901904 CAGGAGGAGCAGACTGTGGTTGG - Intergenic
1148773122 17:50078307-50078329 TAGGCACAGCAGGCTGGGGTGGG - Intronic
1148904697 17:50904854-50904876 CAGCCCCAGCAGCCTGTGGCTGG + Intergenic
1149486472 17:57046463-57046485 CAGGCGCAGCGGGCAGTGGTGGG - Intergenic
1149565104 17:57635676-57635698 CAAGCTCAGCAGGCTGGGGAAGG - Intronic
1150226425 17:63527076-63527098 CAGGAAAGGCAGGCTGGGGTGGG - Intronic
1151294874 17:73177603-73177625 CAGGGACAGCTGGCTGGGGCTGG - Intergenic
1151569065 17:74917189-74917211 CAGGCAGAACAGGGTGTGGCTGG - Exonic
1151761783 17:76108258-76108280 CAGCTACAGGAGGCTGAGGTGGG - Intronic
1152033742 17:77859186-77859208 CAGGCAAAGGAGGCTCTGGTGGG - Intergenic
1152269616 17:79316355-79316377 CCAGGCCAGCAGGCTGTGGTCGG + Intronic
1152566800 17:81103873-81103895 CAGGCAGAGCAGGCTGTTGCTGG - Intronic
1152613244 17:81325923-81325945 TAGGCAGAGCTGGCTGTGGTCGG - Intronic
1152734095 17:81988504-81988526 CAGGGACAGCAGGAGGTGGTGGG + Intronic
1153566271 18:6421033-6421055 CAGGCTCAGGAGGCTGATGTGGG - Intergenic
1156205698 18:34883421-34883443 CAGCTACAGGAGGCTGAGGTGGG - Intronic
1156488296 18:37480670-37480692 CATCCACAGGAGGCTCTGGTGGG - Intronic
1156690125 18:39697487-39697509 AAGGCAGAGGAGGCTGAGGTGGG + Intergenic
1156752539 18:40476744-40476766 CAGCTACAGGAGGCTGAGGTGGG - Intergenic
1157107956 18:44792558-44792580 CAGGTACTCCAGGCGGTGGTGGG - Intronic
1157476774 18:48028879-48028901 CAGCCACAGCAGGAGGAGGTAGG - Exonic
1158082940 18:53615728-53615750 CAGGGTAAGCAGGCTGTGGTTGG - Intergenic
1158517090 18:58139704-58139726 CAGGCACAGCTGCCTCTGCTCGG - Intronic
1160451392 18:78968731-78968753 CAGGCTCAGGAGGGTGTGGGAGG - Intergenic
1161086121 19:2335587-2335609 CAGGGACAGAGGGGTGTGGTGGG - Intronic
1161154777 19:2726948-2726970 CAGGCACAGAAGCCTGTTCTGGG + Intronic
1161167652 19:2796865-2796887 CAGGCACACCGGGCAGTGGGTGG - Intronic
1161251127 19:3280956-3280978 CAGGCCTAGGAGGCTGTGATGGG - Intronic
1161977940 19:7616444-7616466 CCGGTCCAGCAGGCTGTGGGGGG - Intronic
1162159622 19:8702129-8702151 AAGGCACAGCAGGCTGACCTAGG - Intergenic
1162524187 19:11197801-11197823 CAGGGACAGCAGGCGGTGGGGGG - Intergenic
1162545084 19:11324405-11324427 CAGCCACCGCAGGCAGTTGTCGG - Exonic
1163815486 19:19462398-19462420 CAGGCACAGCTGGAGGGGGTGGG - Intronic
1164905421 19:31963823-31963845 CGGGCACAGCAGGCTTTGGGTGG - Intergenic
1164942141 19:32259051-32259073 CAGGCTCTGTAGGCTTTGGTGGG - Intergenic
1165044495 19:33093996-33094018 CAGCCACAGCAGGCTGCACTGGG - Intronic
1165779470 19:38423895-38423917 CAGGAACAGCAGCCTCTGGGAGG - Intronic
1165934811 19:39382924-39382946 TAGTCACAGCAGGCTGTGTGTGG + Intronic
1166495508 19:43300307-43300329 CAACCACAGCAGGATGAGGTTGG + Intergenic
1166720298 19:44992550-44992572 CAGGCCCACCTGGCTGTGGACGG + Intronic
1167377023 19:49117824-49117846 CAGGCTCAGCTGTCTGTGTTGGG + Intronic
1167745536 19:51349557-51349579 CAGCCTCAGGAGGCTGAGGTGGG - Intronic
1168148014 19:54430354-54430376 CAGCCAGAGCAGGCGCTGGTGGG - Intronic
1202688227 1_KI270712v1_random:67278-67300 CGGGCAGAGCTGGCTGTGGCTGG - Intergenic
926122539 2:10252691-10252713 CGGGCACAGTAGGAGGTGGTGGG - Intergenic
926633211 2:15156325-15156347 CAGGCACAGGAGTGTGAGGTTGG + Intergenic
927640439 2:24842204-24842226 ATGGCAGAGCAGGCTGTGGAGGG - Intronic
929087597 2:38183686-38183708 CACTCACAGCAGGCTGTGTGTGG - Intergenic
929188165 2:39116737-39116759 CAGTCTCAGGAGGCTGAGGTGGG + Intronic
929893186 2:45936189-45936211 GGGGCACAGCAGGCAGGGGTGGG - Intronic
931223555 2:60309917-60309939 CAGCAAAAGCAGGCAGTGGTGGG + Intergenic
933248441 2:80001740-80001762 GAGGCACAGGAGGCTGTGTCCGG - Intronic
933867414 2:86534308-86534330 CAGGTACGGGAGGCTGAGGTAGG - Intronic
934136417 2:89000384-89000406 CAGGCACAGCAGGTAGTATTGGG + Intergenic
934139854 2:89035941-89035963 CAGGTACAGCAGCCAGTGTTGGG + Intergenic
934145902 2:89093706-89093728 CAGGTACAGAAGGCAGTGTTGGG + Intergenic
934223356 2:90106862-90106884 CAGGTACAGAAGGCAGTGTTGGG - Intergenic
934229386 2:90164610-90164632 CAGGTACAGCAGCCAGTGTTGGG - Intergenic
934751579 2:96797387-96797409 CAGGAGCAGCAGGCTCTGGCTGG - Intronic
934835907 2:97589799-97589821 CAGGCAAAGCAGTCTGTGCACGG + Exonic
935050392 2:99520393-99520415 CATTCAAAGCAGGGTGTGGTCGG + Intergenic
935216261 2:100977472-100977494 CTGGCAGAGCACACTGTGGTGGG + Intronic
936152020 2:110027257-110027279 CAGGCACAGCCCCCTGAGGTAGG + Intergenic
936192658 2:110344156-110344178 CAGGCACAGCCCCCTGAGGTAGG - Intergenic
936370437 2:111898471-111898493 CGGGCCCAGCAGGTTGGGGTGGG - Exonic
936950418 2:117972506-117972528 CAGGCAGAGCCCCCTGTGGTTGG - Intronic
937079955 2:119133744-119133766 CATGCACAGCAGGAAGTGGCAGG - Intergenic
937310048 2:120896437-120896459 CAGGCCCACCAAGCTGGGGTGGG + Intronic
938618944 2:133029733-133029755 CAGGCATATCAGGCTGTGCTAGG + Intronic
941713200 2:168736574-168736596 CAGGCACTGGAGGCTGAGGCAGG - Intronic
942974250 2:181995967-181995989 GAAGGACAGTAGGCTGTGGTGGG + Intronic
943441809 2:187934870-187934892 TTGGCTCAGCAGGCTGTGCTTGG + Intergenic
944320767 2:198339362-198339384 CAGGCAGAGCAGCCTGGGTTGGG + Intronic
946038731 2:216765895-216765917 CAGCCACTGCAGGCTGAGGGTGG + Intergenic
946336201 2:219038334-219038356 CAGGCAGAGCAGGGTGTGGCAGG - Intronic
947661802 2:231875040-231875062 CAGGAATGGCAGGCTGTGGGTGG + Intergenic
947752275 2:232539394-232539416 CAGGGCCAGCTGGGTGTGGTAGG - Intergenic
947876504 2:233471177-233471199 CAGCGACAGGAGGCTGTGCTGGG - Exonic
948090685 2:235292224-235292246 CAGGCATAGCAGGATGTGCCAGG - Intergenic
948511069 2:238465707-238465729 GAGACACAGCTGGCTGTGGTGGG + Intergenic
948557641 2:238824616-238824638 CAAGCATAGCAGGCTGTGACTGG + Intergenic
948706005 2:239792845-239792867 CATGCGCAGCGTGCTGTGGTGGG - Intronic
948790081 2:240372480-240372502 CAACGAGAGCAGGCTGTGGTGGG + Intergenic
1168848996 20:963899-963921 CAGGCACACGAGGCTGCGGTGGG - Intronic
1168996788 20:2139174-2139196 CATGCACAGCAGGATGGGGCTGG - Intronic
1169209831 20:3759727-3759749 GGGCCACAGCAGGCTGTGGAAGG - Intronic
1169446359 20:5674751-5674773 CAGTCCCAGGAGGCTGAGGTAGG - Intergenic
1170840637 20:19922311-19922333 CTGGCACAGCTGGCTTTGTTTGG - Intronic
1171351639 20:24507223-24507245 CAGGCTTGGCAGGCTGTGGGGGG - Intronic
1172712973 20:36941320-36941342 CAAGGACAGAAGGCTGTGGGAGG - Intronic
1172870022 20:38130045-38130067 CAGGCTCAGGAGGCTGAGATGGG + Exonic
1173019805 20:39257689-39257711 CATACACAGCCGGGTGTGGTGGG - Intergenic
1174322579 20:49753710-49753732 CAGTCCCAGGAGGCTGAGGTGGG - Intergenic
1174585744 20:51606763-51606785 CAGACTCAGAAGGCTGAGGTAGG + Intronic
1174961236 20:55159366-55159388 CAGAGACAGCAGGCTTTGGTTGG + Intergenic
1175680782 20:60987009-60987031 TAGGCACAGCAGGGTGTGGCAGG - Intergenic
1175790601 20:61737876-61737898 CAGAGACAGGAGGCTGTGGTTGG + Intronic
1176103215 20:63373901-63373923 CAGCCACAGCAGGCTCAGCTCGG + Intronic
1176244882 20:64092800-64092822 CGGGGGCAGCAGACTGTGGTTGG - Exonic
1176262380 20:64188810-64188832 CAGGCACCGGAGCCTGCGGTGGG + Intronic
1176265736 20:64208404-64208426 CAGGCCCAGCTGGCTCTGCTCGG - Exonic
1176430602 21:6573355-6573377 CAGCCAGGGCAGGCCGTGGTTGG + Intergenic
1178929817 21:36807535-36807557 CAGCCACACCAGGCAGTGGGCGG - Intronic
1179032441 21:37732246-37732268 CAGGCACAGCAGGGTGTGTGGGG + Intronic
1179640930 21:42746772-42746794 CAGGCACGCCGGGCTGTGGGGGG + Intronic
1179705996 21:43180817-43180839 CAGCCAGGGCAGGCCGTGGTTGG + Intergenic
1179725413 21:43338963-43338985 CAGGGGCCACAGGCTGTGGTGGG + Intergenic
1179729725 21:43360924-43360946 CAGGCACAGCCAGGTGTGGGCGG + Intergenic
1179902326 21:44400613-44400635 CAGCCACATCAGCCTGGGGTTGG + Intronic
1180067294 21:45418805-45418827 CAGGCACAGGAGGTCGGGGTGGG - Intronic
1180087194 21:45513053-45513075 CAAGCACAGCAGCCTGGGGCTGG + Exonic
1181021825 22:20107576-20107598 CATGCCCAGCAGGCTGGGATAGG - Intronic
1181168050 22:20993774-20993796 CAGGCACAGCAGGCAGAGCAGGG - Intronic
1181495148 22:23283484-23283506 CAGGCACAGGCCCCTGTGGTGGG - Intronic
1181567269 22:23746702-23746724 CAGTCCCAGGAGGCTGAGGTGGG - Intronic
1181582777 22:23837231-23837253 CAGGGCCACCAGGCTGTGGATGG - Intronic
1183184097 22:36282077-36282099 AGGGCACAGAAGGCTGGGGTGGG - Exonic
1183675466 22:39296882-39296904 CTGGCAGAACAGGCTGGGGTGGG - Intergenic
1183718761 22:39550014-39550036 CACACACAGGAGGCTGTGATGGG - Intergenic
1183723943 22:39578204-39578226 CAGGGACAGCAGGCGATGGGAGG - Intronic
1184087539 22:42274228-42274250 CAGGCACAGCAGGAGGCTGTGGG - Intronic
1184098970 22:42331562-42331584 GAGGCCCAGCAGGCTGAGCTTGG + Intronic
1184697700 22:46149471-46149493 CAGGCACAGCTGGCAGCGGAGGG + Intergenic
1184701992 22:46181369-46181391 CAGCTGCAGCAGGCTGTGGCAGG + Intronic
1184715598 22:46280118-46280140 CAGGAAAAGCAGGCTGTGATGGG + Intronic
1185173585 22:49306919-49306941 CAGGCAGTGCAGGCTGTGCCCGG - Intergenic
951893378 3:27587418-27587440 CCTGCACAGGAGGCTGAGGTGGG - Intergenic
952259183 3:31723180-31723202 CAGGCTTAGCTGGCTGTGGATGG + Intronic
953087428 3:39683760-39683782 TTGGCACAGCATGCTGTGATTGG - Intergenic
953222473 3:40985399-40985421 CAGACACACCAGGTTTTGGTTGG + Intergenic
953687597 3:45090297-45090319 GTGGCAGGGCAGGCTGTGGTGGG - Intronic
953842442 3:46400103-46400125 CAGGCCCGGGAGGCTGGGGTGGG - Intergenic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
957118396 3:76057217-76057239 CAGGCACTGCAGGCTGTGGGTGG - Intronic
959198061 3:103210949-103210971 CTGGCACTCCCGGCTGTGGTGGG - Intergenic
959366123 3:105459896-105459918 ATGGGACAGCAGGCTGTGGAAGG + Intronic
960571668 3:119190827-119190849 CAAGTACAGCTGGCTGAGGTTGG - Intronic
961501156 3:127337034-127337056 CAGGCACAGCGGGGGGTAGTCGG + Intergenic
962626017 3:137226888-137226910 CAGGATCAGCAGCCTGTGCTAGG - Intergenic
964314783 3:155432123-155432145 CAGGAGCAGCAGGATGTGTTGGG - Intronic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
966873412 3:184307231-184307253 AAGGCACAGCAGGCTGGGCATGG - Intronic
967833479 3:193942056-193942078 TAGGCAAAGGCGGCTGTGGTAGG + Intergenic
968074505 3:195809150-195809172 AAGGCACAGCAGACAGAGGTGGG - Intronic
968547099 4:1205016-1205038 GAGTCGCAGCAGGCTGTGCTCGG + Intronic
968736215 4:2297905-2297927 GTGACACAGCAGGCTGTGCTGGG + Intronic
968921170 4:3522885-3522907 CAGGCACACCTGGCTATGGCTGG + Intronic
969104659 4:4796461-4796483 CAGGAACTGCAGGCTATGGATGG - Intergenic
969576684 4:8040165-8040187 CACCCACAGCAGGCAGGGGTGGG + Intronic
969883732 4:10196935-10196957 TAGGCACAGTGGGCTCTGGTGGG - Intergenic
970599234 4:17627715-17627737 CAGGCACAGGAGGCTGAGGCAGG + Exonic
972645948 4:40967595-40967617 CAGGCATACCTAGCTGTGGTGGG - Intronic
973162186 4:47032356-47032378 CAGTGACAGCAGGCTGGGGAGGG - Intronic
973896748 4:55421410-55421432 CAGACTCAGAAGGCTGAGGTGGG - Intronic
974607818 4:64174801-64174823 TAGGCCCAGCAGGCCGTGCTTGG - Intergenic
976725287 4:88210299-88210321 CAGCCACTGGAGGCTGAGGTGGG - Intronic
977454326 4:97238766-97238788 CATGCTCAGCAGGATATGGTTGG - Intronic
977718794 4:100214565-100214587 CAGGAAAAGCTGGCTGTGTTAGG - Intergenic
978233010 4:106423703-106423725 CAGCCTCAGGAGGCTGAGGTGGG + Intergenic
978284685 4:107061998-107062020 CAGGCTCAGGAGGCTGAGGCAGG + Intronic
978822138 4:112979117-112979139 TTGGCCCAGCAGGCTGTGCTTGG + Intronic
980745120 4:137002126-137002148 CAGGCACAGAGGGCTGTGTGAGG - Intergenic
982668243 4:158291887-158291909 CAGCCTCAGCAGGCTGGGGTGGG - Intergenic
983272600 4:165580584-165580606 CATGCACAGCAGACTGTTCTAGG - Intergenic
983575275 4:169254796-169254818 CAAGCACAGCAAGCAGGGGTTGG + Intronic
983653183 4:170053708-170053730 CACACACAGGAGGCTGAGGTGGG - Intergenic
983943870 4:173564747-173564769 TAGTCTCAGCAGGCTGAGGTGGG - Intergenic
985206151 4:187539119-187539141 AAGGCACAGAAGGCCGTTGTGGG + Intergenic
985420875 4:189784081-189784103 CGGGCACAGTGGGGTGTGGTGGG - Intergenic
985677844 5:1241496-1241518 CAAGCACAGGAGGCTGGGGTTGG - Intronic
986328912 5:6703116-6703138 CAGGCTCAGGAGGCTGCAGTGGG - Intergenic
986706098 5:10455902-10455924 GAGGCACAGCTGCCTGTGCTGGG - Intronic
987121291 5:14769940-14769962 TAGGCACTGCAGGCCTTGGTGGG + Intronic
987358908 5:17088988-17089010 CAGCCTCAGGAGGCTGAGGTGGG - Intronic
987989359 5:25190721-25190743 GAGGCCCAGCAGGCTTGGGTCGG + Intergenic
988575335 5:32417666-32417688 CAGCAACAGAAGGCTGAGGTTGG + Exonic
990610153 5:57448849-57448871 CAGGCACAGCAGGTTTTCTTTGG + Intergenic
991544439 5:67765879-67765901 CTGACACAGCAGGATGAGGTGGG - Intergenic
992797428 5:80265711-80265733 GAGGCTCAGCAGGCTGAGGCAGG - Intergenic
994005651 5:94834599-94834621 CAGGAACAGTAGGCAGTGGCAGG + Intronic
994092312 5:95820237-95820259 CAGCCACGGGAGGCTGAGGTGGG + Intronic
994205055 5:97025190-97025212 CAGGAAGAACAGGCAGTGGTGGG + Intronic
995705971 5:114989788-114989810 CAAGCCCAGCAGGCTTTGGCTGG - Intergenic
995849078 5:116525580-116525602 AAGACACAGAAGGCTGTGGGTGG - Intronic
997195639 5:131977381-131977403 CAGGCACAGCAGGCTGGGAAGGG + Intronic
997603622 5:135157102-135157124 CAGGCTCCCCAGGCAGTGGTGGG - Intronic
998359619 5:141573764-141573786 CAGGCAAAGGAGGTGGTGGTGGG + Exonic
998390803 5:141785944-141785966 CAGGTACACCTGACTGTGGTTGG - Intergenic
998523298 5:142819456-142819478 CTGGCAGAGCAGGCTATGGGAGG - Intronic
998558801 5:143151842-143151864 CAGGCTCAGGAGGCTGAGGCAGG + Intronic
999309794 5:150544767-150544789 CACCCACAGCAGGCTGGGGAGGG + Intronic
999533933 5:152495889-152495911 GAAGCAGAGCAGGCTATGGTGGG - Intergenic
999604330 5:153297666-153297688 CAGGCACTGCAGGCTGAGGCAGG + Intergenic
999609424 5:153353022-153353044 CAGGCACTGAAGTCTGTGGTTGG + Intergenic
999684485 5:154090015-154090037 CAGGCACTGGAGGATGTGCTGGG - Intronic
1000003196 5:157159690-157159712 ATGGCACAGCACGCTGTGGTGGG + Intronic
1000888175 5:166772263-166772285 CAGGGAAAGCAGGCTGCTGTGGG + Intergenic
1001590453 5:172861057-172861079 CAGGCCCTGCAGGCTGGGGCAGG - Intronic
1001819935 5:174702565-174702587 CAGCTACAGGAGGCTGAGGTGGG - Intergenic
1002425348 5:179171642-179171664 CAAGCACAGGAGGCAGTGATGGG - Intronic
1002447993 5:179301885-179301907 CGGGCACAGCACGCTGTGAGCGG - Intronic
1003190535 6:3870741-3870763 GCGGCACAGGAGGCTGAGGTGGG - Intergenic
1003637885 6:7850474-7850496 CAAGCACAGGAGGCTGCTGTTGG + Intronic
1004420519 6:15465337-15465359 CAGCTACAGGAGGCTGAGGTGGG + Intronic
1004673293 6:17817293-17817315 CAGGCACTGCAGCCTGTGGGAGG + Intronic
1004953933 6:20706119-20706141 CAGGCACAGCAGACTGGGACAGG + Intronic
1007474007 6:42107215-42107237 CTGGCACAGGAGGCGGTGGGGGG + Exonic
1007521290 6:42453038-42453060 CAGGCGCAGCAGGCCGGGGAGGG + Intergenic
1007817991 6:44538305-44538327 CAGGCAGGGCAGGCTCTGGGAGG + Intergenic
1008795685 6:55299795-55299817 CTAGCAGAGCAGGCTGTGGTGGG - Intergenic
1010399459 6:75431689-75431711 CAGGCACAGCCAGCTGTCCTAGG + Intronic
1011129577 6:84039769-84039791 AAGGCAGAGCAGGCTGAGGGAGG + Intronic
1013416144 6:109926306-109926328 CAGGAATAGCAGGCAGTAGTGGG + Intergenic
1013435529 6:110101810-110101832 GAGGCAGAGGAGGCGGTGGTGGG + Exonic
1013552275 6:111219415-111219437 GATGCACAGGAGGCTGAGGTGGG + Intronic
1015219309 6:130785924-130785946 CCAGCACAGGAGGCTGAGGTGGG - Intergenic
1016840269 6:148518314-148518336 CATGCCCAGCAGACGGTGGTGGG - Intronic
1017344246 6:153361564-153361586 CAGGCACATCTGGATGTGGGAGG - Intergenic
1018863170 6:167726942-167726964 GAGGCAGAGGAGGCTGTGGGAGG + Intergenic
1019120179 6:169796155-169796177 CAGGCAGAGGAGGATGTGGATGG - Intergenic
1019145002 6:169970757-169970779 CAGGCTCACCGGGCTGTGGAGGG + Intergenic
1019278985 7:190965-190987 CAGGGACAGAAGCCTGTGGCAGG - Intergenic
1019598386 7:1869019-1869041 CTGGCTCGGCAGGCTGGGGTGGG + Intronic
1019617715 7:1973748-1973770 GAGGCAGAGCAGGATGTGGAGGG - Intronic
1019631579 7:2052475-2052497 CAGGCACAGCAGGCAGGGAGGGG + Intronic
1019709960 7:2513665-2513687 CAGCCACAGCAGGCAGGGGGTGG - Intronic
1019807882 7:3141933-3141955 CAGCCTCAGGAGGCTGAGGTGGG + Intronic
1020132795 7:5569066-5569088 GTGGCACAGGAGGCTGAGGTGGG + Intergenic
1020705657 7:11540905-11540927 CAGGAACTCTAGGCTGTGGTAGG + Intronic
1021698255 7:23294061-23294083 CAGGGAGAGCAGCCTGGGGTGGG - Intergenic
1022094433 7:27130173-27130195 CAGGCCCAGCGGGCTCTTGTCGG + Exonic
1023759731 7:43453440-43453462 CAGGCAGAGCAGGTTTTGATGGG + Intronic
1024063822 7:45717100-45717122 CAGGCACAGCATGGCGTGGCTGG - Exonic
1024147602 7:46533215-46533237 CAGGGCCAGCAGACTGAGGTGGG + Intergenic
1024224230 7:47313567-47313589 CAGGTACTGCATGCTGTGCTGGG - Intronic
1024246718 7:47476312-47476334 CAGGCACAGAATGTAGTGGTAGG - Intronic
1024251300 7:47507770-47507792 CTGGCACAGGAGGCTGTGTTGGG - Intronic
1026150014 7:67779973-67779995 CAGCTACAGGAGGCTGAGGTGGG + Intergenic
1026361520 7:69605246-69605268 CAGGCACAGAAGCTTGTAGTCGG + Intronic
1026538191 7:71257878-71257900 AATGCCCAGGAGGCTGTGGTAGG - Intronic
1027128937 7:75577039-75577061 AAAGCACAGGAGGCTGGGGTTGG + Intronic
1027734771 7:81919618-81919640 TTGGCCCAGCAGGCTGTGCTTGG + Intergenic
1029296234 7:99542827-99542849 TAGTCCCAGGAGGCTGTGGTGGG + Intergenic
1032471550 7:132182616-132182638 CAGCCCCTGCAGGATGTGGTGGG - Intronic
1032736650 7:134698463-134698485 CAGGCTTAGCAGGCAGGGGTAGG + Intergenic
1033733507 7:144200494-144200516 CAGCCCCAGGAGGCTGAGGTGGG - Intergenic
1033749543 7:144350479-144350501 CAGCCCCAGGAGGCTGAGGTGGG + Intergenic
1034151769 7:148922463-148922485 CAGGCAGTGCAGTGTGTGGTGGG - Intergenic
1034471470 7:151256871-151256893 GAGGCACGGCTGGCTGTAGTCGG - Intronic
1034859262 7:154582009-154582031 GAGGAAAAGGAGGCTGTGGTAGG - Intronic
1035321916 7:158035490-158035512 AGGGCCCAGCAGGCTGGGGTTGG + Intronic
1035437699 7:158871488-158871510 CTGGCCCAGCAGGTTGTGGTGGG - Exonic
1036165533 8:6429411-6429433 AAGCCACAGCAGTCTGGGGTGGG - Intronic
1036388085 8:8299111-8299133 GAGGAAACGCAGGCTGTGGTGGG - Intergenic
1037943173 8:22969996-22970018 CAGGTACAGTAGGCTGACGTGGG - Intronic
1037949543 8:23009887-23009909 CAGGCTCTCCAGGCTGTGCTGGG - Intronic
1038428381 8:27480052-27480074 CAGCCTCAGCAGTCTGTGGCCGG - Intergenic
1039752489 8:40491208-40491230 GCTGCACAGCTGGCTGTGGTGGG - Intergenic
1039965380 8:42280253-42280275 CAGGGGAAGCAGGTTGTGGTGGG - Intronic
1040933921 8:52764038-52764060 CAGGCACTGCAGGAGGTGCTTGG + Intergenic
1041400593 8:57440042-57440064 GAGGAACAGCAGGAAGTGGTTGG + Intergenic
1042251903 8:66764580-66764602 CAGCTACAGGAGGCTGAGGTGGG - Intronic
1042727469 8:71893565-71893587 CAGGCATGGCTGGCTGTGGGAGG + Intronic
1043514403 8:80982698-80982720 CAGGCAGAGCAGGTTTTGGGGGG - Intronic
1043750222 8:83925744-83925766 CAGGCACTGGTGGCTATGGTGGG + Intergenic
1044071491 8:87766124-87766146 TAGGCACAGCATACTGTGGGAGG - Intergenic
1044426801 8:92061697-92061719 CAGGCAGAAGAGGCTGTGCTTGG - Intronic
1046218236 8:111178195-111178217 CGGGCACAGGAGCCTGAGGTGGG - Intergenic
1046263294 8:111799020-111799042 CAGCCCCAGCATGCTGTGGCAGG + Intergenic
1049197970 8:141325806-141325828 CAGCCACAGAAGGCGGGGGTGGG + Intergenic
1049198746 8:141329650-141329672 CAGCCACAGCAGGCGGGGCTGGG + Intergenic
1049416778 8:142499000-142499022 AAGGCCTAGCAGCCTGTGGTTGG - Intronic
1049438500 8:142598633-142598655 CAGGCAGGGCAGGCTGGGGGTGG - Intergenic
1049553673 8:143272032-143272054 CAGGCAGTGCTGGCTCTGGTGGG - Intronic
1049709455 8:144057099-144057121 CAGGCACAGTGGGCTGCTGTCGG - Exonic
1049719389 8:144108602-144108624 CAGCCACAGCAGGCTGAGGTTGG - Exonic
1049879090 8:145049937-145049959 CAGGCATGGGAGGCTGAGGTGGG + Intergenic
1051077492 9:13257291-13257313 CAGGCACGGGAGGCTATTGTGGG - Intronic
1051336641 9:16071596-16071618 CGAGCACAGCTGGCTGAGGTTGG + Intergenic
1051357849 9:16255749-16255771 GAGGCCCAGCAGGCTGTGCATGG + Intronic
1052456411 9:28705026-28705048 CAGATACAGGAGGCTGAGGTGGG - Intergenic
1053117802 9:35520760-35520782 CAAGCAAAGCAGTCTGTGCTGGG + Intronic
1054735288 9:68744558-68744580 CAGGGAGAGGGGGCTGTGGTTGG + Intronic
1056551879 9:87659340-87659362 CAGGCACAGCAGGGTGATGTGGG - Intronic
1056614349 9:88150798-88150820 CAGGCAAAGTGGGCTGTAGTTGG + Intergenic
1056741672 9:89261555-89261577 AAGACCCAGCAGGCTGTGCTTGG + Intergenic
1057407555 9:94787251-94787273 AAGTCACAGCAGGATGTGGCAGG - Intronic
1057494848 9:95553040-95553062 CAGGCACAGCAGGCTGGGGCCGG + Intergenic
1057616628 9:96596745-96596767 CAGCTACAGGAGGCTGAGGTGGG + Intronic
1060155182 9:121314822-121314844 TAGGCACAGAAAGCTGTGGCTGG - Intronic
1060414917 9:123423424-123423446 CAGGAACACATGGCTGTGGTAGG + Intronic
1060515440 9:124262860-124262882 CAGGCACTGCAGGCTCTGAATGG - Intronic
1060797121 9:126520198-126520220 GACCCACAGCAGGCTGTGGATGG - Intergenic
1061243259 9:129386705-129386727 GGGGCAGAGCAGGCTGTGGCTGG + Intergenic
1061805256 9:133134138-133134160 CAGGCCCAGCCGGCTCTGCTAGG + Intronic
1062042502 9:134410618-134410640 CAGGCATAGTAGGCAGTGGCCGG + Intronic
1062198350 9:135287081-135287103 CAGGCCCAGGAGGCAGTGCTGGG - Intergenic
1185775569 X:2800403-2800425 CAGGGCCAGCAGACTGAGGTGGG - Intronic
1186065133 X:5755297-5755319 CAGGAATGGCAGGCTGTGATAGG - Intergenic
1186165926 X:6825773-6825795 CTTGCACAGCAAGCTGGGGTGGG - Intergenic
1187478773 X:19635762-19635784 CAGGGACAGGAGGGGGTGGTTGG - Intronic
1187605177 X:20874831-20874853 CAGTCACAGCAGCCTGGAGTTGG + Intergenic
1187618810 X:21027847-21027869 CAGCCACAGCATGATGTGGTGGG - Intergenic
1190924221 X:54887423-54887445 CAGGAGCAGCAGGTGGTGGTAGG + Intergenic
1191850429 X:65582040-65582062 AAGGCAAAGCAGGATGTGGTTGG + Intergenic
1192007104 X:67227927-67227949 CATACACAGCAGCCTGTTGTGGG - Intergenic
1195408789 X:104546632-104546654 TAGGGATAGCAGGCTTTGGTGGG + Intergenic
1195779085 X:108440487-108440509 AAGGCTCACTAGGCTGTGGTGGG + Intronic
1196415001 X:115461832-115461854 AAAGCACAGCAGGCTGAGTTTGG - Intergenic
1196868115 X:120087555-120087577 CAGCCACAGCAGGCTGTGACAGG - Intergenic
1196874830 X:120147702-120147724 CAGCCACAGCAGGCTGTGACAGG + Intergenic
1199371553 X:147055847-147055869 CAGCTACAGGAGGCTGAGGTGGG + Intergenic
1199719265 X:150530602-150530624 TAGGCCTGGCAGGCTGTGGTGGG - Intergenic
1200075358 X:153548001-153548023 TAGGGACAGCAGGAGGTGGTGGG + Intronic
1200684491 Y:6246542-6246564 CGGGCACAGCAGGCTGTGCCTGG + Exonic
1200990020 Y:9337801-9337823 CGGGCACAGCAGGCTGTGCCTGG + Exonic
1200992682 Y:9358116-9358138 CGGGCACAGCAGGCTGTGCCTGG + Exonic
1200995336 Y:9378395-9378417 CGGGCACAGCAGGCTGTGCCTGG + Intronic
1200998000 Y:9398740-9398762 CGGGCACAGCAGGCTGTGCCTGG + Exonic
1201000509 Y:9467274-9467296 CGGGCACAGCAGGCTGTGCCTGG + Exonic
1201003177 Y:9487604-9487626 CGGGCACAGCAGGCTGTGCCTGG + Exonic
1201008490 Y:9528199-9528221 CGGGCACAGCAGGCTGTGCCTGG + Exonic
1201294348 Y:12450954-12450976 CAGGACCAGCAGACTGAGGTGGG + Intergenic
1201408336 Y:13672373-13672395 CAGACACAGCAGTGTGTGGAGGG + Intergenic
1202195305 Y:22294677-22294699 CATGCACAGCAGGAAGTTGTAGG + Intergenic