ID: 1077218318

View in Genome Browser
Species Human (GRCh38)
Location 11:1404343-1404365
Sequence CCGTGGCCACTCCCCTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077218318_1077218330 26 Left 1077218318 11:1404343-1404365 CCTCTTCAGGGGAGTGGCCACGG 0: 1
1: 0
2: 1
3: 12
4: 109
Right 1077218330 11:1404392-1404414 TCCGCCTGCCTCAGCCTCCCAGG 0: 3
1: 381
2: 5164
3: 7534
4: 7374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077218318 Original CRISPR CCGTGGCCACTCCCCTGAAG AGG (reversed) Intronic
901210823 1:7525113-7525135 CCCTGGCCAGCCCCCTGGAGAGG - Intronic
901495952 1:9622086-9622108 CTGTGGCCCCTACCCAGAAGTGG + Intergenic
902742068 1:18445728-18445750 CCTTGGCCATTCCCCAGTAGGGG - Intergenic
903972414 1:27127644-27127666 CCTTGACCACCTCCCTGAAGTGG - Intronic
906232070 1:44172390-44172412 CTGTGGCTACTCCCCTGGAGGGG - Intergenic
909629878 1:77759912-77759934 CCGTGGCCCCGCCCCTGGGGCGG - Intergenic
912706824 1:111920836-111920858 CAGTGGCCTATCCCCAGAAGAGG - Intronic
915597083 1:156902002-156902024 CTGTGGCCTCTCCCCTTCAGAGG + Intronic
919381785 1:196869442-196869464 CCTTGGGCACTCCCTTGCAGAGG - Intronic
919751814 1:201042496-201042518 CCCTGGGCCCTGCCCTGAAGGGG - Intronic
919781821 1:201226038-201226060 TCTTGGCCACCACCCTGAAGTGG - Exonic
922654861 1:227373257-227373279 CAGTGCCCATTTCCCTGAAGGGG + Intergenic
1063977835 10:11431156-11431178 CGGTGGACACTCCTCTGAAGAGG + Intergenic
1070323183 10:75370297-75370319 TCCTGGCCCCTGCCCTGAAGGGG - Intergenic
1075786271 10:125052321-125052343 CCGTGGCCATTTCCCAGCAGTGG + Intronic
1077218318 11:1404343-1404365 CCGTGGCCACTCCCCTGAAGAGG - Intronic
1081908002 11:46681279-46681301 CCGTGGCCACTCACCTGATGAGG + Exonic
1084560616 11:69903553-69903575 CCGTGGGCAGCCCCCGGAAGGGG + Intergenic
1087887272 11:103495283-103495305 CACTGGCCACTCCTCTCAAGAGG - Intergenic
1089939385 11:122399274-122399296 TGCTGGCCACTCTCCTGAAGGGG + Intergenic
1096502606 12:52074062-52074084 CCGCGCGCCCTCCCCTGAAGAGG - Intronic
1097798881 12:63891061-63891083 AGGTGGCCAGACCCCTGAAGAGG - Intronic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1102491211 12:113290604-113290626 CTCTGCCCACTCCCATGAAGAGG + Intronic
1103344112 12:120237994-120238016 CCCCGGCCACTGTCCTGAAGAGG + Intronic
1105917257 13:24928017-24928039 ACGTGACCCCTTCCCTGAAGGGG + Intergenic
1108127148 13:47256851-47256873 CCATTTCCACACCCCTGAAGAGG + Intergenic
1109590056 13:64466998-64467020 CCATGGTCACTACCCTAAAGAGG - Intergenic
1113608515 13:111627125-111627147 TCCTGGCCTCTCTCCTGAAGGGG - Intronic
1117107002 14:52407907-52407929 CCTTGCCCCATCCCCTGAAGGGG - Intergenic
1117742607 14:58833993-58834015 CTGTGGCCACTCACTTGGAGTGG + Intergenic
1118379423 14:65205392-65205414 CTGTGGCAACTCCCCTGGGGTGG - Intergenic
1121259388 14:92555049-92555071 CCGTAGCCACTAGCCAGAAGTGG - Intronic
1124584385 15:30991700-30991722 CCGGGGCCCATCCCCGGAAGGGG + Intergenic
1128315516 15:66657036-66657058 CCCAGGCCACTCCCCAGAGGCGG - Intronic
1129144362 15:73633487-73633509 CGGTGGCCCCGCCCCTGCAGAGG + Intronic
1129351597 15:74958700-74958722 CCGCAGCCACTCCCAGGAAGTGG - Intronic
1129389008 15:75211209-75211231 CTGTGGCTGCTCCCCTGGAGGGG + Exonic
1131291449 15:91110551-91110573 CCGTGGCCTCTCGCCTGATCTGG + Intronic
1132204112 15:99974801-99974823 CTGTGCCCTCTTCCCTGAAGAGG - Intronic
1136553363 16:30993537-30993559 CCCTGGCCACTCCACTGCGGTGG - Intronic
1137425176 16:48373318-48373340 CTTTGGCCATCCCCCTGAAGGGG - Intronic
1139415080 16:66801517-66801539 CCGTGGCGTCTACCCTCAAGCGG + Exonic
1141199020 16:81882963-81882985 CCATGGCCACACTCCTGGAGGGG + Intronic
1141925449 16:87165738-87165760 CTTTGGCCTCTCCCCTGAACTGG - Intronic
1147476371 17:40715468-40715490 CCATGGGCACTCTCCTGAAGGGG + Intergenic
1148768472 17:50053282-50053304 CTCTGGACACTCCCCTGGAGTGG + Intergenic
1148866479 17:50631402-50631424 CCTTGTCCTCTCCCCTGAAGTGG - Intergenic
1159264750 18:66065794-66065816 TCCTGGCCACTCATCTGAAGAGG - Intergenic
1160450070 18:78957127-78957149 ACGTGGCCCCTCCCCTAACGTGG - Intergenic
1163365417 19:16873398-16873420 CAGTGGCCACTCCCCAGGTGAGG + Intronic
1163617803 19:18340228-18340250 CCGAGGTCACTCGCCTCAAGGGG - Intergenic
1163732272 19:18955965-18955987 TCCTGGCCCCTCCCCTGGAGTGG - Intergenic
1164669519 19:30064633-30064655 CGGTGGCCAGGCCCCGGAAGGGG + Intergenic
1164995041 19:32714907-32714929 CCATGGCAACTCCAGTGAAGAGG - Intergenic
1165769418 19:38370150-38370172 TCGTGTCCACTCCTCTGCAGGGG - Exonic
1166130872 19:40744817-40744839 CCCTGGGCTCTCCCCTGAAGGGG - Intronic
931235010 2:60405884-60405906 CCCTGGCCATTCCCCTGCAGAGG + Intergenic
935206259 2:100898883-100898905 CCTTGGCCACCCGACTGAAGTGG - Intronic
935592395 2:104855142-104855164 CCGTGGCCACCCCCTTCAGGGGG - Intergenic
941670810 2:168290510-168290532 CCCTGGTCACTGCCGTGAAGAGG - Intergenic
944132530 2:196362212-196362234 TCGTGGCCACACCCCTGTAAAGG + Intronic
947181583 2:227416235-227416257 CTCTGGGCACTACCCTGAAGAGG - Intergenic
948600770 2:239106396-239106418 CCTTGGGCAGTCCCCAGAAGGGG + Intronic
1169444359 20:5659076-5659098 CCATGGCAACAGCCCTGAAGCGG + Intergenic
1172823583 20:37760547-37760569 CTCTGACCACTCCCCTGACGGGG - Intronic
1175215340 20:57389452-57389474 CCGTGGCCACGCCACCGACGCGG + Intergenic
1175331383 20:58166988-58167010 CCAAGGCCACACCCCTGGAGTGG - Intergenic
1180142118 21:45899002-45899024 CTGTGGCCTGTCACCTGAAGCGG - Intronic
1184405724 22:44299352-44299374 GGCTGGCCCCTCCCCTGAAGGGG + Intronic
1184419843 22:44373404-44373426 CCTTGGCCTCTGCCCTGCAGGGG + Intergenic
1185344673 22:50306073-50306095 CCGTGTCCAGTCACCCGAAGCGG - Intronic
950517296 3:13475739-13475761 CCGTGTCCCCTCCCCAGAAAGGG - Intergenic
953797801 3:45998766-45998788 CCGTGCCCACGGCCCTGAGGAGG + Intergenic
955516765 3:59733543-59733565 ATGTGGCCAGTCCCCTCAAGAGG + Intergenic
957884726 3:86271462-86271484 CCTTGGCCATTTCCCTGAAGGGG + Intergenic
968750611 4:2387075-2387097 CCGGGGCCACTCCCTGGAGGAGG + Intronic
968893492 4:3385154-3385176 TCCTGGCCACTCCCGAGAAGTGG - Intronic
968898954 4:3421784-3421806 CTGTGGCTCCTCCCATGAAGAGG - Intronic
970101281 4:12524922-12524944 CCTTGGCCATTCCAGTGAAGTGG + Intergenic
973821032 4:54661518-54661540 CCTTGACCACTACCTTGAAGGGG - Intronic
986200202 5:5572555-5572577 CAGTGGCCACTCCCTCGTAGCGG + Intergenic
994342120 5:98642660-98642682 CATTGACCACTCTCCTGAAGGGG - Intergenic
997310654 5:132878167-132878189 CTGTGGAAACTCCCCTGAAGGGG + Exonic
997374456 5:133387209-133387231 CAGTGGCCACTCCCATGATTAGG - Intronic
997399779 5:133593346-133593368 CTGGGACCTCTCCCCTGAAGTGG - Intronic
999097848 5:148996569-148996591 CCGTGGCAGCTCCCCTGAGGAGG + Intronic
1004964531 6:20833407-20833429 TCCTCGCCACTTCCCTGAAGAGG + Intronic
1006749359 6:36366861-36366883 CCTAGGCCACTCACCTGAACAGG + Exonic
1006907041 6:37539552-37539574 AGGAGGCCACTCCCCTGCAGGGG - Intergenic
1011712367 6:90067520-90067542 CTGTGGCCAATCCCTGGAAGGGG - Intronic
1011744063 6:90392087-90392109 CAGTGGCCACTCCCAGGGAGGGG - Intergenic
1015756510 6:136612031-136612053 CTGTGGCCCCTACCCAGAAGTGG + Intronic
1018895725 6:168015558-168015580 CTGGAGCCACTTCCCTGAAGAGG - Intronic
1019074952 6:169379614-169379636 CCATGGCCAGTCCCCTGGCGTGG - Intergenic
1020025157 7:4894656-4894678 CCCTGGCCACTCCTCTCGAGAGG + Intergenic
1020328402 7:6994489-6994511 GCCTGGCCACTCCCCTTGAGGGG + Intergenic
1024041568 7:45560024-45560046 CCATGCCCACTTCCCTGCAGTGG + Intergenic
1026436355 7:70402348-70402370 CCAGAGCCACTCCACTGAAGTGG + Intronic
1028743243 7:94300316-94300338 CTGCGGCCACTCCTCGGAAGCGG - Intergenic
1028793455 7:94878689-94878711 CTCTGGCCACTCCCCTAAGGGGG - Intergenic
1029109519 7:98205519-98205541 CCGAGGCTGCTCCCCTGGAGCGG + Exonic
1029508619 7:100978607-100978629 CAGTGGCAGCTCCCCTGAAGAGG - Intronic
1031991725 7:128203011-128203033 CTCAGGCCACTCCCCTGAAGAGG - Intergenic
1032543570 7:132724242-132724264 GCGTGCCCCCTCCCCTGATGGGG + Intronic
1034206337 7:149319023-149319045 CCGTGGCCACTACCCAGCTGAGG - Intergenic
1036634422 8:10539153-10539175 CTGTGGCCATTACCCTCAAGAGG + Intronic
1038144324 8:24880421-24880443 CCGTGGCAAATACCCAGAAGTGG + Intergenic
1044769286 8:95612879-95612901 CAGTGGCAAGTTCCCTGAAGTGG + Intergenic
1045300883 8:100908751-100908773 CCGTGGCGGCCCGCCTGAAGCGG - Intergenic
1048461215 8:134623300-134623322 CCCTGGACACTCCCCTGTGGGGG + Intronic
1049308133 8:141918587-141918609 CCGTGCCCAGCCCCCTGCAGAGG - Intergenic
1059339249 9:113588129-113588151 CCCAGGCCAGTCCCCTGCAGGGG - Intronic
1061451182 9:130667692-130667714 CCTTGGCAGCTCCCGTGAAGGGG + Intronic
1061648917 9:132030163-132030185 CAGTGCACACTCCCCTGAAGAGG - Intronic
1062046077 9:134425147-134425169 CAGTGGCCACAGCCCTGCAGGGG + Intronic
1062219199 9:135405165-135405187 CTGTGGGCAGACCCCTGAAGGGG - Intergenic
1062359716 9:136181994-136182016 CTGGGGCTACTCCCCTGCAGAGG + Intergenic
1187176109 X:16897712-16897734 CTGGAGCCACTGCCCTGAAGCGG - Intergenic
1188274012 X:28178239-28178261 GCATGGCCATTCCCATGAAGAGG - Intergenic
1196101769 X:111854207-111854229 ACATGGCCAATCCCCAGAAGAGG + Intronic
1198421105 X:136471490-136471512 CTGTAGCCACCCCCCTTAAGTGG + Intergenic
1199711566 X:150473321-150473343 CCTTGACCACTCTCCAGAAGAGG - Intronic