ID: 1077218976

View in Genome Browser
Species Human (GRCh38)
Location 11:1407040-1407062
Sequence CTAGGGTTTCCCAGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 1, 2: 3, 3: 23, 4: 266}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077218964_1077218976 6 Left 1077218964 11:1407011-1407033 CCTGCACCTAGGATGACAGGCGG 0: 1
1: 0
2: 0
3: 13
4: 323
Right 1077218976 11:1407040-1407062 CTAGGGTTTCCCAGGGAAGGGGG 0: 1
1: 1
2: 3
3: 23
4: 266
1077218967_1077218976 0 Left 1077218967 11:1407017-1407039 CCTAGGATGACAGGCGGAGGCTC 0: 1
1: 0
2: 0
3: 3
4: 122
Right 1077218976 11:1407040-1407062 CTAGGGTTTCCCAGGGAAGGGGG 0: 1
1: 1
2: 3
3: 23
4: 266
1077218962_1077218976 15 Left 1077218962 11:1407002-1407024 CCTTGTCTGCCTGCACCTAGGAT 0: 1
1: 0
2: 1
3: 7
4: 172
Right 1077218976 11:1407040-1407062 CTAGGGTTTCCCAGGGAAGGGGG 0: 1
1: 1
2: 3
3: 23
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077218976 Original CRISPR CTAGGGTTTCCCAGGGAAGG GGG Intronic
900008147 1:79257-79279 GTGGGGGTTCCCAGGGGAGGGGG - Intergenic
901142156 1:7042269-7042291 CCAGGGCAGCCCAGGGAAGGGGG - Intronic
901525093 1:9816326-9816348 CTAGGGGTTGCCAAGGGAGGAGG + Intronic
901701464 1:11046848-11046870 CTGGGGTTTCTCAGGGTCGGGGG - Intronic
902238532 1:15073457-15073479 CTGGGGTTGCCCCAGGAAGGTGG - Intronic
903740102 1:25553829-25553851 CTGGGGTTTCCTAGGAAAGAAGG + Intronic
904213232 1:28899441-28899463 CTAGAATGTCCCAGGAAAGGGGG - Intronic
904563451 1:31413538-31413560 CTCGGGTTTCCGCGGGCAGGAGG + Intronic
904674974 1:32193469-32193491 CCAGGTTGTCCCAGGGAATGGGG + Intronic
904715329 1:32463658-32463680 TTAGGGTCTCTCAGCGAAGGGGG + Intergenic
904858549 1:33518090-33518112 GTAGGGATTCCCAGTGAGGGCGG - Intronic
904900914 1:33856366-33856388 CTGGGGTTCCCCAGAGAAAGAGG - Intronic
905632108 1:39524649-39524671 CCTGGGGTTCCCTGGGAAGGAGG + Intronic
905643602 1:39609378-39609400 CTACGGTCTCCCGAGGAAGGAGG + Intergenic
911074907 1:93863844-93863866 CTAGGGGTGCACAGGAAAGGAGG - Intergenic
911882187 1:103254067-103254089 CTAGGGTTGCACAGGGAGTGTGG + Intergenic
914881010 1:151547218-151547240 CTGGGCTTTGCCAGAGAAGGAGG + Intronic
915017192 1:152744928-152744950 TTAGTGTTTTCCAGGAAAGGTGG + Intronic
915491794 1:156254157-156254179 CTAGGGTTTCACAGTGGAGGTGG - Intronic
915556076 1:156661477-156661499 GTTGGGTTTCCTGGGGAAGGCGG + Intergenic
916625690 1:166552741-166552763 GTAGGGTTTCCCAGGCAAGATGG - Intergenic
917967282 1:180186652-180186674 TTATAGTTTCCCCGGGAAGGTGG + Intronic
918412113 1:184270734-184270756 CTGGGGCTTCCCAGGGAGCGAGG - Intergenic
921220741 1:212972039-212972061 CTGAGCTTTTCCAGGGAAGGGGG - Intronic
922516755 1:226213821-226213843 CCTTGGTTTCCAAGGGAAGGAGG + Intergenic
922731168 1:227949383-227949405 CCAGGCTTTCCCAGGGAAGCAGG - Intergenic
922744188 1:228035125-228035147 GGAGGGCTTCCCAGGGGAGGTGG + Intronic
924152653 1:241144481-241144503 TTATGGCTTCCCAAGGAAGGGGG - Intronic
1063368136 10:5503900-5503922 CTAGGAGTACCCAGGAAAGGGGG - Intergenic
1064255858 10:13742298-13742320 CTGGGGAATCCCAGGGAAGCAGG + Intronic
1067068321 10:43115874-43115896 CTGTGGGTTCCCAGGGAATGTGG + Intronic
1067459689 10:46448597-46448619 CCAGGGTTTAACAGGAAAGGAGG + Intergenic
1067627499 10:47936016-47936038 CCAGGGTTTAACAGGAAAGGAGG - Intergenic
1069606906 10:69744459-69744481 CTTGGATTCCCCAGGGAAGGAGG - Intergenic
1070640011 10:78161443-78161465 AAAGGGCTTCCCAGAGAAGGTGG - Intergenic
1072416179 10:95248787-95248809 CTAGTGTTTCCCAGGCACAGCGG - Intronic
1072924534 10:99604981-99605003 CTGAGGTTTCCCAGAGAAGAAGG + Intergenic
1073354799 10:102845358-102845380 GAAGGTTTTCCCAGGGATGGTGG + Intergenic
1074034345 10:109723205-109723227 CTAGGGTGTCAGAGAGAAGGAGG + Intergenic
1075334306 10:121597685-121597707 CCAGGGTTTGACAGGGAGGGGGG + Intronic
1077218976 11:1407040-1407062 CTAGGGTTTCCCAGGGAAGGGGG + Intronic
1077395788 11:2320529-2320551 CTAGCTTTTCCCAGGGACGAAGG - Intergenic
1077497685 11:2894322-2894344 CTGGGGTAACCCAGGGAAGGGGG - Intronic
1077510537 11:2958870-2958892 CCGCGGTTTCCCAAGGAAGGAGG + Intronic
1078993186 11:16670029-16670051 GTAGGGATTCCCAGGGAAGGGGG - Intronic
1080178499 11:29394895-29394917 ATAGGGTAGCCCAGGGTAGGTGG + Intergenic
1080792869 11:35537106-35537128 CCATCGTTACCCAGGGAAGGGGG + Intergenic
1081582647 11:44362838-44362860 GAAAGGTTTCCCATGGAAGGAGG - Intergenic
1083827334 11:65211097-65211119 CTCTGGTTTCCCAGGGGTGGAGG + Intronic
1084914251 11:72416285-72416307 TTAGGGCTTCACAGGCAAGGTGG - Intronic
1086347512 11:85912310-85912332 CTATTGTTTTCCAGGAAAGGTGG + Intronic
1088034528 11:105296037-105296059 CTGGGGATACCCAGGGAAAGGGG - Intergenic
1089466771 11:118690706-118690728 CTGGGGTTTCCTGGGGAGGGTGG - Intergenic
1089640559 11:119844798-119844820 ACAGGGTGGCCCAGGGAAGGAGG + Intergenic
1090314932 11:125777816-125777838 CTACTGTTTCTCAGGGATGGTGG + Intronic
1091615945 12:2051920-2051942 TTAGGGTCACCCAGGGAATGAGG + Intronic
1091750474 12:3018839-3018861 CTGGGGTCCCCCAGGGGAGGAGG + Intronic
1096523725 12:52198548-52198570 CTAGGGTTCCCCAGGAAGGCTGG - Intergenic
1096910569 12:54979813-54979835 CTCTGTTTTCCCAGGGAAGCAGG + Intronic
1096975449 12:55697161-55697183 TTTGGGTTTCCCAGGGAGGGGGG - Intronic
1097532790 12:60826327-60826349 CTAAGGTTTCTCTGGGAAGAAGG - Intergenic
1100714572 12:97292363-97292385 CTAGGGTTGCGCAGGCAAGTGGG - Intergenic
1100980379 12:100158144-100158166 CTAGGGTTACACAGTGAGGGTGG - Intergenic
1101800937 12:108021537-108021559 CTAGAGTTTCCCATGGGAGCAGG + Intergenic
1101823294 12:108200851-108200873 CTAGGCTTCCCCAGGGCAGAAGG - Intronic
1101860345 12:108477422-108477444 TGAGGGCTTCCCAGGGGAGGTGG - Intergenic
1102509336 12:113403692-113403714 CTGTGGTTTCCCAGGGGAAGAGG - Intronic
1102567292 12:113805070-113805092 CAAAGGTTTCCCAGGGAAAATGG + Intergenic
1103408692 12:120694963-120694985 GTAGAGTTTCCCTGTGAAGGTGG - Exonic
1103816273 12:123659453-123659475 CTAGGGTTTCCAGAGGAATGAGG - Intronic
1104250035 12:127084249-127084271 CTAGTGGTTCCCAGGGTTGGGGG + Intergenic
1105759563 13:23501630-23501652 CAAGCGATGCCCAGGGAAGGAGG - Intergenic
1107562294 13:41568360-41568382 CTGTGGTTTGCCAGGGCAGGAGG - Intronic
1107776585 13:43850150-43850172 CCATTGTTTCCCATGGAAGGGGG - Intronic
1109310997 13:60693069-60693091 CGAAGGTATCCCATGGAAGGAGG + Intergenic
1110533403 13:76623128-76623150 CTGGGGTTTCCCCTGGAAGCAGG - Intergenic
1111318595 13:86593979-86594001 TTGAGGTTTCCCAGAGAAGGGGG + Intergenic
1112389440 13:98969682-98969704 CAAGGGTTTCCCAAAGAAGCTGG + Intronic
1112406318 13:99123740-99123762 CTAGTTCTCCCCAGGGAAGGAGG + Intergenic
1113371663 13:109730999-109731021 GTAGGGGTGCCCTGGGAAGGAGG + Intergenic
1113617477 13:111691268-111691290 CCAGGGCTTCCTAGGGGAGGTGG + Intergenic
1113623007 13:111776528-111776550 CCAGGGCTTCCTAGGGGAGGTGG + Intergenic
1114278617 14:21169847-21169869 CCAGGGGTTCCCAGGGAAGAGGG - Intergenic
1114896916 14:27002222-27002244 CCAGGAGTTCCTAGGGAAGGAGG + Intergenic
1115640442 14:35332392-35332414 CTGGGGTTTTCCAGGGATAGAGG + Intergenic
1116904791 14:50394199-50394221 TCAGGCTTTCCCAGGGGAGGAGG - Intronic
1118284948 14:64462817-64462839 CAATGGTGTCCCAGGGAACGGGG + Intronic
1118768580 14:68926770-68926792 TTAGAGTTCCCCAGGGCAGGAGG - Intronic
1118989116 14:70781997-70782019 CTATGACCTCCCAGGGAAGGCGG - Intronic
1119903314 14:78280590-78280612 ATAGGGTCTCCCAGCCAAGGGGG + Intronic
1120083508 14:80241946-80241968 AAAGTGTTTCCCAGAGAAGGAGG + Intronic
1121438128 14:93932262-93932284 CTAGTGTGTCCCAGGCCAGGAGG + Intergenic
1122843802 14:104479711-104479733 AGAGGGTTCCCCAGGGCAGGGGG - Intronic
1125483653 15:40097743-40097765 CTTGTGCTCCCCAGGGAAGGAGG - Intronic
1127693671 15:61422742-61422764 CAAGGGCTTCACAGGAAAGGGGG + Intergenic
1127772774 15:62244262-62244284 CTAGGGTTACACAGTGAGGGTGG - Intergenic
1128767855 15:70261982-70262004 GGAAGCTTTCCCAGGGAAGGTGG - Intergenic
1129414345 15:75366940-75366962 CTAGGGTGTAGCAGGGAATGAGG - Intronic
1129993452 15:79984589-79984611 CTAAGGTTTCCCAGGTAATGCGG + Intergenic
1131303678 15:91222169-91222191 CAAGGGGTTCCAAAGGAAGGAGG - Intronic
1132445406 15:101912853-101912875 GTGGGGGTTCCCAGGGGAGGGGG + Intergenic
1132534462 16:471205-471227 CTCGGGACTCCCTGGGAAGGAGG - Intronic
1132558672 16:583783-583805 CATGGGCCTCCCAGGGAAGGAGG + Exonic
1134150625 16:11801824-11801846 CTAGGGGTGGCCAGGGTAGGCGG + Intergenic
1136550074 16:30978399-30978421 GCAGGCTTTCCCAGGGATGGCGG + Intronic
1139652570 16:68369852-68369874 CCAGTGTTTCCCTGGGCAGGCGG + Intronic
1141163385 16:81644284-81644306 CTACAATTTTCCAGGGAAGGAGG - Intronic
1142109007 16:88321302-88321324 CCAAGGTTTCCCTGGGATGGTGG - Intergenic
1143120883 17:4606051-4606073 CCAGTATTTCCCAGGGCAGGAGG + Intronic
1143897345 17:10146300-10146322 CTAGGGTTGCCCCGGGAAGAAGG - Intronic
1147611976 17:41807194-41807216 CTAGGGTGTTCCTGGGAAAGAGG + Intronic
1147790852 17:43013641-43013663 CTGGGGTTTGCTAGGGATGGAGG + Exonic
1149524196 17:57341151-57341173 CTGGGGTGGGCCAGGGAAGGAGG + Intronic
1149570798 17:57671076-57671098 CTGGGCTTTCCCAGTCAAGGTGG - Intronic
1150236011 17:63593191-63593213 ATTGGTTTTCCCAGGGAAGAGGG + Exonic
1154009745 18:10564627-10564649 ATAGAGTTTCCCAGGTAAGATGG - Intergenic
1155495096 18:26435081-26435103 CAAGGGTTACCCAAGGAGGGTGG + Intergenic
1159878871 18:73839277-73839299 CTAGGGTCTCCCTGGAAAGATGG - Intergenic
1160639902 19:120854-120876 GTGGGGGTTCCCAGGGGAGGGGG - Intergenic
1160891835 19:1383126-1383148 CGAGGGTGTGTCAGGGAAGGGGG + Intergenic
1160995320 19:1879671-1879693 CCAGGGGTTCCCAGGGAACCTGG + Intronic
1161209228 19:3057562-3057584 CTCGCGCTTCCCAGGGGAGGTGG + Intronic
1162463302 19:10826096-10826118 CTAGGGTTTCCCAAAGAGGATGG - Intronic
1162525108 19:11202295-11202317 TTGGGGTTTCCCAGAGAAAGAGG + Intronic
1163481732 19:17560506-17560528 CTGGGTATCCCCAGGGAAGGCGG + Intronic
1165272793 19:34724892-34724914 CTGGGGTTTTTCAGAGAAGGGGG - Intergenic
1165306261 19:35004862-35004884 CTAGGGTTGCACAGAGATGGAGG - Intronic
1166766822 19:45256083-45256105 ACAGTGTTTCCCATGGAAGGAGG + Intronic
1167105848 19:47429631-47429653 CGAGGGTCCCCCAGGGAGGGTGG + Exonic
1168294092 19:55370324-55370346 CAGGGGTTCCCCAGGGCAGGGGG + Exonic
925770267 2:7275259-7275281 CTAGGAGCTCCCCGGGAAGGAGG - Intergenic
926202789 2:10813350-10813372 CTGGGGTTCTCCAGAGAAGGAGG - Intronic
927075240 2:19570975-19570997 GAAGAGTTTCCCAGGGAAGCAGG + Intergenic
930544283 2:52746880-52746902 GCAGAGTTTCCCAGGGGAGGGGG + Intergenic
932274687 2:70443103-70443125 CCAGGGCTTCCCAGTGATGGAGG - Intergenic
934164177 2:89279351-89279373 CTGGGGTTTCCCTGGGCTGGAGG + Intergenic
934203097 2:89903176-89903198 CTGGGGTTTCCCTGGGCTGGAGG - Intergenic
936167778 2:110138757-110138779 CAAGGTTTTGCCAGGGAAAGGGG + Intronic
937603490 2:123768724-123768746 CTAGGGATTACCAGGAAAGAAGG + Intergenic
938737946 2:134203547-134203569 CTAGGGTTTTCTAGGGCATGAGG + Intronic
939000600 2:136729540-136729562 TTAGGGTTGCTAAGGGAAGGAGG + Intergenic
941171777 2:162146716-162146738 CAAGGGTTTCACAGAGATGGTGG - Intronic
942781392 2:179647609-179647631 CTAGGAGTTCCCAGGGATAGGGG + Intronic
944000710 2:194834072-194834094 TTAGTGTTTGCCAGGGATGGTGG + Intergenic
944144984 2:196497743-196497765 CTAGGTTTTGCAAGGAAAGGTGG - Intronic
944705195 2:202281665-202281687 CTTGGGTTACCCAGGCATGGTGG - Intronic
945666806 2:212753606-212753628 CTAGGGTTACTCAGGCAAGCAGG + Intergenic
947502486 2:230681594-230681616 CTAGGATTACCCAGTGAAGATGG + Intergenic
948205687 2:236161735-236161757 CCGTGGCTTCCCAGGGAAGGAGG - Intergenic
948491220 2:238314614-238314636 CCAGGGCCTCCCAGGGCAGGAGG - Intergenic
1168995649 20:2130940-2130962 CCAGGGGGTTCCAGGGAAGGGGG - Intronic
1170676428 20:18485630-18485652 CCTGGGTTTGCCAGGGATGGTGG + Intergenic
1172891912 20:38271560-38271582 GCAGGGCTTCCCAGGGGAGGTGG - Intronic
1173306826 20:41858482-41858504 CTGGGGTGTCCCAGGGAAGCAGG + Intergenic
1177540885 21:22493163-22493185 TTAAGGTTTCCCAGGCAAGATGG + Intergenic
1178473055 21:32911872-32911894 CTGAGGTTTCCCAGGGAAGAAGG - Intergenic
1179454904 21:41492741-41492763 CTAGTCTTTCCCAGGAAACGTGG + Intronic
1180048251 21:45319615-45319637 CTGGGGTTTCCCAGGGCTGCGGG - Intergenic
1180081261 21:45488859-45488881 CTAGTGTCCCCCAGGGATGGGGG - Intronic
1180767466 22:18353774-18353796 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1180778840 22:18508608-18508630 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1180811562 22:18765929-18765951 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1181112057 22:20607952-20607974 CCAGGGTCTCCCAGGGAAGATGG + Intergenic
1181197715 22:21200177-21200199 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1181395860 22:22621109-22621131 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1181647518 22:24241459-24241481 CTGAGGTTTCCCAGAGAAGCAGG - Intronic
1181703986 22:24636724-24636746 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1181882577 22:25992578-25992600 TTTGGGTTTCCCAGTGAATGTGG - Intronic
1181960540 22:26618987-26619009 CTGGGGCTTGCCAGGGCAGGAGG - Intergenic
1182619575 22:31611510-31611532 CCAGTGTCTCCCAGGGAAGACGG + Intronic
1182960269 22:34465624-34465646 CTAGAGTTTCCCAGGAACTGTGG + Intergenic
1183310472 22:37106919-37106941 CAAGGGCTGCCCAGGGGAGGGGG - Intronic
1183856035 22:40636058-40636080 CTTGGGATTCCCAGGCAAGGAGG - Intronic
1185076865 22:48687809-48687831 CTGGGGCAGCCCAGGGAAGGTGG - Intronic
1185217931 22:49613940-49613962 CTAGGTTTTCCCAGCGTATGGGG - Intronic
1185373278 22:50470585-50470607 GCAGAGTTTCCCAGGGGAGGGGG - Intronic
1185408900 22:50672687-50672709 TGAGGGTCTCCCAGGGGAGGGGG - Intergenic
1203229088 22_KI270731v1_random:94658-94680 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
949176027 3:1063467-1063489 CTTGTGTTTCCCAGGTGAGGTGG + Intergenic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950205690 3:11078702-11078724 CTAGTGTTTGCCAGGGAGGAAGG - Intergenic
950422659 3:12907869-12907891 CCCGGGTTTCCCAGGAGAGGAGG + Intronic
950991950 3:17449109-17449131 CTTGGGCTTCCCAGGTGAGGTGG - Intronic
954073165 3:48158007-48158029 TGTAGGTTTCCCAGGGAAGGGGG - Exonic
954382940 3:50229235-50229257 CCTGGGCTTCCCAGGGGAGGTGG + Intronic
954422783 3:50427338-50427360 CTGGGGGTCCCCAGGGATGGGGG - Intronic
954624703 3:52016170-52016192 CTAGGGCTGCCCAGGGGATGGGG - Intergenic
954807921 3:53231009-53231031 CTAGCCTTTCCCAGGTCAGGTGG + Intronic
958185524 3:90114642-90114664 CCAGGGTTTCACAGATAAGGTGG + Intergenic
959278110 3:104304005-104304027 CTGGGGATTCCCAGGCAAGATGG + Intergenic
959595848 3:108127569-108127591 ATAGGGTCTCCCACGGAATGGGG + Intergenic
961432140 3:126890869-126890891 CTGGGGTTCCCCAGGGAGTGGGG + Intronic
961437759 3:126931244-126931266 CTTGGGTTTCCCAGGGACCAGGG + Intronic
962253878 3:133857363-133857385 CCAGGGTCTCCCAGCGAAGTGGG + Intronic
964072948 3:152657198-152657220 CTAGCTTTTCCCAGAGAAGTAGG - Intergenic
964510281 3:157442612-157442634 CCATGGTTTCCCTGGGAAGGTGG + Exonic
966500442 3:180633804-180633826 ATAGGGGTTCCCAGGGAAGAGGG - Intronic
968047133 3:195630823-195630845 GTCGGATTTCCCAGGGAAGCTGG + Intergenic
968307514 3:197659221-197659243 GTCGGATTTCCCAGGGAAGCTGG - Intergenic
968658544 4:1789270-1789292 CTAGTGGTTCCTGGGGAAGGTGG + Intergenic
969583786 4:8080461-8080483 CCAGGGCTGGCCAGGGAAGGGGG + Intronic
970790736 4:19854754-19854776 CCAAGGTTTCACAGGGAAGTGGG + Intergenic
970968321 4:21952320-21952342 CTAGGGTTAGTCAGAGAAGGTGG - Intergenic
972156772 4:36172819-36172841 CTGGTGTTTCCCAGGAAAGCTGG - Intronic
972462569 4:39318332-39318354 ATGGAGTTTCCCAGGGAATGTGG - Intronic
974109628 4:57511317-57511339 GTGGGGGTTCCCAGGGAAGAGGG + Intergenic
975743565 4:77453816-77453838 CTAGCTCTTCCTAGGGAAGGTGG + Intergenic
976530606 4:86148292-86148314 CCAGGGATTCCCAGGGAAAATGG + Intronic
977002247 4:91518900-91518922 TTAGGCTTTCCCAGGGAAGATGG + Intronic
978365073 4:107972946-107972968 CTAAGTCTTCCCAGGGAAGGGGG - Intergenic
982478228 4:155878274-155878296 GTAGGGTTTCACAGGGGTGGAGG + Intronic
985974442 5:3405109-3405131 CTTGGGTTTCCCAGGTCAGAAGG + Intergenic
985974451 5:3405137-3405159 CTTGGGTTTCCCAGGTCAGAAGG + Intergenic
985974460 5:3405165-3405187 CTTGGGTTTCCCAGGTCAGAAGG + Intergenic
987371428 5:17196852-17196874 CCTGGGTTTCCTTGGGAAGGCGG - Intronic
987808679 5:22804584-22804606 AATGGGTTTCCCAGAGAAGGTGG - Intronic
993413741 5:87601234-87601256 GTGGGGGTTCCCAGGGAAGAGGG + Intergenic
994876871 5:105435227-105435249 CTAAGGTCTCCCAAGGAAGAGGG - Intergenic
997668725 5:135653070-135653092 CTATGTCTTCCCATGGAAGGTGG - Intergenic
997688798 5:135811203-135811225 CTAGATTCTCCCTGGGAAGGAGG + Intergenic
999038923 5:148385068-148385090 CATGATTTTCCCAGGGAAGGAGG + Intronic
999429919 5:151517290-151517312 CCAGTGTTTCCCAGGGATGGGGG - Intronic
1000035483 5:157444527-157444549 TCAGGATTCCCCAGGGAAGGTGG + Intronic
1000813124 5:165887380-165887402 CTAGGGTTTCCCAGAGAAGGAGG + Intergenic
1001117502 5:168952036-168952058 CTAGAGTTTCCTGGGGAAGTAGG + Intronic
1001450799 5:171822910-171822932 CTTGTGTTTCCAAGGGAAGCAGG - Intergenic
1001934459 5:175694523-175694545 CTAGGGTGTCCTAGGGGTGGGGG - Intergenic
1002747252 6:69261-69283 GTGGGGGTTCCCAGGGGAGGGGG - Intergenic
1003086801 6:3066895-3066917 CCAGGGATTTGCAGGGAAGGAGG - Intronic
1003923959 6:10859537-10859559 CTGAGGTTTCCCAGAGAAGGAGG + Intronic
1003953425 6:11140684-11140706 ATAGGATTCCCCAGGGTAGGGGG + Intergenic
1005759423 6:28954159-28954181 GTAGGGTTTTCCTGGGAAGTGGG - Intergenic
1008675110 6:53810863-53810885 GGAGGGTTTCACAGAGAAGGCGG - Intronic
1009960178 6:70510462-70510484 CTAGCGGTTGCCAGGGAATGGGG - Intronic
1010019157 6:71139487-71139509 TTGGGGGTTCCCAGGAAAGGGGG - Intergenic
1011195141 6:84773426-84773448 CCAGGTCTTTCCAGGGAAGGGGG - Intergenic
1013069506 6:106715937-106715959 CCAGGGTTTCCCAGTGCAGTGGG - Intergenic
1014901752 6:126974140-126974162 CTAGGGCTTACCAAGGAAGATGG + Intergenic
1017371095 6:153710084-153710106 AGAGGGTTTCCCAGGAATGGAGG - Intergenic
1018793546 6:167168918-167168940 CCAGGGTTTCCCAGGGATGGCGG + Intronic
1018823169 6:167389460-167389482 CCAGGGTTTCCCAGGGATGGCGG - Intergenic
1019299320 7:295582-295604 CCACGGTGTCCCAGGGAAAGAGG - Intergenic
1019898305 7:4000109-4000131 ATGGGGTTTCCCTGGGAAGGAGG + Intronic
1020279712 7:6644070-6644092 CTAGGGCTTCCCTGGGAGGTGGG - Intronic
1023598097 7:41853682-41853704 CTCAGGTGTCCCAGGGAAGCAGG - Intergenic
1024732148 7:52264578-52264600 CTAGGGTTATCCAGAAAAGGTGG + Intergenic
1029962690 7:104705669-104705691 CTAGGGTTCCCCAGGCCATGAGG + Intronic
1031066691 7:117113309-117113331 ATAAGGTTTGCCTGGGAAGGTGG + Intronic
1032232867 7:130090906-130090928 TAGGGGTTTGCCAGGGAAGGTGG - Intronic
1032775706 7:135110363-135110385 CTCGGGTTTCCCAGCAAAAGTGG - Intronic
1033545907 7:142399999-142400021 CTTGGGAATTCCAGGGAAGGAGG - Intergenic
1033548600 7:142425087-142425109 CTTGGGAATTCCAGGGAAGGAGG - Intergenic
1034682031 7:152936192-152936214 CTTTAGTTTCCCTGGGAAGGTGG + Intergenic
1035135896 7:156703029-156703051 GTACAGTTTCCCAGGGAAAGTGG - Intronic
1035306616 7:157937086-157937108 GGAGGGCTTCCCAGAGAAGGTGG - Intronic
1035793954 8:2336606-2336628 CTGGGGATTCCCAGGCAAGATGG + Intergenic
1035798851 8:2385102-2385124 CTGGGGATTCCCAGGCAAGATGG - Intergenic
1038347711 8:26747553-26747575 CAGGGCTTGCCCAGGGAAGGTGG + Intergenic
1039063628 8:33591786-33591808 GAAGGGTTGACCAGGGAAGGAGG - Exonic
1039965375 8:42280213-42280235 TGAGTGTTTCCCAGGGAGGGAGG + Intronic
1042660376 8:71148505-71148527 CTCAGGTTTCCCAGAGAAGAAGG + Intergenic
1043509019 8:80931621-80931643 CAAGGGTATCCCGGGGAAGGAGG - Intergenic
1047060105 8:121215736-121215758 CCAGGCTCTCCCAGCGAAGGGGG - Intergenic
1049469563 8:142769316-142769338 CTTGGTTTTCCCAGGCAAGAGGG + Intronic
1049766596 8:144358087-144358109 CCAGGATTTCCAAGGGAATGCGG + Exonic
1051336781 9:16072797-16072819 CTAGGGTATCTCAGGGAAGATGG - Intergenic
1051718918 9:20015108-20015130 TGAGGGTTCCCCAGTGAAGGCGG - Intergenic
1051726142 9:20089531-20089553 GTGGGGGTTCCCAGGGAAGAGGG - Intergenic
1056993680 9:91434921-91434943 AAAGGGTTTCCTAGGGAATGTGG + Intergenic
1057248693 9:93481652-93481674 CTGGGGTGTCCCAGACAAGGAGG - Intronic
1057444746 9:95105654-95105676 CTAGAGTTTCCCAAGGCAGAGGG - Intronic
1057928200 9:99171132-99171154 CTTGAGTTTCTCAGGGAGGGAGG - Intergenic
1059300981 9:113313321-113313343 GGAGGGGGTCCCAGGGAAGGGGG - Exonic
1059848664 9:118311245-118311267 CTAGTGTCACACAGGGAAGGGGG + Intergenic
1060108357 9:120888968-120888990 CTAGGATTTCACAGTGATGGTGG + Intronic
1060995435 9:127872915-127872937 CCAGGGTCTCCCAGAGAGGGAGG + Intronic
1061238050 9:129353308-129353330 CTGGGGAGTCACAGGGAAGGTGG + Intergenic
1061389204 9:130307809-130307831 CCAGGGTCACCCAGGGAAGCCGG - Intronic
1061451019 9:130667010-130667032 CCAGGGTGTCCGGGGGAAGGAGG - Intronic
1062686616 9:137816978-137817000 CGAGGGTTTCTCAGGGCTGGGGG - Intronic
1186090981 X:6048831-6048853 CTAGGGTCTGTCAGGGAGGGCGG + Intronic
1186806041 X:13140797-13140819 CTGGGATTTCACAGAGAAGGTGG - Intergenic
1188298551 X:28480355-28480377 TTAGTGTTTGCCAGGGAATGGGG - Intergenic
1190477280 X:50840554-50840576 CCAAAGTTTCCCAGAGAAGGTGG - Intergenic
1192161725 X:68793376-68793398 CAGGAGTTTCCCAGGGAAGTGGG + Intergenic
1192314009 X:70038085-70038107 CCAGGGTCTCTCAGGGATGGAGG + Exonic
1192924039 X:75736867-75736889 TTAGGTTTTCTCAGGGAGGGAGG + Intergenic
1193046628 X:77061098-77061120 TTAGAGTAGCCCAGGGAAGGGGG + Intergenic
1193185461 X:78507287-78507309 CCAGGGTTTCCCAGGGGACAGGG - Intergenic
1195004845 X:100675646-100675668 CCAGGGCTTCCTAGGGAAGTAGG + Exonic
1197331779 X:125161611-125161633 CTAGTGTTTGCCAGGGATTGGGG + Intergenic
1198104046 X:133445808-133445830 CTAGTGTTTCCCAGGTAAGAAGG + Intergenic
1200054224 X:153450362-153450384 CTAGGGTCTCGCCGGGGAGGTGG + Intronic
1201906324 Y:19089262-19089284 ATATGGTTTCAGAGGGAAGGTGG - Intergenic