ID: 1077219963

View in Genome Browser
Species Human (GRCh38)
Location 11:1411462-1411484
Sequence CTTGGGGAGCAGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1711
Summary {0: 1, 1: 1, 2: 10, 3: 187, 4: 1512}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077219963_1077219968 -8 Left 1077219963 11:1411462-1411484 CCTTCCTCCCTCTGCTCCCCAAG 0: 1
1: 1
2: 10
3: 187
4: 1512
Right 1077219968 11:1411477-1411499 TCCCCAAGAGAGCCCAGGTCTGG 0: 1
1: 0
2: 1
3: 16
4: 167
1077219963_1077219972 0 Left 1077219963 11:1411462-1411484 CCTTCCTCCCTCTGCTCCCCAAG 0: 1
1: 1
2: 10
3: 187
4: 1512
Right 1077219972 11:1411485-1411507 AGAGCCCAGGTCTGGCCCAGCGG 0: 1
1: 0
2: 5
3: 40
4: 505
1077219963_1077219983 15 Left 1077219963 11:1411462-1411484 CCTTCCTCCCTCTGCTCCCCAAG 0: 1
1: 1
2: 10
3: 187
4: 1512
Right 1077219983 11:1411500-1411522 CCCAGCGGTGGGCAGGGGAGGGG 0: 1
1: 0
2: 10
3: 97
4: 710
1077219963_1077219973 3 Left 1077219963 11:1411462-1411484 CCTTCCTCCCTCTGCTCCCCAAG 0: 1
1: 1
2: 10
3: 187
4: 1512
Right 1077219973 11:1411488-1411510 GCCCAGGTCTGGCCCAGCGGTGG 0: 1
1: 0
2: 4
3: 34
4: 398
1077219963_1077219981 14 Left 1077219963 11:1411462-1411484 CCTTCCTCCCTCTGCTCCCCAAG 0: 1
1: 1
2: 10
3: 187
4: 1512
Right 1077219981 11:1411499-1411521 GCCCAGCGGTGGGCAGGGGAGGG 0: 1
1: 0
2: 10
3: 82
4: 672
1077219963_1077219977 8 Left 1077219963 11:1411462-1411484 CCTTCCTCCCTCTGCTCCCCAAG 0: 1
1: 1
2: 10
3: 187
4: 1512
Right 1077219977 11:1411493-1411515 GGTCTGGCCCAGCGGTGGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 258
1077219963_1077219978 9 Left 1077219963 11:1411462-1411484 CCTTCCTCCCTCTGCTCCCCAAG 0: 1
1: 1
2: 10
3: 187
4: 1512
Right 1077219978 11:1411494-1411516 GTCTGGCCCAGCGGTGGGCAGGG 0: 1
1: 0
2: 2
3: 21
4: 255
1077219963_1077219979 10 Left 1077219963 11:1411462-1411484 CCTTCCTCCCTCTGCTCCCCAAG 0: 1
1: 1
2: 10
3: 187
4: 1512
Right 1077219979 11:1411495-1411517 TCTGGCCCAGCGGTGGGCAGGGG 0: 1
1: 0
2: 1
3: 29
4: 336
1077219963_1077219980 13 Left 1077219963 11:1411462-1411484 CCTTCCTCCCTCTGCTCCCCAAG 0: 1
1: 1
2: 10
3: 187
4: 1512
Right 1077219980 11:1411498-1411520 GGCCCAGCGGTGGGCAGGGGAGG 0: 1
1: 1
2: 7
3: 76
4: 801
1077219963_1077219975 4 Left 1077219963 11:1411462-1411484 CCTTCCTCCCTCTGCTCCCCAAG 0: 1
1: 1
2: 10
3: 187
4: 1512
Right 1077219975 11:1411489-1411511 CCCAGGTCTGGCCCAGCGGTGGG 0: 1
1: 0
2: 3
3: 26
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077219963 Original CRISPR CTTGGGGAGCAGAGGGAGGA AGG (reversed) Exonic
900110393 1:1003040-1003062 CTTGCTGAGCAGAGGCAGGAGGG + Intergenic
900359102 1:2279384-2279406 CTTGGAGAGCAGGGCCAGGAAGG - Intronic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900416084 1:2535426-2535448 CCTGAGGAGCTGAGGGAGGTGGG + Intergenic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900603172 1:3511855-3511877 CTTGGTGAGCAGAGGGTCGAGGG - Intronic
900822402 1:4899665-4899687 CCTGGGAGGCAGAGTGAGGAGGG - Intergenic
901094191 1:6665173-6665195 CTTGGGAGGCAGACGAAGGAGGG - Intronic
901105982 1:6756913-6756935 TTTGGGCAGCTGAGGCAGGAAGG + Intergenic
901269566 1:7941457-7941479 CATGGGTGACAGAGGGAGGAAGG + Intronic
901609427 1:10485559-10485581 TTTGGGAGGCAGAGGTAGGAGGG - Intronic
901645877 1:10716462-10716484 CATGGGGAGCAGTGGGCAGAGGG + Intronic
901740338 1:11338069-11338091 GAGGGGGAGGAGAGGGAGGAGGG - Intergenic
901861882 1:12079632-12079654 CATGTGGAGCTGAGCGAGGAAGG - Intronic
902283041 1:15388324-15388346 CCTGGGGAGGGGAGGGAGGGAGG - Intronic
902530260 1:17086297-17086319 CGTGGGGAGCAGAAGCAGCAAGG + Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902928036 1:19710212-19710234 CTTGGGACGCTGAGGCAGGAGGG - Intronic
902936613 1:19769319-19769341 CAAGGAGAGCAGAGAGAGGAGGG - Intronic
903007252 1:20306983-20307005 CCAGGGGAGAAGAGGGAGGGAGG - Intronic
903041249 1:20532428-20532450 TTTGGGAAGCCGAGGCAGGAGGG + Intergenic
903054997 1:20629722-20629744 TTTGGGAAGCTGAGGGAGGAAGG + Intergenic
903105958 1:21080205-21080227 CTTGGAAAGCTAAGGGAGGAGGG + Intronic
903217349 1:21850563-21850585 CTTGGGGGTCAGAGTGAGGCAGG - Intronic
903269109 1:22176767-22176789 GTTAGGGAGCAGAGAGAGGCTGG + Intergenic
903325027 1:22564420-22564442 CTTGGGGAGGAGAGGGCTGGGGG + Intronic
903527465 1:24002700-24002722 CTTGGGGGGCTGAGGCGGGAAGG + Intergenic
903602521 1:24553252-24553274 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
903674327 1:25054750-25054772 CATGGGGAGCAGGGGGAGCAGGG + Intergenic
903790448 1:25889480-25889502 CTTGGGGAGCTGAGTGAAGGGGG - Intronic
903839083 1:26225498-26225520 CTTGGGGCGGGGAGGGAGGTGGG + Intergenic
904021179 1:27467104-27467126 CTTGGGAAGCTGAGGTGGGAGGG + Intronic
904257256 1:29262172-29262194 GTTGGGGAGTAGAGGAAGAAAGG - Intronic
904375828 1:30081903-30081925 GTGGGGGAGCAGAGGGAGGGAGG - Intergenic
904397276 1:30230305-30230327 CTTGGAGAACAGAGGTGGGAGGG - Intergenic
904417692 1:30373218-30373240 CTTGGGGAGAAAGAGGAGGAGGG - Intergenic
904583913 1:31568533-31568555 CTAGGGCAGCAGAGGAAGCAAGG - Intergenic
904681645 1:32233531-32233553 CTTTGGGAGCTGAGGCAGGCAGG - Intergenic
904793947 1:33044843-33044865 CTTAGGGAAGAGAGGGAAGAAGG + Intronic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905256416 1:36688390-36688412 GGAGGGGAGGAGAGGGAGGAGGG + Intergenic
905304312 1:37007003-37007025 CTTGCACAGCAGAGGGAAGACGG - Intronic
905436288 1:37957572-37957594 CTTGGGAGGCTGAGGCAGGAGGG - Exonic
905461559 1:38126001-38126023 CTTGGGGAGGAATGGGAGGGAGG + Intergenic
905699079 1:39998505-39998527 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
905733613 1:40312112-40312134 CCTGGGGAGCAGAGAGTTGATGG + Exonic
906062518 1:42958138-42958160 CTAGGGGAGCAGACGGAGAGCGG + Intronic
906145688 1:43558757-43558779 CTGGGGGAGGGGAGGGAGGCAGG + Intronic
906180107 1:43810738-43810760 CCTTGGGAGCAGAGGGGCGAGGG + Intronic
906191793 1:43903655-43903677 CCCTGGGAGGAGAGGGAGGAGGG + Intronic
906394126 1:45445685-45445707 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
906618592 1:47254636-47254658 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
906713819 1:47952321-47952343 CTAGATGAGCAGAGGCAGGAGGG - Intronic
906751252 1:48263933-48263955 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
907099179 1:51812418-51812440 CTTGGGGAGCTGAGGTGGGAGGG + Intronic
907222548 1:52917557-52917579 CATGGGTAGAGGAGGGAGGATGG + Intronic
907223582 1:52924999-52925021 CTTGAGGAGCTGAGGCAGAAAGG - Intronic
907464064 1:54623566-54623588 ATTGGGGCGGGGAGGGAGGAGGG - Intronic
907523583 1:55040503-55040525 CATGGGCAGCGGAGGGTGGAGGG + Intronic
908042777 1:60133004-60133026 ATTGGGAAGCCGAGGCAGGAGGG - Intergenic
908876012 1:68676670-68676692 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
908983136 1:69983279-69983301 CATGGGAAGCTGAGGGAGCAGGG + Intronic
909290054 1:73871091-73871113 TTTGGGAAGCTGAGGCAGGAAGG - Intergenic
909538083 1:76760625-76760647 CCTGGGGAGCAGAGGGAAGTGGG + Intergenic
909636662 1:77824316-77824338 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
909838267 1:80285432-80285454 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
910530198 1:88227136-88227158 CATGTGGTGCAGAGGTAGGAGGG + Intergenic
910819144 1:91327408-91327430 CTTGGGGGGCTGAGGTAGGAGGG + Intronic
910891857 1:92027085-92027107 CTTGGGAGGCTGAGGAAGGATGG + Intergenic
911615302 1:100004407-100004429 CTTGGGAGGCTGAGGGAAGATGG - Intronic
911702134 1:100966118-100966140 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
912803282 1:112735242-112735264 CTTGGGAGGCTGAGTGAGGAAGG + Intergenic
912947379 1:114096287-114096309 CTGGGGGAGCTGAGAGATGAGGG + Intronic
914221539 1:145686444-145686466 TTTGGGGAGCAGGGGGAGGCAGG - Intronic
914227153 1:145730078-145730100 TTTGGGAGGCAGAGGCAGGAGGG + Intronic
914264100 1:146022802-146022824 CTTTGGGAGCTGAGGCAGGAGGG + Intergenic
914377798 1:147087887-147087909 CTTTGGGAGGTGAGGCAGGAGGG - Intergenic
914474102 1:148009310-148009332 TTTGGGGAGCAGGGGGAGGCAGG - Intergenic
914717637 1:150265639-150265661 CTTGGGGAGAGGAGGGATGCTGG + Exonic
914847900 1:151292919-151292941 CTGGTGGAGCAGATGGTGGATGG - Exonic
915136657 1:153736686-153736708 TTTGGGAGGCAGAGGGAGGGTGG - Intronic
915199519 1:154216620-154216642 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
915305828 1:154977486-154977508 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
915342998 1:155186380-155186402 GAAGGAGAGCAGAGGGAGGAGGG - Intronic
915369533 1:155337039-155337061 TTTGGGGAGTAGAGGTAGGGAGG + Exonic
915655126 1:157353027-157353049 CTTGGGGGATTGAGGGAGGAGGG - Intergenic
915734446 1:158075909-158075931 CATGGGTCTCAGAGGGAGGAAGG + Intronic
915893572 1:159793565-159793587 CTAGGGCAGCAGCGGCAGGAGGG - Intergenic
915910187 1:159910196-159910218 TCTAGAGAGCAGAGGGAGGAAGG + Intergenic
916264041 1:162871843-162871865 CTTGGGGGGAAGAGTGAGAAGGG + Intergenic
916606017 1:166343147-166343169 AGTGGGGAGCAGGGGGAGCAGGG + Intergenic
916606021 1:166343156-166343178 CAGGGGGAGCAGGGGGAGCAGGG + Intergenic
916720441 1:167481461-167481483 AGTTGGGAGCAGAGGGAGGATGG + Intronic
917118241 1:171623687-171623709 CTTGGGGGGAAGGGGGATGAAGG + Intergenic
917207307 1:172590775-172590797 CTTGGGATGCAGATGGAGGTAGG - Intronic
917353469 1:174102383-174102405 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
917832184 1:178903499-178903521 CTTGGGGAGAAAAGTGAGAAGGG - Intronic
918533765 1:185551657-185551679 CTTTGGGAGGTGAGGGAGGGTGG + Intergenic
918855337 1:189747470-189747492 GTTGGGGAGGGGAGGGGGGAGGG + Intergenic
918862800 1:189854657-189854679 GTTGGGCAGGTGAGGGAGGAGGG - Intergenic
919172233 1:193969309-193969331 CTTGGGAGGCTCAGGGAGGATGG + Intergenic
919630364 1:199954871-199954893 GCTGGAGAGCAGAGGGAAGAGGG - Intergenic
919805128 1:201376917-201376939 CTTGGGGGGCAGATGGGGAAAGG - Intronic
919888229 1:201950585-201950607 CTTGGGGTGCTGAGGCGGGAGGG + Intergenic
919942460 1:202297707-202297729 CTTGGGGAGCCGGGGCGGGAGGG - Intronic
920054904 1:203184632-203184654 CCTGTGGAGCACAGGGAGGTGGG + Exonic
920105993 1:203554010-203554032 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
920578896 1:207086045-207086067 GAAGGGGAGCAGAGGGAGGCAGG + Intronic
920609561 1:207423683-207423705 CTTGGGGAGCAGAAGGCGGTCGG - Intergenic
920658142 1:207891573-207891595 CTTGGGGGGCTGAGGTGGGAGGG + Intronic
920688164 1:208125798-208125820 CTTGGGGAGCGGATGCAGGTTGG - Intronic
920879063 1:209863475-209863497 CTTGGGGAGCTTTGGGAGAAGGG + Intergenic
921086093 1:211794407-211794429 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
921221727 1:212978458-212978480 TTTGGGGCGTGGAGGGAGGAGGG - Intronic
921827416 1:219688682-219688704 CATGGTGAGGAGAGGGAGGGTGG - Intronic
922170469 1:223150339-223150361 CTTGGGAAGCTGAGTGAGGAGGG - Intergenic
922281064 1:224124833-224124855 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
922510862 1:226166261-226166283 CTTGGGGGGCTGAGGTGGGAGGG - Intronic
922804632 1:228378904-228378926 TTTGGGGAGGAGAGGGAGTGAGG + Intergenic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
923073428 1:230587424-230587446 TTTGGGGAGGAAAGTGAGGAGGG + Intergenic
923138010 1:231135256-231135278 CTTTGGGAGCCAAGGCAGGAGGG + Intergenic
923517069 1:234706958-234706980 CTTGGGAAGCATATGTAGGAAGG - Intergenic
923669587 1:236029067-236029089 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
923784494 1:237054297-237054319 GGAGGGGAGAAGAGGGAGGAAGG - Intronic
923810706 1:237311719-237311741 TTTGGGAAGCAGAGGCAGGTGGG - Intronic
923875813 1:238045776-238045798 CTTGGGGAGAAGAGGGGAGAGGG + Intergenic
924255724 1:242180873-242180895 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
924373747 1:243384698-243384720 CTTGGGAGGCTGAGGTAGGAGGG + Intronic
924497441 1:244603761-244603783 TTTGGGAATCAGAGGCAGGAGGG + Intronic
924536995 1:244943990-244944012 CTTCGGGAGGCGAGGGAGGAAGG - Intergenic
924550307 1:245069935-245069957 CTTGGGAAGCTGAGACAGGAGGG + Intronic
924740311 1:246790981-246791003 CTTGGGGAGCACGGGGAGCTGGG + Intergenic
924780317 1:247141434-247141456 GTTGGGGAGCAATGGGATGAAGG + Intronic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1063091677 10:2871026-2871048 AGTGGGGGGCAGAGGGAAGAAGG - Intergenic
1063298270 10:4827465-4827487 CTGGGGGAGGTGAGGAAGGAGGG - Intronic
1063425045 10:5944138-5944160 TTTGGGAGGCTGAGGGAGGAGGG + Intronic
1063570423 10:7210401-7210423 ACTGGGCAGCAGAGGCAGGAGGG + Intronic
1063595057 10:7427529-7427551 CTAGGGCAGCTGAGGCAGGAGGG - Intergenic
1063609987 10:7553908-7553930 CTTGGGGGGCAGAGGTGGGTTGG - Intergenic
1063632718 10:7749053-7749075 CTTGGGGAGCAGCGATAGGTGGG + Intronic
1063959755 10:11297440-11297462 CTTGTGGAACAGAGGGACCAGGG + Intronic
1064011182 10:11737788-11737810 GTGGGTGAGCAGAGGGAGGGAGG - Intergenic
1064048097 10:12037190-12037212 CTTGGGGGGCTGAGGCAGGTGGG - Intronic
1064219651 10:13429763-13429785 TTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1064365741 10:14706333-14706355 CTTGGGGGGCTGAGGCAAGAGGG - Intronic
1064402871 10:15035766-15035788 CTTGGGGAGAAAGGGGAGCATGG + Intronic
1064408274 10:15083723-15083745 TTTGGGAAGCAGAGGTAGGCAGG - Intronic
1064442159 10:15363828-15363850 GTTGGGGAATAGAGGGAGGGAGG - Intronic
1064555037 10:16539452-16539474 CTTGTGGAACAGAGGAAGGCAGG + Intergenic
1065042497 10:21711636-21711658 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1065126784 10:22581486-22581508 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1065181567 10:23131343-23131365 GTTGGAGGGCAGAGGGTGGAAGG + Intergenic
1065353479 10:24816465-24816487 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1065516224 10:26527050-26527072 CTTGGTGGGCTGAGGGAGGCTGG - Intronic
1065676735 10:28183544-28183566 TTTGGGAAGCTGAGGCAGGAGGG + Intronic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1065949440 10:30638611-30638633 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1066058982 10:31705965-31705987 AATGGGGAGCAGAGGGATGGGGG - Intergenic
1067085932 10:43238087-43238109 TTTGGGGGGCGGAGGGAGGGGGG + Intronic
1067139737 10:43647321-43647343 CTTGGGAGGCCGAGGCAGGAGGG - Intronic
1067307380 10:45077053-45077075 TTGGGGGAGCACAGGAAGGAAGG + Intergenic
1067346971 10:45444026-45444048 GTTGGGGGGCACGGGGAGGACGG + Intronic
1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG + Intergenic
1068414276 10:56697382-56697404 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
1068547001 10:58358866-58358888 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1068769637 10:60806644-60806666 CTTAGGAAGCTGAGGCAGGAAGG - Intergenic
1068867655 10:61911743-61911765 CTTGGGGGGCAGCGGGCAGAAGG + Intronic
1069417703 10:68215628-68215650 ATTGGGGATCAGAGGGAAAATGG + Intergenic
1069524255 10:69153594-69153616 TTTGGGAGGCAGAGGCAGGAAGG - Intronic
1069626384 10:69870418-69870440 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1069807087 10:71132801-71132823 ACAGGGGAGAAGAGGGAGGATGG - Intergenic
1069919125 10:71805782-71805804 TGTGGGGAGCATGGGGAGGAAGG - Intronic
1070077077 10:73146993-73147015 TTTGGGAAGCAGAGGTGGGAGGG + Intronic
1070210151 10:74309612-74309634 TTTGGAGAGCAGAGGTAGCAGGG + Intronic
1070211225 10:74324270-74324292 TTTGGGAGGCAGAGGCAGGAGGG - Intronic
1070225275 10:74497721-74497743 CTTGGGAGGCAGAGACAGGATGG + Intronic
1070610173 10:77927110-77927132 CCTGGGGAGGGGAGAGAGGAGGG - Intergenic
1070613187 10:77948644-77948666 TTTGGGGTGCTGAGGCAGGAGGG - Intergenic
1070750035 10:78958581-78958603 CTTGGAGAGCAGAGAGAGCAGGG + Intergenic
1070794733 10:79210042-79210064 CTGGGGGGGCGGAGGGAGAAGGG - Intronic
1070812590 10:79305838-79305860 CGTGGGGAGCAGCAGGTGGAGGG - Intronic
1070829507 10:79409850-79409872 TTGGAGGAGCAGGGGGAGGACGG + Intronic
1070840252 10:79481571-79481593 TTTGGGGGTCAGAGGAAGGAAGG + Intergenic
1070868667 10:79727981-79728003 TTTGGGGTGCAGAGGAAGGATGG + Intergenic
1070899055 10:80011766-80011788 CTTGGGAAGCTGAGGTGGGAGGG + Intergenic
1071237427 10:83665415-83665437 CTTGGGAGGCTGAGGCAGGAAGG + Intergenic
1071635580 10:87250196-87250218 TTTGGGGTGCAGATGAAGGATGG + Intergenic
1071659659 10:87487778-87487800 TTTGGGGTGCAGATGAAGGATGG - Intergenic
1071706976 10:88009735-88009757 CTTGGGAAGCTGAGGCAGAAGGG - Intergenic
1072153239 10:92700169-92700191 AGTGGGGAGCAGAAGAAGGATGG - Intergenic
1072225044 10:93361105-93361127 GTTGTGGGGTAGAGGGAGGATGG + Intronic
1072279335 10:93851856-93851878 TTTGGGAGGCAGAGGCAGGAGGG - Intergenic
1072304811 10:94096832-94096854 TTTGCTGAGCAGAGGGATGAAGG + Intronic
1072597225 10:96885487-96885509 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1072669911 10:97421749-97421771 CTTGGGAGGCAGAGGCAGAATGG + Intronic
1072686803 10:97542430-97542452 GTGGGAGAGCAGAGGGAGGGAGG - Intronic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072699873 10:97633114-97633136 GTTAGCGAGCAGAGGGTGGAGGG - Intronic
1072724268 10:97801790-97801812 CTGGGTGAGAAGGGGGAGGATGG + Intergenic
1072785036 10:98273562-98273584 CTGGGGGTGCAGGGGGAAGAGGG - Intergenic
1072804830 10:98417726-98417748 CCTGGGGAGGAAGGGGAGGATGG + Exonic
1072808979 10:98445259-98445281 CCTGGGGAGGACAGGGAGGCAGG - Intronic
1072851517 10:98898557-98898579 CTAGGGGCTCAGAGGAAGGAAGG + Intronic
1072917237 10:99545556-99545578 GAGGGGGAGCAGTGGGAGGAGGG + Intergenic
1073070182 10:100788371-100788393 CTGGAGGGGCAGTGGGAGGAGGG + Intronic
1073218007 10:101847358-101847380 CTTGGGCAGCAGGGGCAGGAGGG - Exonic
1073323330 10:102628605-102628627 CTGGGGGAGCAGAGGAAAGTAGG + Intronic
1073632016 10:105158663-105158685 GTTGGGGGGCAGAGGCAGGAGGG + Intronic
1074124934 10:110521355-110521377 CTTGGGATGCGAAGGGAGGACGG - Intergenic
1074196594 10:111192525-111192547 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1074496590 10:113984777-113984799 CTTGGGGAGCAGGATAAGGAAGG - Intergenic
1074748346 10:116558300-116558322 CTTGGGAGGCTGAGGCAGGATGG - Intronic
1074911736 10:117916301-117916323 CTTGGGGAGGGGAGACAGGAGGG + Intergenic
1074941215 10:118237326-118237348 CTGGGGGACCAGAGGCTGGAAGG - Intergenic
1074969993 10:118528286-118528308 CTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1075400726 10:122159667-122159689 GGTGGCGAGCAGAGGGAGGCTGG - Intronic
1075403406 10:122177459-122177481 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1075520960 10:123143234-123143256 GCTGGGGAGCGGAGGAAGGATGG + Intergenic
1075794173 10:125107049-125107071 CTTGGGGGGTGGAGGGAGGCTGG + Intronic
1075799153 10:125142042-125142064 CCTGGGGAGCCCAGGGAGCATGG + Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076058064 10:127391792-127391814 CTTGGGGAGGAGAGTGGGTAGGG - Intronic
1076236692 10:128869036-128869058 CTCGGGAAGCTGAGGAAGGAGGG - Intergenic
1076361116 10:129889506-129889528 TTTGGGGAGCAGGTGGATGATGG - Intronic
1076462693 10:130657194-130657216 CTTGGGGGGCAGAGGGCTCAGGG + Intergenic
1076583613 10:131531339-131531361 CATGCTGAGCTGAGGGAGGAGGG + Intergenic
1076644660 10:131944666-131944688 ACTGGACAGCAGAGGGAGGACGG - Intronic
1076667676 10:132102402-132102424 CATGGGGTACAGAGGGAGGAAGG - Intergenic
1077003980 11:342189-342211 TTTGGGAGGCTGAGGGAGGAGGG - Intergenic
1077143805 11:1036097-1036119 CGTGGGGGGAAGAGGGGGGAAGG - Intronic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077227458 11:1444655-1444677 CCTGGGGAGCGGAGGGAGAGGGG - Intronic
1077280433 11:1742538-1742560 CTAGGGGAGCAGCAGGAGGAAGG + Intronic
1077329613 11:1978277-1978299 CTTGAGGTGCAGAGAGAGGATGG + Intronic
1077344212 11:2038978-2039000 CATGGAGGGCACAGGGAGGAGGG + Intergenic
1077403251 11:2369257-2369279 CTTGGGGGGCAGGGAGGGGAGGG - Intergenic
1078022847 11:7669907-7669929 CTAGGGTAGCACAGGGAGGCAGG - Intronic
1078383588 11:10866632-10866654 CTTGGGAGGCTGAGGGGGGAGGG + Intergenic
1078529719 11:12127615-12127637 CTTTGGGAGCACAGGGAAGGAGG + Intronic
1078530167 11:12130956-12130978 CTGGAGGAGCAGAGGCCGGAGGG + Intronic
1079398322 11:20085084-20085106 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1079497887 11:21066844-21066866 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1080181455 11:29431175-29431197 TTTGGGAGGCAGAGGGAGCAAGG - Intergenic
1080326935 11:31085973-31085995 TTTGGGAGGCTGAGGGAGGAGGG - Intronic
1080419163 11:32094803-32094825 AATGGGGACCAGAGGCAGGACGG + Intronic
1080428651 11:32178738-32178760 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1080497493 11:32834094-32834116 CTTGGGGACCAGACAGAGAAGGG + Intronic
1081551333 11:44115295-44115317 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1081714066 11:45236110-45236132 GCTGGGGAAAAGAGGGAGGAAGG - Intergenic
1081737836 11:45416717-45416739 CATGGGGAAGAGAGGGAGGAAGG - Intergenic
1081772893 11:45660721-45660743 CTAGGGGAGGAGATGGAGGGGGG - Intronic
1081994084 11:47352547-47352569 ATTGGGGAGCAGGGCTAGGAGGG - Intronic
1082029236 11:47592972-47592994 CTTGGTTAGGACAGGGAGGAGGG + Intronic
1082740064 11:56900964-56900986 CCTGTGAAGCAGAGGGAGCAAGG + Intergenic
1082858520 11:57831109-57831131 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1082953612 11:58845356-58845378 CTTGGGAAGCTCAGGCAGGAGGG + Intronic
1083052281 11:59788004-59788026 CGTGGGAAGCAGGAGGAGGATGG - Intronic
1083064039 11:59905201-59905223 CTTGGGGCGAAGAGTGGGGAGGG - Intergenic
1083156742 11:60828047-60828069 ACAGGGGAGCCGAGGGAGGAGGG + Intergenic
1083250660 11:61464466-61464488 CTTTGGGAGCTCAGGGAGGAAGG - Intronic
1083270421 11:61569500-61569522 CTGGGGCAGCAGAGGGAGCCAGG + Intronic
1083308845 11:61774409-61774431 CTTGGGAAGCTGAGGCAGGCAGG + Intronic
1083469539 11:62873909-62873931 CTTGGGAAGCTGAGGTGGGAGGG - Intronic
1083581369 11:63827437-63827459 GGTGGGGAGCAGGGGGAGGGTGG - Exonic
1083735540 11:64678232-64678254 GATGGGGAGGAGAGGGAAGAGGG - Intronic
1083771265 11:64868976-64868998 CTTGGAGGGCCGCGGGAGGATGG + Intronic
1083942350 11:65903190-65903212 CTGGGGCAGCTGAGGGAGCAGGG + Intergenic
1084235223 11:67783589-67783611 TTTGGGAAGCCGAGGCAGGAGGG + Intergenic
1084353388 11:68620043-68620065 TTTGGGAAGCTGAGGAAGGAGGG + Intergenic
1084415366 11:69029264-69029286 TTTAGGAAACAGAGGGAGGAGGG - Intergenic
1084462558 11:69303996-69304018 ATTAGGGAGCAGGGGAAGGATGG + Intronic
1084475660 11:69387199-69387221 CTGACCGAGCAGAGGGAGGAAGG - Intergenic
1084593757 11:70105210-70105232 CTTGGAGAGCAGGGAGAGCAGGG + Intronic
1084612439 11:70212211-70212233 CTTGGGGTGGATAGTGAGGAAGG - Intergenic
1085071193 11:73547552-73547574 CTTGGGATGCAGAGGCAGGAGGG + Intronic
1085082030 11:73643048-73643070 TTTGGGAAGCTGAGGAAGGAGGG + Intergenic
1085263410 11:75222124-75222146 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
1085411270 11:76292108-76292130 CTTGGGGACTGGAGGGAGCAGGG - Intergenic
1085488256 11:76887150-76887172 CTTGGGAGGCTGAGGTAGGAAGG + Intronic
1085508607 11:77074071-77074093 CTTAGGGAGCAGATGGAGGATGG + Intronic
1085519764 11:77131028-77131050 CTTGGGGAGCAGTGACTGGAGGG + Intronic
1085587675 11:77726406-77726428 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
1085681085 11:78575450-78575472 GTTGGAGGGCAGAGGGAAGAGGG - Intergenic
1085732313 11:79010385-79010407 CTTGGGGAGGCCAGGGAGGCCGG + Intronic
1085973284 11:81620765-81620787 CTTGTAGAGCAAGGGGAGGAGGG + Intergenic
1086036230 11:82417903-82417925 CTTGGGCGGCTGAGGTAGGAGGG + Intergenic
1086177397 11:83907943-83907965 CTTGGGAAGCTGAGGAGGGATGG - Intronic
1086338903 11:85827230-85827252 CTTGGGGAATAGAGGTGGGAAGG - Intergenic
1086383375 11:86283024-86283046 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1086480924 11:87237797-87237819 AGTGGGGAGCAGGGGGAGGTGGG - Intronic
1087054457 11:93919992-93920014 CATGGGGAGTGGTGGGAGGATGG + Intergenic
1087669576 11:101089679-101089701 TTGAGGGAGAAGAGGGAGGAAGG + Intronic
1087905838 11:103696166-103696188 GCTGGGGAGGGGAGGGAGGAGGG - Intergenic
1088214846 11:107496602-107496624 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1088285171 11:108180217-108180239 CTTGGGAAGCTGAGGTGGGAGGG + Intronic
1088453887 11:110013506-110013528 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1088622241 11:111697746-111697768 CTTTGGGTGCTGAGGCAGGAGGG + Intronic
1088644312 11:111904543-111904565 CTTGGGAAGCTGAGGCAGGAAGG + Intergenic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1088691851 11:112335075-112335097 CTTGGGGAGAAGTGGCAGGCAGG + Intergenic
1088729961 11:112671698-112671720 CTTGGGGAGCAGGGGGTTAAGGG - Intergenic
1088823198 11:113474221-113474243 CTTGAAGAGCAGAGGTAAGAGGG - Intronic
1088928230 11:114323447-114323469 CTTGGGGACAAGAGAGAGCATGG + Intergenic
1088929762 11:114339844-114339866 TATGGGGAGCAGAGGGTGTATGG + Intergenic
1088986613 11:114914746-114914768 CTTGGGAAGCAGAGAGATGAAGG - Intergenic
1088988064 11:114927363-114927385 CTAGGGGGGCAGAGGTAGTAAGG + Intergenic
1089037270 11:115407760-115407782 CTTGGGAAGCCAAGGAAGGAGGG + Intronic
1089320593 11:117624248-117624270 GATGGGGAGCAGAGCCAGGAGGG + Intronic
1089356320 11:117856385-117856407 CTTCGGGAGCAGGGGGAGGGAGG - Intronic
1089380659 11:118028873-118028895 TTGGGGGAGAAGAAGGAGGAGGG + Intergenic
1089395609 11:118134948-118134970 CCTGGGGAGGAAAGAGAGGATGG + Exonic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1090078870 11:123597332-123597354 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1090188353 11:124752370-124752392 CTTGGGGAGAAGAGGAAGGAAGG - Intergenic
1090266907 11:125359071-125359093 CTGTGGGAGCAAAGGCAGGAAGG + Intronic
1090267804 11:125364501-125364523 CTTGGGATGAAGAGGGATGAAGG - Intronic
1090351296 11:126110163-126110185 CGTGGGGAGGACTGGGAGGATGG + Intergenic
1090441539 11:126728937-126728959 CTTTCGGGGCAGAGGGAGGAGGG + Intronic
1090483906 11:127094781-127094803 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
1202812592 11_KI270721v1_random:33456-33478 CTTGAGGTGCAGAGAGAGGATGG + Intergenic
1202827198 11_KI270721v1_random:94167-94189 CATGGAGGGCACAGGGAGGAGGG + Intergenic
1091498449 12:991677-991699 CTTGGGGAGCGGAGGGGGGGAGG + Intronic
1091682289 12:2535596-2535618 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1092198290 12:6563424-6563446 TTTGGGGCTCAGCGGGAGGAAGG - Exonic
1092277554 12:7073282-7073304 CTTTGGGAGGCCAGGGAGGATGG + Intergenic
1092496816 12:9004578-9004600 CTTGGGAGGCAGAGGCAGGGAGG - Intronic
1092618824 12:10240166-10240188 CTTGGGGGGCTGAGGTAAGAAGG - Intergenic
1092624315 12:10310225-10310247 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1092682834 12:11006488-11006510 CTTGGCAAGCTGAGGCAGGAAGG - Intronic
1092713466 12:11363284-11363306 CTTGGGGAGAAGAGAGAATATGG + Intronic
1092730030 12:11522666-11522688 TTTGGGAAGCTGAGGCAGGATGG + Intergenic
1093203178 12:16214514-16214536 TCTGGGGAGCAGAAGGAGGGTGG + Intronic
1094186296 12:27646484-27646506 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
1094211599 12:27899101-27899123 CTTTGGGAACAGGGAGAGGATGG - Intergenic
1095394162 12:41743453-41743475 CTTGGGAAGCTGAAGCAGGAGGG - Intergenic
1095506887 12:42907751-42907773 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
1095595183 12:43950825-43950847 CTTGTGGAACAAAGGGAAGATGG + Intronic
1095616389 12:44194721-44194743 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1095943652 12:47741405-47741427 CCCAGGGAGAAGAGGGAGGAGGG - Intronic
1096134058 12:49185119-49185141 GTTGGGGAGGGGATGGAGGAAGG - Exonic
1096216689 12:49801659-49801681 GGTGGGGAGCACTGGGAGGAGGG + Intronic
1096276336 12:50211398-50211420 TTTGGGAGGCAGAGGCAGGAGGG + Intronic
1096332544 12:50726741-50726763 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1096583369 12:52602648-52602670 CTGGGGGAGCAGAGGAGGGAAGG - Intergenic
1096688180 12:53303012-53303034 CCTGAGGAGCATAGGGAGGTGGG - Exonic
1096742967 12:53707682-53707704 CTTGGGGGGCCAAGGCAGGAGGG - Intergenic
1097861715 12:64524406-64524428 CTTGGAGGACAGAGGGAAGAGGG - Intergenic
1098900223 12:76104737-76104759 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
1098904889 12:76151664-76151686 CCTGGGAGGCAGAGGGAGGTTGG + Intergenic
1098995736 12:77117401-77117423 CTTAGAGAGCAGGGGGAAGATGG - Intergenic
1099640788 12:85280664-85280686 CTTTGGGGGCGGAGGGCGGAGGG + Intronic
1099785017 12:87251109-87251131 CTTGGGAAGGAAAGAGAGGAAGG - Intergenic
1100593236 12:96049100-96049122 CTTTGGGAACAGAGTGAGAAAGG - Intergenic
1100635382 12:96430553-96430575 CTTGGGAGGCTGAGGGAGGAGGG + Intergenic
1100691772 12:97046071-97046093 CATTGGGAGCAGAGAAAGGAGGG - Intergenic
1100911408 12:99367128-99367150 CGTGGGGAGAGGAGTGAGGAGGG + Intronic
1101001013 12:100357183-100357205 GGTGGGGAGCAGAGAGAGGAGGG + Exonic
1101316343 12:103632498-103632520 CTTGGGGAGCTGAGGCTGGTGGG + Intronic
1101679656 12:106953294-106953316 CTTGGGAAGTTGAGGCAGGAAGG - Intergenic
1101758187 12:107637956-107637978 ATAGGTGAGCAGAGGGAGGCAGG + Intronic
1101762589 12:107671059-107671081 CTTGGGGAGCAAAAGTACGAGGG + Intergenic
1101763318 12:107676959-107676981 CATGAGAAGCAGAGGAAGGATGG - Intergenic
1101821810 12:108190412-108190434 CTTGGGGGGCAGAGGCAGTTCGG - Intronic
1101859835 12:108474190-108474212 CTTGGGGAGCAGGGGCCGGGTGG - Intergenic
1102274951 12:111574663-111574685 TTTGGGAAGCCAAGGGAGGAGGG - Intronic
1102288827 12:111682388-111682410 CTTGGGAGGCTGAGAGAGGAAGG + Intronic
1102366709 12:112343524-112343546 CTTGGGGAGACCAGGGAGGGAGG + Intronic
1102462782 12:113110202-113110224 GCTGGGGAGGAGGGGGAGGAGGG + Intronic
1102596647 12:113998043-113998065 CTTGGGAGGCAGAGGCAGGAGGG - Intergenic
1102649217 12:114425599-114425621 TTTGGGGAGCATAGGGGGTAGGG + Intergenic
1102655804 12:114481333-114481355 CTGGCGCTGCAGAGGGAGGAAGG + Intergenic
1102765918 12:115432976-115432998 CTTGTGGAGCTGTGTGAGGATGG + Intergenic
1102879387 12:116472612-116472634 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1102957007 12:117065291-117065313 CTGGGGGAGCAGAGGAAGAAGGG + Intronic
1102966935 12:117135151-117135173 ATTCAGGAGCAGAGGCAGGAGGG - Intergenic
1102978221 12:117221751-117221773 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1103033949 12:117641339-117641361 CTTGGGAGGCAGAGGCAGGTGGG - Intronic
1103460609 12:121101800-121101822 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1103507911 12:121453942-121453964 CTTGGGGAGCAGACGGAGGTGGG - Intronic
1103610410 12:122120724-122120746 CTTCAGGAGCAGGGGAAGGAGGG + Intronic
1103705892 12:122872134-122872156 GGTGGGGAGCAGAGGCAGCATGG - Intronic
1103855120 12:123962641-123962663 GATGGGGAGTAGAGAGAGGAAGG + Intronic
1103923942 12:124413494-124413516 CTTGGGGACACGAGGCAGGAAGG + Intronic
1104007306 12:124902676-124902698 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1104088275 12:125494441-125494463 TTTGGGGAGGAGGGGGAGGAGGG - Intronic
1104192040 12:126491270-126491292 CTTGGGAAGCTGAGGTGGGAGGG - Intergenic
1104482176 12:129117257-129117279 CTAGGGGTTCAGGGGGAGGAGGG + Intronic
1104872469 12:132009769-132009791 TTTGGGAAGCTGAGGCAGGAGGG - Intronic
1105035900 12:132920776-132920798 CTTGGGAAGCTGAGGCAGAAGGG - Intronic
1105345215 13:19565073-19565095 GTTGGGGAGCGGAGCGGGGAGGG - Intergenic
1105796346 13:23857460-23857482 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1106148967 13:27079501-27079523 CTAGGGGAGGAGCTGGAGGAAGG + Intronic
1106158244 13:27177245-27177267 CTAGGGGAGAAGGTGGAGGAGGG + Intergenic
1106234187 13:27847864-27847886 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1106313995 13:28577783-28577805 TTTGGGGAGCAGAGCTAGAATGG - Intergenic
1106353512 13:28956944-28956966 GTTGGGGGACAGAGGGAAGAAGG + Intronic
1106795677 13:33202539-33202561 TTTGCGGAGCCTAGGGAGGAAGG + Intronic
1107014544 13:35697554-35697576 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1107668568 13:42718385-42718407 AGTGGGGAGGATAGGGAGGAAGG + Intergenic
1108025125 13:46169690-46169712 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1108352040 13:49596618-49596640 CTTGTCGAGCAGAGGGTGGGGGG + Intergenic
1109150042 13:58835735-58835757 AGTGGGGAGCAGAGGGAGGGAGG - Intergenic
1109867497 13:68284407-68284429 CTTGGGGTGGGGAGGGGGGAGGG + Intergenic
1110091370 13:71452368-71452390 TTTGGGAAGCAGAGGCAGGCAGG - Intronic
1110267831 13:73558487-73558509 CTTGGGAGGCTGAGGGAGGGAGG + Intergenic
1111420178 13:88000715-88000737 CATAGGGAGCAGAGAGATGAAGG - Intergenic
1111475097 13:88735490-88735512 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
1111701013 13:91689058-91689080 CTTGGGAAGTTGAGGCAGGAGGG + Intronic
1111823881 13:93244597-93244619 TTTGGGGAGCAGTGGGGAGAAGG - Intronic
1112030094 13:95448979-95449001 TTTGGGAAGCCGAGGGAGGCAGG - Intronic
1112036500 13:95501419-95501441 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1112318048 13:98382117-98382139 CTTGGGAAGCTGAGGTGGGAGGG + Intronic
1113626515 13:111851994-111852016 TTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1113968223 13:114166837-114166859 CGTGGTGAGGAGAGGGAGCAGGG - Intergenic
1114314607 14:21497923-21497945 TTTGGGAAGCCGAGGTAGGAGGG - Exonic
1114444039 14:22774320-22774342 CAGGTGGAGCAGAGGTAGGATGG + Intronic
1114773570 14:25455993-25456015 CCTGGGGAGGAAAGGAAGGAAGG - Intergenic
1114788016 14:25623331-25623353 CTTCTGCAGCAAAGGGAGGAAGG + Intergenic
1115106114 14:29763468-29763490 GGAGGGGAGGAGAGGGAGGAAGG + Intronic
1115127226 14:30010512-30010534 CTTGGGGAGCAGGGGCAGGAGGG + Intronic
1117143434 14:52812504-52812526 TTTGGGAAGCTGAGGTAGGAAGG + Intergenic
1117373343 14:55098657-55098679 TTTGGGAAGCTGAGGCAGGAAGG + Intergenic
1117726744 14:58682240-58682262 CCTGGGGAGCAAAGGGAGGGAGG - Intergenic
1118633008 14:67723339-67723361 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1118715828 14:68559486-68559508 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1118765506 14:68906878-68906900 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1118779460 14:68997419-68997441 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
1118781477 14:69011458-69011480 TTTGGGGGGCTGAGGCAGGAGGG - Intergenic
1118830519 14:69427108-69427130 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1119041893 14:71282027-71282049 CCTGGGGAAGAGAGGGAGGTAGG - Intergenic
1119303050 14:73585895-73585917 CTTGGGAGGCTGAGGCAGGAAGG + Intergenic
1119391980 14:74296903-74296925 CTCAGGGGGCAGAGGCAGGATGG + Intronic
1119401452 14:74365405-74365427 CTGGGGGAACAGAGATAGGAGGG + Intergenic
1119749711 14:77068467-77068489 CTTCGGGAGCAGTGGCAGGAGGG - Intergenic
1119768693 14:77206630-77206652 GATGGGGAGGAGAGGGTGGAGGG - Intronic
1119799126 14:77427041-77427063 CTGGGGCAGCAGAGGGAAAATGG + Exonic
1119967819 14:78936518-78936540 CTAGAGGAGCAGGGAGAGGAAGG + Intronic
1120002842 14:79323139-79323161 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1120059693 14:79967833-79967855 TTTGGGAAGCAGAGGGGTGAGGG - Intergenic
1120061608 14:79989948-79989970 CTTGGGAAACTGAGGCAGGAGGG - Intergenic
1120802839 14:88711835-88711857 CCTGGGAAGCTGAGGCAGGAGGG + Intronic
1120820649 14:88909015-88909037 CTTGGGGATCTGAGGGTGAATGG - Intergenic
1121052748 14:90830153-90830175 GGTGGGGAGGAGACGGAGGACGG + Intergenic
1121395163 14:93615368-93615390 GGTGGGGAGAAGAGGGAGGGAGG - Intronic
1121432867 14:93899860-93899882 CTAGGGAGGGAGAGGGAGGAGGG + Intergenic
1121553616 14:94820303-94820325 CTGGGGGTGGAGAGTGAGGAGGG - Intergenic
1121912792 14:97807120-97807142 ATTGGGGAGCAGAGGAGGAAAGG + Intergenic
1121943784 14:98098888-98098910 CTGGGGCAGCAGAGGGAGAGGGG + Intergenic
1122082982 14:99279817-99279839 CTTAGGGATCAGAGGGAGCATGG - Intergenic
1122348281 14:101073636-101073658 CTGGGGCTGCAGAGGGAGGCCGG - Intergenic
1122391556 14:101391328-101391350 TTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1122449843 14:101796839-101796861 CTTGAGGAGCAGAGGCAGCAGGG - Intronic
1122600979 14:102921832-102921854 CTTGGGGGGCTGAGGCAGAACGG - Intergenic
1122646007 14:103194666-103194688 CTTGTGGAGTAGATGGAGGAAGG + Intergenic
1122647944 14:103207410-103207432 GGAGGGGAGGAGAGGGAGGAAGG - Intergenic
1122877048 14:104672428-104672450 TTTGGGAAGCAGAGGAAGGAGGG + Intergenic
1122924010 14:104891571-104891593 TTGGGGGAGCATAGGGAAGAAGG + Intronic
1123133990 14:106010855-106010877 CTTGGGGAGCAGCAGAAGGTGGG + Intergenic
1123402527 15:20002802-20002824 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1123434921 15:20247843-20247865 GGAGGGGAGGAGAGGGAGGAGGG + Intergenic
1123468172 15:20531234-20531256 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123511865 15:21009456-21009478 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1123649943 15:22469830-22469852 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123728488 15:23126444-23126466 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123740346 15:23278649-23278671 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123746652 15:23323909-23323931 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123756417 15:23400752-23400774 CTTGGGAGGCTGAGTGAGGAGGG + Intergenic
1123775461 15:23574946-23574968 CTAGTGGAGCTGAGGGAGTAAGG + Intronic
1124216142 15:27808392-27808414 GTTGGGGAGCAGAGGCAGCAAGG + Intronic
1124278920 15:28347225-28347247 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1124303779 15:28564383-28564405 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1124464295 15:29922088-29922110 CTTTGGGAGCCTAGGGCGGATGG - Intronic
1124596892 15:31098750-31098772 CTGGGGGAGCAGACACAGGATGG + Intronic
1124950545 15:34315477-34315499 CTTAGGAAGCTGAGGCAGGAGGG + Intronic
1125358863 15:38845191-38845213 TTTGGGAAGCTGAGGTAGGAGGG + Intergenic
1125386109 15:39138615-39138637 CTTGGGAAGCTGAGGTGGGAAGG - Intergenic
1125431467 15:39599031-39599053 CTTGGGAGGCTGAGGCAGGAGGG - Exonic
1125432239 15:39607175-39607197 CTTGGGGAGCAGGGTCAGGTGGG - Intronic
1125540750 15:40468595-40468617 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
1125700015 15:41674132-41674154 CTTGGGAAGCTGAGGTAGGTGGG - Intronic
1125802860 15:42465518-42465540 CTTTGGGAGCCCAGGGTGGAAGG - Intronic
1125868865 15:43079221-43079243 CTTGGGAGGCCGAGGCAGGAGGG + Intronic
1125898113 15:43319694-43319716 CTTTGGGAGCACAAGGAGGGAGG - Intergenic
1125987871 15:44073024-44073046 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1126169057 15:45679331-45679353 TTTGGGGTGCAGATTGAGGATGG + Intronic
1126265054 15:46744470-46744492 TTTGAGGAGCTGAGGGAAGAAGG - Intergenic
1126673643 15:51138211-51138233 CTTGGGTGGCAAAGAGAGGAAGG + Intergenic
1126752976 15:51895998-51896020 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1126816346 15:52459003-52459025 TTTGGGGGGCAGGGGGAGAAGGG + Intronic
1126876378 15:53045945-53045967 CTTGGGAGGCTGAGGGAGGCAGG - Intergenic
1127054972 15:55121953-55121975 CTTGGGAAGCTGAGGCAGAATGG + Intergenic
1127157089 15:56139600-56139622 TTTGAGGAGCAGAGAGAAGAAGG - Intronic
1127262349 15:57335550-57335572 GCTGGAGAGCAGAGGGAGAACGG - Intergenic
1127386076 15:58468253-58468275 CTGGGGAAGCAGAGAGAGCAAGG - Intronic
1127513384 15:59666246-59666268 TTTGGGGAGCAGGGGAAGAAGGG - Intronic
1127877725 15:63125075-63125097 CTTAGGGAGTCCAGGGAGGAAGG + Intronic
1128068548 15:64779231-64779253 CTGGGGGTGGAGAGTGAGGATGG - Intergenic
1128071032 15:64797360-64797382 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1128278216 15:66372226-66372248 CTTGAGGAAGAGAGTGAGGAAGG - Intronic
1128904177 15:71452455-71452477 CTTTGAGAGCTGAGGGAGGAGGG - Intronic
1128916523 15:71567656-71567678 CTTCAGGAGCTGAGAGAGGAAGG + Intronic
1129006607 15:72378909-72378931 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1129114778 15:73359208-73359230 CTGGGGGAGCAGTGGGTGGAGGG + Intronic
1129174826 15:73832463-73832485 CTTTGGGAGCAGAGGGAATATGG - Intergenic
1129347270 15:74930615-74930637 CTTTGGGAGCCAAGGGAGGAAGG - Intronic
1129538949 15:76335969-76335991 GTGGTGGAGGAGAGGGAGGAGGG + Intergenic
1129696417 15:77742953-77742975 CTTGGGGTGCGGTGAGAGGATGG + Intronic
1129785429 15:78306918-78306940 CTTGTGGGGCAGAGTGAGGGTGG - Intergenic
1129791015 15:78340590-78340612 GTTGGGGAGCCCAGGCAGGAGGG + Intronic
1129824928 15:78628668-78628690 CCTGGGAAGCACAGTGAGGAAGG - Intronic
1129875540 15:78973216-78973238 CTTGGGGGGCAGAGTGTGGGTGG + Intronic
1129888949 15:79058365-79058387 CTTCGGCAGCAGATCGAGGATGG - Exonic
1129968538 15:79757813-79757835 CTGGGGGACCAGAGGCAGCACGG + Intergenic
1130022888 15:80245766-80245788 TTTGGGCAGCAGAGGTAGGCAGG - Intergenic
1130070089 15:80639830-80639852 CTTGTAGTGAAGAGGGAGGATGG + Intergenic
1130684652 15:86026059-86026081 CTTGGGAAGCTGAGGCAGGGGGG + Intergenic
1130721277 15:86387737-86387759 CTTGGGGACAGCAGGGAGGAAGG - Intronic
1130765968 15:86871564-86871586 CTTAGTGAACAGAGTGAGGAAGG - Intronic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1130843324 15:87722385-87722407 GGTGGGGAGCAGGGGAAGGAGGG - Intergenic
1130980866 15:88811067-88811089 CTTGGAGAACCAAGGGAGGAAGG - Intronic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1131243156 15:90765999-90766021 CTTAGGAAGCTGAGGGAAGAGGG + Intronic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131416184 15:92260646-92260668 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1131487524 15:92834048-92834070 CCAGGAGAGAAGAGGGAGGAGGG - Intergenic
1131688109 15:94793204-94793226 CCTGGAGAGCAGAGGCAAGAGGG - Intergenic
1131963204 15:97810323-97810345 CTTGGGGGGCTGAGGCGGGAGGG + Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132049332 15:98593922-98593944 CTTGGGAGGCAGAGGGCAGAAGG - Intergenic
1132085554 15:98905554-98905576 CTTGGGAGGCTGAGGTAGGAGGG + Intronic
1132537335 16:489025-489047 CACGGGAAGAAGAGGGAGGAGGG - Intronic
1132674693 16:1116892-1116914 CCGGGGGAGCAGAGGGGGGCGGG - Intergenic
1132724971 16:1334471-1334493 GTCGGTGAGCAGAGGGAGGAGGG + Intronic
1132759519 16:1501959-1501981 CTTGGGGAGGAGAGAGGGGCTGG + Intronic
1132878997 16:2153007-2153029 CGTGTGGTGAAGAGGGAGGACGG + Exonic
1133213648 16:4277245-4277267 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1133285491 16:4688769-4688791 AGGTGGGAGCAGAGGGAGGAGGG - Intronic
1133526597 16:6611774-6611796 CTTGGGAAGCAGAGAGAGAAGGG - Intronic
1133552973 16:6876063-6876085 CTCGGGGGGCTGAGGTAGGAGGG + Intronic
1134002957 16:10796945-10796967 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1134068006 16:11241711-11241733 GTTGGGGAGATGAGGGAGAAAGG - Intergenic
1134103176 16:11467194-11467216 CTTGGGGAGGCCAAGGAGGATGG - Intronic
1134255742 16:12609980-12610002 CTTGGGAGGCTGAGGGAGGATGG - Intergenic
1134364196 16:13561623-13561645 TGTGGGGAGCTGAGGGTGGAAGG + Intergenic
1134634259 16:15780061-15780083 CTTGGGAAGGAGAGTGAAGAAGG - Intronic
1134646582 16:15872591-15872613 CTTGGGAAGCTGAGGCAAGAAGG + Intronic
1135049528 16:19181313-19181335 TTTGTGGAGCAGAAGGAGGTTGG - Intronic
1135529388 16:23239665-23239687 CTTGAGAAGCTGAGGTAGGAGGG - Intergenic
1135574205 16:23572656-23572678 CTTGGGGAGCGGGGAGATGATGG - Exonic
1135710935 16:24716559-24716581 CTTGGGGAGCTGAGGCAGAAGGG + Intergenic
1135722101 16:24826816-24826838 CCAGGGGAGCAGAGCAAGGAGGG - Intronic
1135892693 16:26371685-26371707 GTGGGGGAGGGGAGGGAGGAAGG + Intergenic
1135992799 16:27228213-27228235 CTGGGTGAGCACAGGAAGGAAGG + Intronic
1136042140 16:27588132-27588154 TTTGGGAGGCAGAGGCAGGAGGG - Intronic
1136103648 16:28013349-28013371 GCTGGCGAGCAGAGGGAGGTGGG + Intronic
1136251865 16:29010652-29010674 CTTGGAAAGCTGAGGCAGGAGGG + Intergenic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1136411828 16:30082216-30082238 TGTGGGGAGTAGAGAGAGGAAGG + Intronic
1136463368 16:30425699-30425721 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1136527752 16:30843451-30843473 CTTGGGAGGCTGAGGTAGGAGGG + Intronic
1136595573 16:31247193-31247215 CTTTGGGAGGCCAGGGAGGATGG - Intergenic
1136712207 16:32248405-32248427 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1136755707 16:32680999-32681021 CTTGGGAGGCAGAGGTGGGAGGG + Intergenic
1136774258 16:32863210-32863232 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1136812406 16:33189373-33189395 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1136818882 16:33299453-33299475 CTTGGGAGGCAGAGGTGGGAGGG - Intronic
1136825445 16:33355986-33356008 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1136830511 16:33454757-33454779 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1136849699 16:33603145-33603167 GGAGGGGAGGAGAGGGAGGAGGG - Intergenic
1136896353 16:33998304-33998326 ATCGGGGAGCAGAAGGAAGAGGG - Intergenic
1136931020 16:34418096-34418118 CTTGGGAAGCTGAGGTAGGTGGG - Intergenic
1136973553 16:34993712-34993734 CTTGGGAAGCTGAGGTAGGTGGG + Intergenic
1137011175 16:35321833-35321855 CTTGGGAGGCAGAGGTGGGAGGG + Intergenic
1137029833 16:35511961-35511983 CTTGGGAGGCAGAGGTGGGAGGG + Intergenic
1137293163 16:47065974-47065996 CTGGAGGAGGAGAGGGAGAAAGG + Intergenic
1137521930 16:49202007-49202029 CTTGGGGAACATGGGGAAGAGGG - Intergenic
1137568305 16:49548049-49548071 CCTGGGGAGTTGAGAGAGGAGGG + Intronic
1137733793 16:50709558-50709580 CATGGGGTGCATGGGGAGGATGG + Intronic
1137759306 16:50927681-50927703 CTTGGGAGGCTGAGGGAGGCAGG - Intergenic
1138311908 16:56032603-56032625 CTTAGGGGGCTGAGGTAGGAAGG - Intergenic
1138315464 16:56065923-56065945 CACAGGGAGCAGAGGGATGAAGG - Intergenic
1138323893 16:56144758-56144780 GTTGGGGAGGCGAAGGAGGAAGG + Intergenic
1138389669 16:56661303-56661325 GATGGTGCGCAGAGGGAGGAAGG - Intronic
1138447513 16:57073699-57073721 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1138611409 16:58128436-58128458 ATTTGGGATCAGTGGGAGGAAGG + Intronic
1138671387 16:58617899-58617921 CTTGGGCTGCTGTGGGAGGATGG + Intronic
1138857563 16:60712921-60712943 CTTTGGGAGGTGAGGGAGGGAGG + Intergenic
1139329380 16:66175695-66175717 CTGGGGGAGAAGAGGGAGGCCGG + Intergenic
1139354956 16:66362012-66362034 TTTGGGTTGCAGAAGGAGGAAGG + Intergenic
1139407853 16:66733595-66733617 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1139472675 16:67186693-67186715 AGTGGGGAGGAGAGGAAGGAGGG - Intronic
1139474617 16:67196846-67196868 GGTGGGCAGCAGAAGGAGGAGGG - Intronic
1139589252 16:67924324-67924346 CTTGGGGAGCAGCGGGGAGAGGG + Intronic
1139787018 16:69401587-69401609 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1139910945 16:70397282-70397304 CTTTGAGAGCACAGGGCGGACGG - Intronic
1139914582 16:70420166-70420188 CTTGTGGCCCAGTGGGAGGATGG + Intronic
1140092944 16:71852145-71852167 CTTTGGGAGCAGATGGCAGAGGG + Exonic
1140254351 16:73322125-73322147 CTCGGAGAGCAGAGGGAGGAAGG + Intergenic
1140283011 16:73572802-73572824 CTTTGGGATCCCAGGGAGGAAGG - Intergenic
1141187792 16:81800360-81800382 GTTGGGGAGCAGGGTAAGGATGG - Intronic
1141267479 16:82509919-82509941 CTTTGGGAGCAGAAAGAGCAAGG - Intergenic
1141413106 16:83849655-83849677 CCTGGGGTGCAGATGGAAGAGGG + Intergenic
1141462798 16:84187707-84187729 CTCGGGGGGCAGAGGTAGGGTGG - Intergenic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141529457 16:84636154-84636176 TTTGGGGAGCAGGGGGAAGATGG + Intergenic
1141545078 16:84761456-84761478 CATGCGGAGCAGAGTCAGGAAGG + Intronic
1141578860 16:84983486-84983508 CTTGGGCAGCACAGGCAGGGGGG + Intronic
1141692701 16:85605642-85605664 CCGGGGGTGCAGGGGGAGGATGG - Intergenic
1141713928 16:85716327-85716349 TTGGGGGAGAAGAGGGAGGGAGG + Intronic
1141737107 16:85861051-85861073 GTTGGGGAGCAGAGGCTGCAGGG + Intergenic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141842651 16:86584049-86584071 CTGAGGGGGCAGAGGCAGGATGG - Intergenic
1141942112 16:87283927-87283949 CTAGGGGAGCAATGGGAGGCAGG + Intronic
1141980720 16:87548261-87548283 CGTGTGGATCAGAGGGAGGAAGG + Intergenic
1142008260 16:87700639-87700661 GCTGGAGGGCAGAGGGAGGAGGG + Intronic
1142228691 16:88889357-88889379 CTGGGGCAGCGGAGGGAGGGAGG + Intronic
1142345172 16:89549414-89549436 CTTTGGGGGCTGAGGCAGGAGGG + Intronic
1142359156 16:89618608-89618630 CTTGGGAAGCTGAGGTGGGAAGG - Intronic
1142359516 16:89619622-89619644 GGAGGGGAGCAGAGGGAGCAGGG - Intronic
1142399885 16:89852993-89853015 CTTGAGGGTGAGAGGGAGGATGG - Intronic
1142417541 16:89950735-89950757 TTTGGGAGGCAGAGGCAGGAGGG + Intronic
1202990983 16_KI270728v1_random:12343-12365 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1203057850 16_KI270728v1_random:941355-941377 CTTGGGAGGCAGAGGTGGGAGGG + Intergenic
1203076682 16_KI270728v1_random:1125329-1125351 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1142489064 17:266272-266294 ACTGGGGAGCACAGGGATGATGG - Intronic
1142503141 17:345169-345191 CTTGGGAGGCTGAGGTAGGAGGG + Intronic
1142655983 17:1394496-1394518 CTAGGGAAGCTGAGGCAGGAGGG + Intronic
1142822219 17:2479272-2479294 CTTGTGGGGCCGAGGCAGGAGGG - Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1142898744 17:2999213-2999235 CTCGTGGAGCAGAGGAGGGAGGG - Intronic
1143088215 17:4432913-4432935 CTTGGGAGGCTGAGGTAGGAAGG - Intergenic
1143141740 17:4745088-4745110 GGAGGGGAGCAGGGGGAGGACGG - Intronic
1143393775 17:6576094-6576116 CTTGGGGAGAAGACTGGGGAAGG + Intergenic
1143407893 17:6690240-6690262 CTTGGTGAGCACAGGGATAAGGG - Intronic
1143410099 17:6703488-6703510 CTATGGGAGCAGAGAGTGGAAGG + Intronic
1143419665 17:6778936-6778958 CCTGGGGGACAGAGGAAGGATGG - Intronic
1143636023 17:8164029-8164051 TTTGGGGTCCAGAGAGAGGAGGG - Intergenic
1144036485 17:11370612-11370634 CTTGAGGAGCACAGGCAAGATGG - Intronic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1144950680 17:18991964-18991986 CCTGGGGGGCAGAGGCAGGCAGG + Intronic
1145014539 17:19387671-19387693 CTGGGGGAGCAGAAGGCTGAGGG + Intergenic
1145772024 17:27500113-27500135 CTGGGGGAGCTGAGCCAGGATGG + Intronic
1145813857 17:27781542-27781564 CTGGGAGAGCAGGGGGAAGATGG - Intronic
1145985120 17:29040769-29040791 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1146057095 17:29586963-29586985 GCCCGGGAGCAGAGGGAGGATGG + Intronic
1146067701 17:29649492-29649514 CTTGGAAAGCTGAGGGAGGTGGG - Intronic
1146099112 17:29961694-29961716 CTTGGGAAGCTGAGGTAGGAGGG - Intronic
1146175548 17:30663930-30663952 CTTGGGCAGGAAAGGGATGAGGG + Intergenic
1146421105 17:32686755-32686777 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1146510098 17:33439535-33439557 CTTGGGGAGCTGAAGAAGCAGGG - Intronic
1146627466 17:34445340-34445362 CTTGGACTGCAGAGGGTGGAGGG - Intergenic
1146662676 17:34675028-34675050 CATGTGCAGCAGAGTGAGGAGGG - Intergenic
1146832222 17:36080014-36080036 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1147185867 17:38712828-38712850 CTGGGGTGGCAGAGGGAGGGAGG + Intronic
1147343618 17:39771669-39771691 CCTGGAGTGCAGAGGGAGGATGG + Intronic
1147889186 17:43704962-43704984 CTTGCGGGGTAGAGGGAGGCTGG - Intergenic
1147894401 17:43741114-43741136 CTTGGGGAGCACAGAGGAGAGGG + Intergenic
1147948666 17:44094901-44094923 CTTGGGAAGCTGAGGTGGGAGGG - Intronic
1147959144 17:44155491-44155513 CCTGGGGAGCAGAGGTCTGAAGG + Intronic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1148098170 17:45069200-45069222 CTTTGGGAGGACAAGGAGGATGG - Intronic
1148109850 17:45138170-45138192 TTTGGGGAGAGGAGGGAGGGCGG - Intronic
1148525362 17:48327731-48327753 CTTGGGAGGCTGAGGGAGGACGG - Intronic
1148703441 17:49606397-49606419 CTTGGGGAGGCCAAGGAGGAAGG - Intronic
1148780247 17:50117448-50117470 CTGGGGGAGCTGTCGGAGGAGGG + Exonic
1148791222 17:50174074-50174096 TTTGGGAGGCAGAGGCAGGAGGG + Intronic
1148821423 17:50361943-50361965 CTTGGGAAAGGGAGGGAGGATGG - Intronic
1148852060 17:50560304-50560326 TTTGGGCAGCAGCCGGAGGACGG - Intergenic
1148856927 17:50583996-50584018 CTTAGTGTCCAGAGGGAGGAAGG + Intronic
1148860955 17:50604133-50604155 CCTGGGGAGGGGAGGGAGGGAGG - Exonic
1149005761 17:51803422-51803444 TTTGGAGAGAAGAGGGAGTAAGG - Intronic
1149304707 17:55336271-55336293 CCTGGGGAGCAGGGGGTGGCTGG - Intergenic
1149930173 17:60744113-60744135 CTTGGGGAGAAGAGCGAACAGGG - Intronic
1150130731 17:62667290-62667312 CCGAGGGAGCAGAGGGAGGTAGG + Intronic
1150228861 17:63538977-63538999 CTTGGGGAGTTTAGGGAGAAAGG + Intronic
1150250852 17:63703752-63703774 CTGGGGGAGAAGAGAGAGGTGGG + Intronic
1150439467 17:65179526-65179548 CCTGGGGAGGAGAGAGAGGGTGG + Intronic
1150550311 17:66203861-66203883 CCTGGGGAGAGGAGAGAGGAGGG + Intergenic
1150571531 17:66391148-66391170 CTTGGAGAGCAGCGGGTGGGAGG + Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150704798 17:67477181-67477203 CTTGGGGGGCTGAGGCAGGAGGG - Intronic
1151143310 17:72016160-72016182 CCTGGGGAGCAGACTGAGGGTGG - Intergenic
1151333077 17:73422611-73422633 CCTGGGGAGGAGACGGTGGAGGG + Intronic
1151427928 17:74043262-74043284 CTTGGGGAGGGGAGGCAGGGAGG + Intergenic
1151517801 17:74607626-74607648 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1151668021 17:75556679-75556701 GGTGGGGAGCTGAGGGAGGCAGG - Intronic
1151803376 17:76390812-76390834 CTTGGGGAGAAGAGGGCAGTGGG + Exonic
1151990487 17:77571088-77571110 CTTGGGGGGCAGTGAGAGAAAGG + Intergenic
1152157561 17:78644820-78644842 CTTGGGGAGAAGACGGGTGATGG - Intergenic
1152209976 17:78997908-78997930 CGTGGGAAGCTGAGTGAGGAAGG + Exonic
1152223972 17:79084237-79084259 TTTGGGGGGCTGGGGGAGGATGG - Intronic
1152303480 17:79508493-79508515 TGCGGGGAGCAGAGAGAGGAGGG - Intronic
1152371886 17:79893392-79893414 GCTGTGGAGCACAGGGAGGAAGG - Intergenic
1152400809 17:80065164-80065186 AGAGGGGAGGAGAGGGAGGAGGG - Intronic
1152447267 17:80353081-80353103 CTGGGGGAGCAGGTGGTGGAAGG + Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152471724 17:80493231-80493253 TTGGGGGAGGAGAGAGAGGAAGG + Intergenic
1152554936 17:81048478-81048500 CTTGGGGAACAAAGGGAGAGTGG - Intronic
1152730657 17:81968038-81968060 CGTGGGGATCACAGGGAGGGAGG - Intergenic
1152815742 17:82406717-82406739 CTTGGGAGGCAGAGGGTGGGAGG - Intronic
1153089138 18:1323975-1323997 CTTGGAGAGGTGAGGGAGGAAGG + Intergenic
1153205222 18:2692103-2692125 CTTGGGCTGCAGAGGTTGGAAGG - Intronic
1153211886 18:2776327-2776349 CTTGGGAAGCTGAGGTGGGAAGG - Intronic
1153283402 18:3435302-3435324 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1153671239 18:7414533-7414555 CTGGCAGAGCACAGGGAGGAGGG + Intergenic
1153810881 18:8750533-8750555 CTGGAGGTGCAGAGGAAGGAAGG + Intronic
1154111219 18:11570148-11570170 CTTGGTGTGCAGAGGGGGAATGG - Intergenic
1155073527 18:22336277-22336299 CTTCAGGTGCAAAGGGAGGAGGG + Intergenic
1155297229 18:24396678-24396700 CTTGGGGTGGGGAGGGAGGGGGG + Intronic
1155309591 18:24510617-24510639 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155505186 18:26526248-26526270 TTTGGGGAGCAGCAGGAGGAGGG + Intronic
1155523800 18:26696239-26696261 ATTGGGAAGCTGAGGGAAGATGG + Intergenic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1156019922 18:32588384-32588406 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1156356456 18:36346256-36346278 CTTGGGGGGCTGAGGCAGGAGGG + Intronic
1156463576 18:37335005-37335027 AGGGGGGAGCAGAGGGAGGGAGG - Intronic
1156986962 18:43360277-43360299 TTTGGGAAGCTGAGGTAGGAAGG - Intergenic
1157165074 18:45351460-45351482 CTTGGGGGGCTCAGGCAGGAGGG - Intronic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1157339375 18:46765751-46765773 CTTGGTGAGCAGAGAGTGTAGGG - Intergenic
1157398386 18:47364101-47364123 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1157423820 18:47568274-47568296 ATTGGGAAGCAGAGAGGGGATGG + Intergenic
1157439091 18:47696679-47696701 CTAGTGGAGCAGAGGTTGGAGGG - Intergenic
1157492881 18:48136509-48136531 CTTGGGGACGGGAGGGAGGGGGG - Intronic
1157608408 18:48940505-48940527 CTTGGGGAGGAAAGGGTGGGTGG + Intronic
1157760128 18:50256520-50256542 CTTGGGGAGCTGCTGAAGGAGGG - Intronic
1157963218 18:52179753-52179775 GTCGGGGAGCAGAGGCAGAAAGG - Intergenic
1158187226 18:54784443-54784465 AATGGGGAACAGAGGGTGGAGGG - Intronic
1158367766 18:56757859-56757881 CTTGGGGGGCTGAGGTGGGAGGG + Intronic
1158452622 18:57580726-57580748 GGTGGGGTGCAGTGGGAGGAGGG - Intronic
1158513196 18:58109676-58109698 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1158561311 18:58516109-58516131 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1159025066 18:63176154-63176176 CATGGGGAGCAATGGCAGGATGG + Intronic
1159868699 18:73736053-73736075 CATGTGGAGGAGAGGGAGAATGG + Intergenic
1160134926 18:76263691-76263713 GCTGGGGAGGAGAGGGAGGCAGG - Intergenic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1160392649 18:78546907-78546929 ATGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160400314 18:78605964-78605986 CTTAGGATGCAGAGGGAGGATGG - Intergenic
1160507330 18:79434430-79434452 CCTGGGGTGCAGAGGGAGCATGG - Intronic
1160685120 19:431019-431041 CTGGGAGAGCAGAGCGGGGAAGG - Intronic
1160738310 19:674725-674747 CTTGGGGAGCAGGGCAGGGACGG - Intergenic
1160738346 19:674832-674854 CTTGGGGAGCAGGGCAGGGACGG - Intergenic
1161116406 19:2499302-2499324 CATCTGGAGCAGAGGGAGGGAGG - Intergenic
1161214195 19:3085127-3085149 CGTGGGGAGCTGAGGAGGGAGGG + Intergenic
1161227083 19:3151648-3151670 CCTGGGAAGCAAAGGGAGGCTGG + Intronic
1161263860 19:3353819-3353841 TTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1161386306 19:3995397-3995419 CTTGGGATGCTGAGGCAGGAGGG + Intergenic
1161434488 19:4254561-4254583 CTTGGGGACCTGAGGCAGGAAGG - Intronic
1161437185 19:4270602-4270624 TTTGGGGGGCTGAGGCAGGAGGG + Intergenic
1161503820 19:4633221-4633243 CTAGGGGTAGAGAGGGAGGAGGG + Intergenic
1161530140 19:4783823-4783845 CTTTGGGAGGAGAAGGAGGGAGG + Intergenic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161792804 19:6370748-6370770 CAAGGGGAGCAGAGGGTGGGGGG + Intergenic
1161926426 19:7303597-7303619 GGAGGGGAGGAGAGGGAGGAAGG + Intergenic
1161961780 19:7527423-7527445 CTGGGGAAGCACAGGGAAGAAGG + Intronic
1162053108 19:8046845-8046867 GATGGGGAGGAGAAGGAGGAGGG - Intronic
1162080482 19:8214939-8214961 GAGGGGGAGGAGAGGGAGGAGGG + Intronic
1162311905 19:9913103-9913125 AGTGGGGTGCAGCGGGAGGAGGG - Intronic
1162328735 19:10013837-10013859 TGTGGGGAGGAGAGGGAGAATGG + Intronic
1162340337 19:10087779-10087801 ATTGGGGAGGAGAGAGAGGCAGG + Intronic
1162355367 19:10180202-10180224 CTTGGGAGGCTGAGGCAGGAGGG + Exonic
1162419175 19:10556178-10556200 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
1162774484 19:12970921-12970943 CTTGGGGGGCCGAGGCAGGCGGG - Intronic
1162795917 19:13087575-13087597 TTTGGGGAGCCGGGGGAGCAGGG + Intronic
1162798255 19:13097710-13097732 CTCGGGGCGGAGAGGGAGGGAGG - Intronic
1162832697 19:13296865-13296887 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1162983414 19:14253980-14254002 CTTGGGCAGGAAAGGGATGAGGG - Intergenic
1163000205 19:14362418-14362440 TTTGTGGGGCAGAGGCAGGAGGG + Intergenic
1163153614 19:15428558-15428580 CTTGGGGGCCTGAGGTAGGAGGG + Intronic
1163171000 19:15530997-15531019 TTTGGGAAGCTGAGGCAGGAGGG + Intronic
1163415063 19:17181317-17181339 CACGGGGAGGAGACGGAGGATGG - Intronic
1163521407 19:17794171-17794193 CTTGGGGATCTGAGGCAGGAAGG + Intergenic
1163524562 19:17812794-17812816 CTTGGGGAACACAGGGATGGGGG - Exonic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163751483 19:19080810-19080832 CTTGGGAAGCTAAGGCAGGAGGG + Intronic
1164960465 19:32424210-32424232 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
1165258439 19:34593992-34594014 CTTGGAGAGGTGAGGCAGGAGGG + Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165429964 19:35766952-35766974 GTTGGTGAGCCGAGGGAGGGAGG + Exonic
1165885930 19:39078312-39078334 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1165932898 19:39371707-39371729 CTCGGGGGGCTGAGGCAGGAAGG + Intronic
1165938401 19:39403202-39403224 CCTGAGGATCTGAGGGAGGAGGG + Intergenic
1166031275 19:40131916-40131938 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
1166147399 19:40847052-40847074 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166151548 19:40878937-40878959 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166170420 19:41024441-41024463 CTGGGGTTGCAGAGAGAGGATGG + Intergenic
1166178639 19:41091709-41091731 CTGGGGTTGCAGAGAGAGGATGG - Intronic
1166179308 19:41095738-41095760 CCTGAGGAGGAGAGGCAGGAGGG - Exonic
1166214308 19:41325568-41325590 GGTGGGGAGGAGAGGGAGGGAGG - Intronic
1166416621 19:42599915-42599937 TTAGGGGAGCAGGGGGAGCAGGG + Intronic
1166504213 19:43361423-43361445 GCTGGGGAGCAGAGGGAAGGTGG - Exonic
1166506246 19:43373335-43373357 GCTGGGGAGCAGAGGGAAGGTGG + Intergenic
1166531532 19:43546246-43546268 CTCCTGGATCAGAGGGAGGAGGG - Intronic
1166672688 19:44720855-44720877 TTTAGGAAGCAGAGGTAGGAGGG - Intergenic
1166733136 19:45069791-45069813 CCTGGGGAACAGAGGGAGGCAGG - Intronic
1166794847 19:45420029-45420051 CCTGGGGATCTGAGGGAGGAGGG - Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167323910 19:48812588-48812610 CATCTGGATCAGAGGGAGGAGGG - Intergenic
1167341323 19:48918253-48918275 CTGAGGGAGCCGAGGAAGGAGGG + Intronic
1167430121 19:49449373-49449395 CTCCAGGAGCTGAGGGAGGAGGG + Intronic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1167456519 19:49599197-49599219 TTTTGGGGGCTGAGGGAGGATGG + Intronic
1167471455 19:49678161-49678183 CCTGGCGGGCGGAGGGAGGAGGG + Intronic
1167489298 19:49782384-49782406 CTTGTGGGTCTGAGGGAGGAGGG + Intronic
1167493888 19:49806960-49806982 CTTGGGGGGGAAAGGGAGGGAGG - Exonic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167653658 19:50748822-50748844 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
1167668901 19:50838702-50838724 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1167668946 19:50838837-50838859 CTGGGGGATCTGAGGGAGGAGGG + Intergenic
1167669194 19:50839630-50839652 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1167711744 19:51115856-51115878 CCTGGGGACCAGACTGAGGAGGG + Intergenic
1167713081 19:51124348-51124370 GTTGGGGGGCACAGGCAGGATGG - Intergenic
1167801815 19:51747894-51747916 TTTGGGAAGCCGAGGTAGGAGGG + Intronic
1168153607 19:54461589-54461611 CACTGGGGGCAGAGGGAGGAGGG - Exonic
1168161525 19:54513313-54513335 TTGAGGGAGCAGAGAGAGGAAGG + Intergenic
1168231449 19:55034920-55034942 GTTGGGGTGCAGAGGGAGCCTGG - Intronic
1168254414 19:55157878-55157900 CTCCAGGATCAGAGGGAGGAGGG - Intronic
1168258793 19:55181398-55181420 CTTGAGGACCAAAGGCAGGAAGG - Exonic
1168340498 19:55620686-55620708 TTTGGGGAGTTGGGGGAGGAGGG - Intergenic
1168514819 19:57002499-57002521 CTAGGGGAGGACAGGGTGGACGG - Intergenic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
1168688204 19:58361244-58361266 AACGGGGAGCAGAGGTAGGAGGG + Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925258942 2:2512897-2512919 CTTGGGGAGTAAAGTGAGCAGGG - Intergenic
925450749 2:3967468-3967490 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
925559757 2:5178252-5178274 TTTGGGAAGAAAAGGGAGGATGG + Intergenic
925609330 2:5691373-5691395 GGCGGGGAGCAGAGGGAGAAGGG + Intergenic
925632454 2:5908793-5908815 CTCAGGGAGAAGAGGGTGGAGGG + Intergenic
925663552 2:6228542-6228564 GGAGGGGAGGAGAGGGAGGAAGG - Intergenic
926005156 2:9367651-9367673 CTTGGGAACCTGAGGTAGGAGGG + Intronic
926043850 2:9695263-9695285 CTTGGGGGACTGAGGCAGGAGGG - Intergenic
926075877 2:9942324-9942346 CTTGGGGAGCTGAGGTAGGGAGG - Intergenic
926200074 2:10788546-10788568 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
926289728 2:11518990-11519012 CTTGGGAGGCTGAGGCAGGATGG + Intergenic
926290824 2:11528607-11528629 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
926397635 2:12460368-12460390 CTTGGGAAGCTGAGGTGGGAGGG + Intergenic
926895148 2:17678666-17678688 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
927471958 2:23384135-23384157 CCGGGGGAGCGGAGGGAGGGTGG + Intergenic
927513317 2:23658084-23658106 AGTGGGCAGGAGAGGGAGGAGGG - Intronic
927841665 2:26448933-26448955 CCTGAGGAGCAGAGTCAGGATGG + Intronic
927853114 2:26512145-26512167 TTTGGGCAGCAGAAGGAGGTGGG + Intronic
927936649 2:27080023-27080045 CTTGGGGATCAGTGAGAGCAAGG - Intronic
928402274 2:30987722-30987744 GTGGGGGAGGAGGGGGAGGAGGG - Intronic
928589252 2:32797285-32797307 CTTAGGAAGCTGAGGCAGGAGGG - Intronic
929167685 2:38900082-38900104 CTTGGGAGGCTGAGGTAGGAAGG + Intronic
929499659 2:42479536-42479558 CTTGGGGGGCTGAGGCAGGAGGG + Intronic
929538327 2:42799374-42799396 CTTCGGGAGGCCAGGGAGGAAGG + Intergenic
929682225 2:44003324-44003346 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
929719011 2:44347225-44347247 CTTGGGAAGCTGAGGTGGGAGGG + Intronic
929754186 2:44750262-44750284 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
930226537 2:48799915-48799937 TTTTGGGAGGAGAGGGAGGCTGG + Intergenic
930234235 2:48873663-48873685 CTCTGGGAGCAGAGGGAGCAGGG + Intergenic
930967178 2:57343574-57343596 CTTGGGAGGCTGAGGGTGGATGG + Intergenic
931085114 2:58821419-58821441 CTTGGGGAGCAGAGAAAAGGAGG + Intergenic
931215459 2:60238426-60238448 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
931269192 2:60686895-60686917 TTTGGGAAGCTGAGGCAGGAGGG + Intergenic
931305834 2:61027228-61027250 CTTGGGAAGCTGAGGTGGGAGGG + Intronic
931420252 2:62120828-62120850 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
931846866 2:66213109-66213131 TTTGGGAAGCCGAGGCAGGAGGG + Intergenic
932128876 2:69169464-69169486 GTTGGGGTCAAGAGGGAGGAGGG + Intronic
932221135 2:69999890-69999912 CTTGGGTGGGAGAGGGAGGAAGG - Intergenic
932686758 2:73877105-73877127 CTTGGGGAGTAGAGAGAGCCAGG - Intergenic
932748397 2:74354492-74354514 AATGGGGAGGAGGGGGAGGATGG + Intronic
932794544 2:74682989-74683011 GTTGGGATGCAGAGGGAGCAGGG - Intronic
932834448 2:75023185-75023207 CAGGGGGAGTAGAGGGAGCAAGG + Intergenic
933035720 2:77394910-77394932 CTTGTGGAACAGGGGGTGGAGGG + Intronic
933481393 2:82861382-82861404 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
933665511 2:84961362-84961384 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
933792670 2:85895562-85895584 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
933837788 2:86259842-86259864 CTAGGGGAGAAGTGGGAAGAGGG + Intronic
934876232 2:97923512-97923534 CTTGAGAGGCTGAGGGAGGAGGG + Intronic
934912822 2:98274959-98274981 CCTGAGGAGCAGAGGAAGGATGG - Intronic
935121832 2:100189880-100189902 CTTGGTGAGCAGGGCAAGGAGGG + Intergenic
935466670 2:103406371-103406393 GCTGGGGAGCAGAGGCATGAGGG - Intergenic
935673685 2:105576288-105576310 CTCTGTGAGCAGGGGGAGGAGGG + Intergenic
935942375 2:108254197-108254219 CCTGGGGAGGAGATGGAGCAGGG - Intronic
936407095 2:112214545-112214567 CAAGGGGAGCAGAGGGAAGTAGG + Exonic
936912705 2:117609385-117609407 TTTGGGAAGCTGAGGCAGGAGGG + Intergenic
936918218 2:117661585-117661607 CCTGGGGACCCGAGGGAAGAGGG + Intergenic
937044645 2:118844780-118844802 CTTGGGCAGTTGGGGGAGGAGGG - Intronic
937150497 2:119682776-119682798 CTTGGAGAGGAGAGGCAGCAAGG + Intronic
937157122 2:119728919-119728941 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
937210533 2:120266601-120266623 CTTGGGAAGCTGAGGTGGGAGGG + Intronic
937273684 2:120671023-120671045 CTCTGGGGGCAGGGGGAGGAGGG + Intergenic
937726765 2:125175976-125175998 CTAGGGGAGCTGTGGGAAGAGGG + Intergenic
938014509 2:127856480-127856502 CTTGGGAGGCTGAGGCAGGATGG + Intronic
938124947 2:128664693-128664715 CTGGGGTAGCAGTGGGAGGAGGG + Intergenic
938192340 2:129295125-129295147 GTAGTGGGGCAGAGGGAGGAGGG + Intergenic
938444389 2:131366425-131366447 CTGGGGGAGCAGGGAGAGAATGG - Intergenic
939524568 2:143276688-143276710 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
939824527 2:146998850-146998872 CTTTGGGAGCTGTGGGAGCAAGG + Intergenic
939983347 2:148806596-148806618 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
940021629 2:149162037-149162059 CTTGAGGATCAGAGGAATGACGG + Intronic
940307126 2:152238539-152238561 CTTTGGGAGGACAAGGAGGAAGG + Intergenic
940746957 2:157578008-157578030 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
940849161 2:158672003-158672025 CTTGAGGAACAGAGGGAAGCCGG + Intronic
940877564 2:158913177-158913199 CTTGGGGGACTGAGGCAGGAAGG + Intergenic
941101233 2:161297836-161297858 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
941197333 2:162468956-162468978 CTTGGGAAGCTGAGGAGGGAGGG - Intronic
941445816 2:165598145-165598167 GTTGGGGAGGAGAGAGAGAAAGG + Intronic
941495467 2:166195938-166195960 CTTGGGAGGCTGAGGCAGGAGGG + Exonic
941809214 2:169738953-169738975 AAGGGGGAGGAGAGGGAGGAGGG - Intronic
941853280 2:170205767-170205789 TTTGGTCAGCAGATGGAGGATGG - Intronic
941918568 2:170828149-170828171 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918704 2:170828733-170828755 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941986821 2:171518629-171518651 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942411682 2:175716133-175716155 GTTGGTGAGCAGAGTGCGGACGG - Intergenic
942726640 2:179016189-179016211 CTTGGGGGGAAGAGTGAGGGGGG + Intronic
942787863 2:179720544-179720566 CAAGGGGAGGAGAGGGAGGGAGG + Intronic
943548512 2:189310935-189310957 AGTGGGGAGCAGGGGGAGGTGGG + Intergenic
943811846 2:192196345-192196367 CGGGGGGAGAAGAAGGAGGAGGG - Intergenic
944107716 2:196097281-196097303 TTTGGGGAGGAGAGGGAGGCTGG + Intergenic
944556925 2:200896482-200896504 CTTGGGGAGTACTTGGAGGAAGG - Intronic
944875018 2:203954479-203954501 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
944997198 2:205307083-205307105 CTTGGTGAGGAAAGGGAGGCAGG - Intronic
945213840 2:207412544-207412566 CTTGGGGAGCAAAGGGCAGCTGG + Intergenic
945474320 2:210263587-210263609 CTTGGGGGGCTGAGGCAAGATGG + Intergenic
945513858 2:210737439-210737461 CTTGGGCAGCTGAGGCAGAAGGG - Intergenic
946001995 2:216490093-216490115 CTTGGTGAGAAGTGGGAGGATGG - Intergenic
946368724 2:219267076-219267098 AGTGGGGAGAAGAAGGAGGAGGG + Intronic
946609484 2:221441948-221441970 GTGGGGGAGCAGTCGGAGGAGGG - Intronic
946643268 2:221806911-221806933 TTTGGGAAGGAGAGAGAGGAAGG - Intergenic
946698606 2:222386832-222386854 TTTGGGAAGCAGAGAAAGGAAGG - Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947257218 2:228180544-228180566 CTTGGGGAAAAGAGGGAGTAGGG + Intronic
947492910 2:230611253-230611275 CCAGGGCAGCAGAGGGTGGAGGG - Intergenic
947536473 2:230942961-230942983 CTAGGGGAACAGAAGCAGGATGG - Intronic
948202083 2:236136545-236136567 CATGGGCAGCAGAGGAGGGAGGG - Intergenic
948251865 2:236535987-236536009 CTGGGCCAGCAGAGGGAGGTGGG + Intergenic
948262243 2:236613018-236613040 CACATGGAGCAGAGGGAGGAGGG - Intergenic
948386937 2:237586301-237586323 CATGGGGTGCAGAGGGAAGCAGG - Intronic
948456425 2:238106589-238106611 CTGGAGGGGCAAAGGGAGGATGG - Intronic
948599373 2:239099713-239099735 CTTGGGGAGAAGATGGCGCATGG - Intronic
948765344 2:240216558-240216580 CCTGGGGAGCAGGGGGAGGTGGG + Intergenic
948902311 2:240962940-240962962 ATGGGGGGGCAGTGGGAGGAGGG - Intronic
948981133 2:241495420-241495442 CTGGGCCAGGAGAGGGAGGAGGG + Exonic
948987141 2:241532656-241532678 CTTGGGGAGGGGCTGGAGGAGGG + Intergenic
948995467 2:241576129-241576151 CGGGAGGAGGAGAGGGAGGAAGG - Intergenic
949020410 2:241738153-241738175 CTTCGGGAGCAGGGTGAGGGTGG - Intronic
1169941492 20:10942600-10942622 ATTGAAGAGCAGAGGGAGGAAGG - Intergenic
1170012165 20:11736084-11736106 CTTGGGAAGCAGGTGGAAGAGGG - Intergenic
1170295138 20:14816180-14816202 GTTGCGGGGCAGAGGGAGGATGG + Intronic
1170572514 20:17640559-17640581 CTTAGGGAGCAGAGTGTGGGTGG + Intronic
1170632377 20:18076570-18076592 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1170856542 20:20061702-20061724 CATGGGGAACACAGGGAGGCGGG - Intronic
1171242178 20:23580511-23580533 CTTGGGGGGAAGAGTGAGAAGGG - Intergenic
1171400305 20:24868861-24868883 GTTGGGGAGCAGGGGAAGGTGGG - Intergenic
1171573348 20:26274729-26274751 CTTGGGAGGCTGAGGTAGGAGGG + Intergenic
1171793797 20:29550881-29550903 CGTGGGGAGCGGAGGGACTAGGG + Intergenic
1171854672 20:30333510-30333532 TGTGGGGAGCAGAGGGACTAGGG - Intergenic
1171868152 20:30505616-30505638 AGGGGGGAGCAGGGGGAGGAAGG - Intergenic
1172030001 20:31975109-31975131 CCTGGGGAGAGGAGGGAGGATGG + Intronic
1172398876 20:34631945-34631967 CTTGGGTGGCTGAGGCAGGAGGG - Intronic
1172707472 20:36892546-36892568 CTTGGGGGGCTGAGGCAGGAGGG + Exonic
1172737617 20:37139739-37139761 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
1172852303 20:37975371-37975393 CATGGAGTGGAGAGGGAGGAAGG + Intergenic
1172866800 20:38106341-38106363 TTTGGGGGGCAGAGGTGGGAGGG - Intronic
1172900928 20:38334408-38334430 CCTGGAAATCAGAGGGAGGATGG - Exonic
1172997295 20:39080557-39080579 CTTAGGGAGAAGAGGGAAGGTGG + Intergenic
1173078831 20:39846672-39846694 CATTGGGAGCAGAGGGAGAAAGG - Intergenic
1173581968 20:44153527-44153549 CATGGGGAGGAGATGGAGGTGGG + Intronic
1173670168 20:44793434-44793456 ATATGGGAGCAGAGGGAGAAAGG - Intronic
1173766117 20:45611199-45611221 CCTAGGGAGTAGAGGGAGGACGG - Intronic
1174022594 20:47542852-47542874 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1174173507 20:48631041-48631063 CCTGGGGAGCAGAGGGCTGGGGG - Intronic
1174384217 20:50177153-50177175 CTTGGGAGGCAGAGGAGGGAAGG + Intergenic
1174452413 20:50628541-50628563 CATGGGGAGTGGAGGCAGGAAGG - Intronic
1174488787 20:50877614-50877636 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1174569690 20:51492686-51492708 CTTGGGGAGCAGGAGGCGGCCGG + Intronic
1174589751 20:51635627-51635649 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1174600798 20:51723243-51723265 CTTGGGGAAAAGAGTGGGGAGGG + Intronic
1174750727 20:53108949-53108971 CTTGGAGGGTAGAGGGTGGAGGG - Intronic
1174828214 20:53788447-53788469 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1174846124 20:53944849-53944871 TTTGGGGAGGAGATGGAGTAAGG + Exonic
1175196177 20:57244783-57244805 CCTGGGGAAGGGAGGGAGGACGG - Intronic
1175400192 20:58695927-58695949 TCTGGGGAGCAGCGGGAGGGAGG - Intronic
1175672317 20:60915544-60915566 CCTGGGGAGGGCAGGGAGGAGGG - Intergenic
1175844230 20:62050279-62050301 CATGGGGAGCAGAGCCAGGCCGG - Intronic
1175873084 20:62217500-62217522 CTTGGGAAGAAGAGGGAGAGAGG + Intronic
1175981820 20:62742584-62742606 TCTGGGGAGCAGAGGACGGAAGG - Intronic
1176041845 20:63069860-63069882 CTTGGGAAGCACAGGGAGGCAGG + Intergenic
1176131645 20:63498966-63498988 CCTGGGGGGCAGAGGGTGGCCGG - Intronic
1176196258 20:63837441-63837463 CTTGGGGAACAGTGAGGGGAAGG + Intergenic
1176232185 20:64038274-64038296 CCTGGGGAGGGAAGGGAGGAAGG - Intronic
1176240785 20:64074975-64074997 CCAGGGGAGCAGAGGCAGAAGGG - Intronic
1176429541 21:6567432-6567454 ATTGGAGAGCCGAGGAAGGATGG - Intergenic
1177261708 21:18737808-18737830 CTTGGGTAGCAGAAAGAGAAAGG + Intergenic
1177778255 21:25594357-25594379 CTTGGGTGGCTGAGGCAGGAGGG - Intronic
1178016379 21:28351126-28351148 ATGCGGGAGGAGAGGGAGGAAGG - Intergenic
1178170633 21:30035764-30035786 CTGGGGGGGTAGGGGGAGGAAGG + Intergenic
1178208390 21:30497609-30497631 CTTTGGGGGTCGAGGGAGGAGGG - Intergenic
1178366764 21:31994909-31994931 TTTGGGAAGCAGAGACAGGAGGG + Intronic
1178810936 21:35880800-35880822 CTGGTGGAGAAGAGGGGGGAAGG - Intronic
1178831217 21:36058391-36058413 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1178909857 21:36665826-36665848 CTTGGAGGGCTGAGGCAGGAGGG - Intergenic
1178950808 21:36983941-36983963 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1179084855 21:38207602-38207624 AGTGGGGAGGGGAGGGAGGAAGG - Intronic
1179086588 21:38223825-38223847 GGTGGGAAGCAGAGGGAGGATGG - Intronic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1179491919 21:41746374-41746396 GGTGGGGAGCAGGGGGCGGATGG + Intronic
1179674823 21:42974410-42974432 CTGGGGGAGGAGAGCGAGGGCGG - Intergenic
1179704935 21:43174894-43174916 ATTGGAGAGCCGAGGAAGGATGG - Intergenic
1180003562 21:45007607-45007629 CTCGGAGAGCAGAAGGGGGATGG - Intergenic
1180605342 22:17054842-17054864 CTTAGGAAGCTGAGGCAGGAGGG + Intergenic
1180907139 22:19422401-19422423 GTGGGGGACCAGAGGGAGGGAGG - Intronic
1181149998 22:20876363-20876385 CTTGGGAGGCAGAGGTGGGAGGG - Intronic
1181464275 22:23102390-23102412 CCCTGGGAGCAGAGGAAGGAAGG - Intronic
1181533533 22:23530440-23530462 GTGGGGGAGCAAAGGGGGGATGG - Intergenic
1181545439 22:23599688-23599710 GCTGGAGGGCAGAGGGAGGAAGG - Intergenic
1181557748 22:23681518-23681540 CTTGGGGACCAGGGGCAGGTGGG + Intergenic
1181623953 22:24109666-24109688 CTTGGGGAACACAAGGAGAAAGG - Intronic
1181772159 22:25133648-25133670 CTCGGGAAGCTGAGGCAGGAGGG - Intronic
1181814871 22:25430211-25430233 GCTGGAGGGCAGAGGGAGGAAGG + Intergenic
1181967853 22:26669092-26669114 CTTGGGGAACAGAAGGTGGCAGG + Intergenic
1182042821 22:27251480-27251502 CTTGTGGAACAGAGAGATGAGGG - Intergenic
1182098263 22:27640195-27640217 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1182207444 22:28643212-28643234 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1182431950 22:30304467-30304489 CTTGGGGAGGAGGAGGAAGAGGG - Intronic
1182537836 22:31019171-31019193 CTTGGGGAGCTGTGGTGGGAGGG - Intergenic
1182655761 22:31888655-31888677 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1183292323 22:37010405-37010427 CCTGGGGAGCAGTGGAGGGAGGG - Intergenic
1183295264 22:37025442-37025464 CTTGGAGAACTGAGGGTGGAAGG + Intronic
1183309335 22:37101022-37101044 GTTGGGGGGCAGAGGGAGCCAGG + Intronic
1183320866 22:37164312-37164334 GGAGGGGAGCAGAGTGAGGAGGG + Intronic
1183418992 22:37699294-37699316 CTTGGGAAGCACAGCGAGGGAGG - Intronic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1183693291 22:39403578-39403600 CATGGGGAGCAGATTGAGTAGGG + Intronic
1184170860 22:42759022-42759044 GTTGGGGAGCAGTTTGAGGAGGG - Intergenic
1184172738 22:42769283-42769305 CTTGAGGGGCAGAGGGTGGGGGG + Intergenic
1184380209 22:44140646-44140668 GATGAGGAGCAGAGAGAGGAAGG - Intronic
1184407353 22:44307748-44307770 CTGGGGAAGGAGAGGAAGGAGGG + Intronic
1184509327 22:44923901-44923923 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1184627511 22:45748069-45748091 CTTGGGGGGCTGAGGTGGGACGG + Intronic
1184864277 22:47193704-47193726 CTCGGGGACCCTAGGGAGGAGGG + Intergenic
1185088447 22:48753114-48753136 CATGGGGAGCAGAGGGAGCTTGG - Intronic
1185092790 22:48785336-48785358 GTTGGGGAGCAGAGTGAGAAGGG - Intronic
1185100951 22:48840586-48840608 AGTGGGGTGTAGAGGGAGGAGGG - Intronic
1185107690 22:48883579-48883601 CCTGGGAAGGAGAGGGAGTAGGG + Intergenic
1185150927 22:49163632-49163654 CATGGGGAGAGGAGGCAGGAAGG + Intergenic
1185265160 22:49898106-49898128 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1185338812 22:50282672-50282694 TGTGGGGAGCAGAGGGGGGCGGG + Intronic
1185382409 22:50516001-50516023 TGAGGGGAGCAGAGGAAGGATGG + Intronic
949477773 3:4465365-4465387 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
949706726 3:6826934-6826956 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
949918923 3:8986247-8986269 CTGGGGGCTCAGAGGGATGAGGG - Intronic
950057061 3:10033803-10033825 CTTGGGAAGCTGAGGCAGAATGG - Intronic
950083237 3:10238725-10238747 CTTTGGGAGAAGAGAGAGAAGGG - Intronic
950150573 3:10683902-10683924 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
950280703 3:11705363-11705385 CTTGGCAGGCAGAGAGAGGAGGG + Intronic
950451623 3:13068663-13068685 ATTGGGCCACAGAGGGAGGATGG - Intronic
950466387 3:13157640-13157662 CCAGGGGAGCAAAGGAAGGAAGG + Intergenic
950504058 3:13382900-13382922 TTTGGGAAGCTGAGGTAGGAGGG + Intronic
950604373 3:14065045-14065067 CTTTGGGTGCAGAGCCAGGAGGG + Exonic
950628652 3:14267017-14267039 TTTGAGGAGTGGAGGGAGGAAGG + Intergenic
950635783 3:14313506-14313528 ATTGAGGAGGAGAGGAAGGAAGG - Intergenic
950642451 3:14357131-14357153 GTAAGGGAGGAGAGGGAGGAAGG + Intergenic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
951504458 3:23427320-23427342 TTTGGGAGGCAGAGGCAGGAAGG + Intronic
951512600 3:23520748-23520770 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
951700030 3:25487010-25487032 CTTGGAGAGGAGAGAGAGGAGGG + Intronic
952374138 3:32751206-32751228 CTTGGGACGCAGAGGTGGGAGGG - Intronic
952376614 3:32772971-32772993 CTTGGGGGGCTGAGGCAGGAGGG - Intronic
952384316 3:32828740-32828762 CTTTGGGAGGACAGGCAGGAGGG - Intronic
952409178 3:33032193-33032215 CATGGGGAGCTGACTGAGGAGGG - Intronic
952456200 3:33474280-33474302 CTTGGGGGGCTGAGGTGGGAGGG + Intergenic
952777641 3:37061496-37061518 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
952832484 3:37576709-37576731 CTCGGGAGGCTGAGGGAGGATGG - Intronic
953137535 3:40195398-40195420 CTTGGGAAGCTGAGGCTGGAGGG - Intronic
953146689 3:40283074-40283096 CTTGGGAAGCTGAGGCAGAATGG - Intergenic
953184001 3:40621317-40621339 CTTGGGCAGCAGTGGGAAGAGGG + Intergenic
953289671 3:41649018-41649040 CTTGGGAAGCTGAGGCAGGCGGG + Intronic
953558174 3:43963279-43963301 CTTGGGAAGCTGAGGTGGGAGGG + Intergenic
953616245 3:44493217-44493239 ATGGGGGAGCAGGGGGATGATGG - Intergenic
953658298 3:44871497-44871519 CTTGGAGAGCAGAGAGCAGAGGG + Intronic
953821205 3:46208887-46208909 CTTGGGGAGCAGAGAGCAGAGGG - Intronic
953861772 3:46550497-46550519 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
954110439 3:48430074-48430096 GTTGGGGAGTAGTGGGAGCAGGG - Intergenic
954412067 3:50375101-50375123 CTTGTGGGTCAGAGGGAGGTTGG - Intronic
954713772 3:52517215-52517237 CTGGGGGCGCTGAGAGAGGAGGG + Intronic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
954800632 3:53185116-53185138 TTTAGGCAGCAGAGGGAGGGGGG + Intronic
955034132 3:55249842-55249864 GTTGGAGAGCAGAGGGTGGGAGG - Intergenic
955339257 3:58112326-58112348 CCAGGGGAGCAGAGGGGAGAAGG - Intronic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
955550408 3:60078850-60078872 TCTGGGGATCTGAGGGAGGAGGG + Intronic
956089373 3:65649272-65649294 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
956163061 3:66374771-66374793 CTTGGGAAGCTGAGGTGGGAGGG + Intronic
956318514 3:67967778-67967800 GTTGGGGAGCAGATGAAGTAGGG + Intergenic
956356987 3:68404687-68404709 CTTGGGAGGCTGAGGAAGGAGGG + Intronic
956484040 3:69702706-69702728 CTCCTGGAGCAGAGGGTGGAGGG - Intergenic
956665058 3:71634179-71634201 CTTGGGAGGCTGAGGCAGGACGG - Intergenic
956665157 3:71635462-71635484 ATTGGGAAGCAGTGGGAGGAGGG - Intergenic
956800905 3:72757495-72757517 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
958908703 3:99969623-99969645 ATTGGAGAGCAGAGGTAGTAAGG + Intronic
959650234 3:108744225-108744247 GTTGGGAGGCAGAGGGAGAAAGG - Intronic
960602766 3:119474427-119474449 CATGGGGAGGAGAGGGAGACAGG - Intronic
960660626 3:120054225-120054247 CTAGGGAAGGAGAGAGAGGAGGG - Intronic
960941097 3:122935314-122935336 CTGGGGGAGCAGGGGGTGGGAGG + Intronic
961096286 3:124159376-124159398 CTTGGGGGGCTGAGGTAGGAGGG - Intronic
961112764 3:124298958-124298980 AGTGGGGAGAAGTGGGAGGAGGG + Intronic
961183847 3:124897576-124897598 CTTGGGAGGCCGAGGCAGGAGGG + Intronic
961237646 3:125381303-125381325 CTTGGTGGGCTGAGGTAGGAGGG + Intergenic
961642197 3:128371678-128371700 GTTGGGGTGCAGAATGAGGAGGG + Intronic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
961824776 3:129593259-129593281 CGGGTGGGGCAGAGGGAGGAGGG - Intronic
961869768 3:129978857-129978879 CTTTTGGGGCAGAGGGAGGCAGG + Intergenic
961902936 3:130231990-130232012 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
962208091 3:133452221-133452243 CTTGGGGGATAGAGGGAGTATGG - Intronic
962246678 3:133801159-133801181 TTTGGGGAGCGGATGGAAGAAGG + Intronic
962754377 3:138456989-138457011 ATGGGAGAGCAGAGGGAGGGGGG - Intronic
962799126 3:138874871-138874893 CTTGGGAGGCTGAGGTAGGAGGG + Intergenic
963139461 3:141935603-141935625 CTTGGGAAGCTAAGGCAGGAGGG + Intergenic
963358662 3:144242243-144242265 TTTGGGGAGAAAAGGGAAGATGG + Intergenic
963690724 3:148498660-148498682 CTTGGAGATCACAGGGAGAAGGG + Intergenic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
964019361 3:151989629-151989651 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
964208238 3:154198720-154198742 CTTGGGGAGAAGGGGGAAAAGGG + Intronic
964363677 3:155926117-155926139 CTTGGGAAGCTGAGGTAGTAGGG - Intronic
964388028 3:156169993-156170015 CTTGGGCAGTAGAGGGAAAAAGG - Intronic
964636203 3:158860425-158860447 CTTGGGCACCAGTGGGAGGAAGG + Intergenic
965066094 3:163850629-163850651 CTTGTGGGGCAGGGGGTGGAGGG + Intergenic
965710063 3:171548295-171548317 CCTGGGCAACAGAGGGAGAATGG - Intergenic
966111578 3:176408809-176408831 TTTGGGGAGCATAGTGGGGATGG + Intergenic
966381802 3:179352115-179352137 CTTGCGGGGCTGGGGGAGGATGG - Intronic
966740790 3:183231560-183231582 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
966892502 3:184417451-184417473 CGGGGGGCGGAGAGGGAGGAGGG + Intronic
966905091 3:184516839-184516861 ACTGGTGGGCAGAGGGAGGAAGG + Intronic
966987994 3:185199851-185199873 CTAGGGGGGCCGAGGCAGGAAGG - Intronic
967169837 3:186814415-186814437 CTAGGGCAGCTGAGGGAAGAAGG - Intergenic
967861593 3:194155997-194156019 GTAGGGAAGCAGAGGAAGGAAGG + Intergenic
968061955 3:195732600-195732622 TTTGGGAAGCAGAGGCAGGTGGG - Intronic
968210752 3:196846773-196846795 CTTGGGAGGCCGAGGCAGGAAGG + Intergenic
968274502 3:197429656-197429678 ATCGGGGAGCTGAGGGAGGCGGG + Intergenic
968460684 4:723404-723426 CTTGGGAAGCAGAAGAAGGTGGG + Intronic
968510550 4:993639-993661 CTTAGGGACCAGCGGGAGGCGGG + Intronic
968628815 4:1639662-1639684 CTTGCAGGGCAGAGGCAGGAGGG + Intronic
968663700 4:1809655-1809677 GGAGGAGAGCAGAGGGAGGACGG - Intergenic
968703742 4:2068857-2068879 CTTGGGGAGCACAGGGGGTGGGG + Exonic
968889247 4:3359087-3359109 GGTGAGGAGGAGAGGGAGGAGGG - Intronic
968913430 4:3486923-3486945 CCCGGGGAGCAGAGGGAAGCAGG + Intronic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
969101997 4:4776413-4776435 CCTGGGGAACACAGGAAGGAAGG - Intergenic
969480589 4:7445007-7445029 GGCGGGGAGCAGAGGGAGGGCGG + Intronic
969509809 4:7611397-7611419 CTTGGGGCTGAGAGGGCGGAAGG - Intronic
969527444 4:7711051-7711073 CTTAGGGAGCACAGGGAGGCAGG + Intronic
969914398 4:10475576-10475598 CTTTGGGAGGCCAGGGAGGACGG + Intergenic
970471575 4:16384598-16384620 CTTGGGGAACGGGGGGATGAGGG + Intergenic
970754654 4:19410808-19410830 TTTGGGGAAAAGAAGGAGGAAGG + Intergenic
970889869 4:21031072-21031094 CTTGGAGACCAGATGGAAGATGG - Intronic
970938224 4:21600085-21600107 CTTGGTTAGCAGAGGGAGTAAGG - Intronic
971022174 4:22548037-22548059 CCTGGGCAGCACAGGGATGATGG - Intergenic
971035600 4:22689544-22689566 CTTGGGGAGTAGACAGAGGTTGG + Intergenic
971114904 4:23633663-23633685 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
971234281 4:24827348-24827370 CTTGGGGAGCAGCAGCAAGAGGG - Intronic
971328510 4:25663627-25663649 GGTGGGGAGGAGAGGTAGGAAGG + Intronic
971378733 4:26077308-26077330 CTTGGGGAGCGGTGGTAGAAAGG - Intergenic
971425094 4:26508087-26508109 CTTGGGATGCTGAGGAAGGAGGG - Intergenic
971594363 4:28509851-28509873 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
971689449 4:29814245-29814267 CTTGGGGGGCTGAGGCAGGAGGG - Intergenic
972032991 4:34486081-34486103 CTTGGGAAGCAGAGGCAGGAGGG - Intergenic
972258897 4:37388289-37388311 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
972389207 4:38597282-38597304 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
972696619 4:41452691-41452713 CTTGCGGTGCAGAAGAAGGAAGG - Intronic
972792254 4:42384280-42384302 CTTGGGAGGCTGAGGGAGTAAGG - Intergenic
973325019 4:48851443-48851465 TTTGGGAAGCTGAGGCAGGAGGG + Intronic
973774079 4:54229922-54229944 CTGGGGGACCAGGGGGAGGTGGG + Intronic
973847911 4:54932032-54932054 CATCAGGAGGAGAGGGAGGAGGG - Intergenic
973906867 4:55540727-55540749 CGTGGAGTGGAGAGGGAGGAAGG + Intronic
974052242 4:56952115-56952137 CTTGGGGGGCTGAGGCAGAATGG - Intergenic
974083372 4:57235057-57235079 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
974087802 4:57279668-57279690 CTGGTGGAGGAGAGGGAGGATGG + Intergenic
974109570 4:57511035-57511057 GTTGGGGAGCAGGGGGTTGAGGG + Intergenic
974310092 4:60194682-60194704 CTTGGGAAGCTGAGGCAGGAGGG - Intergenic
974323058 4:60377119-60377141 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
974727245 4:65812785-65812807 CTTGGGGAGAGAAGGCAGGATGG - Intergenic
975713247 4:77181262-77181284 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
976429728 4:84948471-84948493 CTTGGAGAGCAGAGACAGGCTGG - Intronic
976685840 4:87813765-87813787 CTTGGGGGGAAGAGTGAGAAGGG - Intergenic
976704948 4:88010200-88010222 CTTGGGAAGCTGAGGTGGGAGGG - Intronic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
976913805 4:90344013-90344035 CTTGGGGAGGGGAGTCAGGATGG - Intronic
977027445 4:91836802-91836824 TTTGGGGAAGGGAGGGAGGATGG + Intergenic
977077951 4:92482321-92482343 CTTAGAGGGCAGAGGGAGGAAGG + Intronic
977292113 4:95176227-95176249 CTTGACGAGCTGAGAGAGGAAGG - Intronic
977848006 4:101789300-101789322 ATTGTGGAGCAGAGTCAGGATGG + Intronic
978094753 4:104762297-104762319 TTTGGGGAGCAGGGGAAGGGAGG - Intergenic
979293373 4:119002734-119002756 CTTAGGAAGCAAATGGAGGAAGG - Intronic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
979399732 4:120233728-120233750 GTAGCGGAGCAGTGGGAGGAGGG - Intergenic
979463752 4:121012748-121012770 CTTGGGAAGCTGAGGTGGGAGGG - Intergenic
979490412 4:121320323-121320345 CTAGCAGATCAGAGGGAGGAAGG + Intergenic
979666430 4:123316020-123316042 TTTGGGAAGCTGAGGCAGGAGGG - Exonic
979762645 4:124426005-124426027 ATTGGGGAGCAGTGGGAGGGAGG - Intergenic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
980467224 4:133201934-133201956 CTTTGGGAGCAGAGTGAAGAAGG + Intronic
980707144 4:136513631-136513653 CTTAGGGAGCTGAGGTGGGAAGG - Intergenic
981080723 4:140636631-140636653 CTTGGGAAGCTGAGGTGGGAGGG - Intronic
981302499 4:143204495-143204517 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
981696762 4:147566724-147566746 TTTGGGAAGCAGAGGTGGGAGGG - Intergenic
981971999 4:150674765-150674787 CTTGGGAGGCTGAAGGAGGAGGG + Intronic
982086594 4:151842165-151842187 CTTGGGTACCTGAGGGAGGAGGG + Intergenic
982235008 4:153243924-153243946 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
982253660 4:153432165-153432187 CTGGGGGTGCTGAGGAAGGAGGG + Intergenic
982710466 4:158753561-158753583 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
982726295 4:158910121-158910143 TTTGGGAAGCTGAGGCAGGAGGG - Intronic
982797490 4:159663623-159663645 CTAGTGGAGCAGTGAGAGGAAGG - Intergenic
982957905 4:161793849-161793871 TTTGGGAAGCCGAGGCAGGAGGG - Intronic
983308210 4:166021368-166021390 GGAGGGAAGCAGAGGGAGGAAGG - Intronic
983359064 4:166705310-166705332 TTTGGGAAGCTGAGGCAGGAGGG - Intergenic
984251951 4:177346272-177346294 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
984553886 4:181191663-181191685 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
984802774 4:183729953-183729975 TGTGGGGAGCAGAGTGAGCAAGG + Intergenic
985064126 4:186104932-186104954 CTCGGGGAGGAGAGGGAGCCAGG + Intronic
985266350 4:188155004-188155026 CTTGGCTAGAAGAGGTAGGAAGG + Intergenic
985362786 4:189193148-189193170 CTTTGGGAGGAGAAGGAGGGTGG - Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985563696 5:604646-604668 CATGGGGTGCAGGGGCAGGAGGG + Intergenic
986174053 5:5336963-5336985 CATGGGCAGCACAGGGAGGAGGG + Intergenic
986299304 5:6465955-6465977 CCTGGGCAGCAGAGGGAGACAGG - Intronic
986670571 5:10139530-10139552 GGTGGAGAGCAGAGGGAGGAAGG + Intergenic
986703607 5:10435959-10435981 CTTTGGGAGCCCAAGGAGGACGG - Exonic
986765138 5:10918799-10918821 GTTGGGGAGCAGGGGGAGTAGGG - Intergenic
986827608 5:11539138-11539160 CTTGGGGAGCACATGGAGAGTGG - Intronic
987071294 5:14339127-14339149 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
988928066 5:36009098-36009120 CTAGTGGAGCTGTGGGAGGAAGG - Intergenic
988999043 5:36742198-36742220 CTTGAGGAGCCTGGGGAGGAAGG - Intergenic
989323539 5:40164860-40164882 CTGGGGTTGAAGAGGGAGGAAGG + Intergenic
989412847 5:41140312-41140334 GTTTGGGGGAAGAGGGAGGATGG + Intergenic
989523060 5:42423690-42423712 CTTGGGGAGGAGAGAGGGGGCGG - Intergenic
989748830 5:44866297-44866319 ATGGGAGAGCAGAGGAAGGAGGG - Intergenic
990466314 5:56074866-56074888 CTTAGGAGGCTGAGGGAGGAGGG + Intergenic
990553307 5:56905528-56905550 CTTGGGGAGAATAAGGAGGGAGG + Intergenic
990682112 5:58256602-58256624 CTTGGGGAGGAGCAGGAGGTTGG - Intergenic
991249537 5:64544564-64544586 CCTGGGAAGCTGAGGCAGGAGGG + Intronic
991250266 5:64552817-64552839 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
991279923 5:64901351-64901373 CTTGGGAAGCTGAGGCAGAATGG + Intronic
991441842 5:66658912-66658934 CTTGAGAGGCAGAGGCAGGAGGG + Intronic
991509765 5:67363825-67363847 CTTGGGGGAAAGAGTGAGGAAGG + Intergenic
991613997 5:68477096-68477118 CATAGGGAGGAGAGGGAGAAAGG - Intergenic
992732278 5:79683810-79683832 CTTGGGAGGCTGAGGGAGGCAGG + Intronic
992794122 5:80240270-80240292 GTTGAGAAGCAGTGGGAGGAAGG - Intronic
993130830 5:83896244-83896266 CAGAGGGAGCAGAGGGAGCAGGG + Intergenic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993191235 5:84684576-84684598 TTTGAGGGGTAGAGGGAGGAAGG + Intergenic
993319849 5:86458841-86458863 CTTGGGGAGAAGAGGCAGGGTGG - Intergenic
993322559 5:86490658-86490680 GTGAGGGAGCAGAGGAAGGATGG - Intergenic
993633862 5:90320353-90320375 CTTTGAGGGCAGAGGGTGGAAGG - Intergenic
994168783 5:96636888-96636910 CGTGGGGAGCAGAAGGATAAGGG + Intronic
995105141 5:108369080-108369102 TTAGGTGAGCAGAGGGATGATGG - Intronic
995125355 5:108573258-108573280 CTAAGGGAGAAGAGGGAGGAAGG + Intergenic
995506548 5:112866452-112866474 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
995655957 5:114426072-114426094 CTTGGGGAGCTGAGGCAGGAGGG + Intronic
995731058 5:115242718-115242740 CTTGGGGAGGAGGCAGAGGAGGG + Intronic
996039535 5:118794605-118794627 CTTAGGGAGCAGAAAGTGGAGGG + Intergenic
996059525 5:119017753-119017775 CTTTGGGAGGTGATGGAGGAGGG + Intergenic
996212012 5:120822451-120822473 CTTGGGAAGCTGAGGTGGGAGGG - Intergenic
996383396 5:122885247-122885269 CTTGGGGAGGAGAGGCAGGGAGG - Intronic
996605585 5:125317655-125317677 CTTGGAGAGTGGAGGGAGGGAGG - Intergenic
996616703 5:125450626-125450648 ATTGAAGAGCAGAGGGAGGAAGG + Intergenic
996715622 5:126585457-126585479 CTTGGGGAGAAGAGAGAGCAAGG - Intronic
997194244 5:131967100-131967122 TTTGGGAAGCCGAGGCAGGAAGG + Intronic
997377598 5:133408473-133408495 CTGGTGGAGCAGAGGGAGAAGGG + Intronic
997415669 5:133726479-133726501 CTTCTGGAGGAGAGTGAGGATGG - Intergenic
997482806 5:134201167-134201189 TTTGGGAAGCTGAGGCAGGAGGG + Intronic
997663576 5:135608740-135608762 CCTTGGGAGAAGAGGGAGGATGG - Intergenic
997704429 5:135933749-135933771 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997792464 5:136772915-136772937 CTGGAGGAGAAAAGGGAGGAGGG + Intergenic
997937734 5:138129117-138129139 TTTGGGGGGCAGAGGGTGGCAGG - Intronic
997966610 5:138361960-138361982 CTTGGGGAGCAGCAGATGGAGGG + Intronic
998080935 5:139274342-139274364 CCTAGGGAGAAGAGGGAAGAGGG - Intronic
998130449 5:139648909-139648931 CCGGGGGAGGAGAGGGAGGTAGG - Intronic
998391087 5:141787357-141787379 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
998811019 5:145966006-145966028 CTTGTGCAGAAGCGGGAGGAGGG + Intronic
999243061 5:150138654-150138676 GGTGGGGAGCAGAGGCTGGAGGG - Intronic
999253251 5:150195107-150195129 CCTGGGGATGAGAGGGAGGAAGG - Intronic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
999324432 5:150634711-150634733 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
999496961 5:152108494-152108516 GTAGGGAAGCAGAGGGAGGGTGG + Intergenic
999673467 5:153977130-153977152 CTTGGGGTGCAGTGGAAGAAGGG - Intergenic
999721133 5:154400028-154400050 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
999799920 5:155023913-155023935 CTTGGGAAGCTGAGGTGGGAGGG - Intergenic
1000115726 5:158151735-158151757 CCTGGGCAACAGAGCGAGGAAGG - Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000355460 5:160390170-160390192 TTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1001266263 5:170276605-170276627 CTGGGGGAGCTGGGGCAGGAGGG + Intronic
1001316875 5:170649482-170649504 CTTGGGGAGCAGAGCATGGCTGG - Intronic
1002076690 5:176712639-176712661 CTGGGGCAGGAGAGGGAGGTGGG + Intergenic
1002118106 5:176980846-176980868 CTTGGGAAGCTGAGGCAGGTGGG - Intronic
1002639862 5:180625641-180625663 CTTGGCCAGCTGATGGAGGATGG + Intronic
1002911399 6:1493817-1493839 CTTGGGGGGCTGAGGCAGGAGGG - Intergenic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1003248218 6:4402024-4402046 TTTGGGTAGCAGAGGGAAGGGGG - Intergenic
1003391517 6:5717181-5717203 CTTGGGGAGAAAAAGGAGCAGGG + Intronic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003598813 6:7499977-7499999 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
1003869594 6:10391164-10391186 CTTGGGCGGCAGGGAGAGGAAGG - Intergenic
1004125143 6:12865949-12865971 CTTAGGGTGGGGAGGGAGGAGGG - Intronic
1004226675 6:13791145-13791167 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1004491885 6:16125508-16125530 TTTGGGAGGCAGAGGCAGGAGGG + Intergenic
1004707524 6:18138372-18138394 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1004716148 6:18218226-18218248 CTTGGGAAGCTGAGGTGGGAGGG - Intronic
1004957701 6:20748400-20748422 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1005056061 6:21729773-21729795 CATGGAGAGCAAAGAGAGGAAGG - Intergenic
1005407129 6:25501290-25501312 CTTGGGGAGGGGAAGGAAGATGG - Intronic
1006076167 6:31534115-31534137 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
1006310818 6:33257905-33257927 CTTGGGAGGCTGAGGGAGGAGGG + Intronic
1006390801 6:33757187-33757209 GGTGGGGAGGTGAGGGAGGAGGG - Intergenic
1006404709 6:33838196-33838218 GTTTGCGGGCAGAGGGAGGAGGG + Intergenic
1006411001 6:33873139-33873161 CTTTGGGAGATGTGGGAGGATGG - Intergenic
1006485269 6:34334696-34334718 TTTGGGAAGCTGAGGGAGGAGGG + Intronic
1006698383 6:35951385-35951407 CTTGGGGAGCAGAGGACCCAGGG + Intronic
1006713899 6:36101328-36101350 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
1006825089 6:36928771-36928793 CCCAGGGAGCAGAGGGAGGCAGG + Intronic
1006902241 6:37510727-37510749 CATGGTGTGCACAGGGAGGAGGG + Intergenic
1006920249 6:37623185-37623207 CCTGGGGTGTAGAGGCAGGAAGG + Intergenic
1006936024 6:37718814-37718836 TTTGGGAAGCCGAGGGAGGAAGG + Intergenic
1007116956 6:39349557-39349579 CAGGGGGAGCAGTGGGTGGAAGG + Intronic
1007222780 6:40292214-40292236 CTTGGGGAGCAGGGAGGTGATGG + Intergenic
1007228548 6:40331835-40331857 CTTGGGGAGCAGGAGGGGGAGGG - Intergenic
1007697524 6:43743289-43743311 CTTGGGTAGCAGGGGGAGTGAGG - Intergenic
1007727739 6:43926869-43926891 CTCAGGCGGCAGAGGGAGGAGGG - Intergenic
1007730751 6:43944122-43944144 CATGGAGAGCAGAGAGAGGAAGG - Intergenic
1007781473 6:44257213-44257235 CTTGGGGAGCTTCGGGCGGAGGG - Intronic
1007798503 6:44371189-44371211 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1008271437 6:49494949-49494971 CTAGTGGAGCAGATGGAGCAGGG + Intergenic
1008294169 6:49756394-49756416 GTTGGGGAGCAGGGGGTTGATGG + Intergenic
1008507624 6:52246399-52246421 CTGGGGCAGCAGAGCCAGGACGG + Intergenic
1008526518 6:52412786-52412808 CTTGGGGACCATAGTGAGAAAGG - Intergenic
1008808490 6:55462324-55462346 CATGGTGAGCATAGGAAGGAAGG - Intronic
1009185445 6:60569027-60569049 ATTGGGAGGCAGAGGAAGGAGGG + Intergenic
1009989721 6:70826820-70826842 CTTGGGAGGCTGAGGTAGGAGGG + Intronic
1010443378 6:75924962-75924984 ACTGGGGAGGGGAGGGAGGAGGG + Intronic
1011041721 6:83036839-83036861 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1011272576 6:85594104-85594126 ATTGCGGAGGAGAGGGAAGAAGG + Intronic
1013044398 6:106470058-106470080 CTCGGGGACCAAAGGGAGGAGGG - Intergenic
1013085482 6:106853393-106853415 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1013136007 6:107283216-107283238 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1013604229 6:111732963-111732985 CTTTGGGAGGAGATGGGGGAGGG + Intronic
1014048370 6:116921713-116921735 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1014102243 6:117524307-117524329 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1014109792 6:117607779-117607801 CATGGTGAGCAGAGGGAGTTAGG + Intergenic
1014429592 6:121352138-121352160 CTTGGGGAGTAAAGTGAGGAGGG + Intergenic
1014889340 6:126823660-126823682 CTTGGGACGCTGAGGCAGGAAGG - Intergenic
1014999171 6:128192871-128192893 GGAGGGGAGGAGAGGGAGGAAGG + Intronic
1015157901 6:130117805-130117827 CTTGGGAAGCTGAGGCAGGTGGG - Intronic
1015495461 6:133877755-133877777 ATTGTGAAGCAGAGGAAGGAAGG + Intergenic
1015554980 6:134451786-134451808 GTTGGGGAGCAGAGAGTGGAGGG + Intergenic
1015912173 6:138179915-138179937 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1015970573 6:138739298-138739320 CTTGGGGGGCTGAGGCAGGAGGG - Intergenic
1016286648 6:142481170-142481192 TCTGGGGAGGAGAGGGAGGCTGG + Intergenic
1016318764 6:142819124-142819146 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1016404593 6:143716830-143716852 CTGGGTGAGCAGGGAGAGGAGGG + Intronic
1016532557 6:145074975-145074997 ATTGGGGAAGGGAGGGAGGAAGG + Intergenic
1016633817 6:146264672-146264694 GTAGGGTAGCAGAGGGATGAGGG - Intronic
1016828846 6:148413756-148413778 TAAGGGGAGAAGAGGGAGGAAGG - Intronic
1017013341 6:150080008-150080030 CTTGGAGGGCAGATGGGGGAAGG - Intergenic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1017294287 6:152776152-152776174 CAGGGGGTGCAGTGGGAGGAGGG + Intergenic
1017495514 6:154979725-154979747 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1017719674 6:157235967-157235989 CCTGGGGTGCACACGGAGGAGGG + Intergenic
1017760237 6:157562868-157562890 CTTGGGGGGCGGTGGGAGGCGGG - Intronic
1017981320 6:159402796-159402818 CCTGGGCTGCAGAGGAAGGATGG + Intergenic
1017999895 6:159569837-159569859 CTTGGGGAGAGTAGGGGGGATGG - Intergenic
1018066406 6:160127599-160127621 GTTTGGGAGCAGAGGAAGCATGG + Intronic
1018129685 6:160717189-160717211 CTTGGGGAGCAGAGGGTGAGTGG + Intronic
1018131900 6:160739651-160739673 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1018147517 6:160906424-160906446 CTTGAGGAGCAAAAGTAGGAAGG + Intergenic
1018457893 6:163969161-163969183 CTTGGGAAGCTGAGGTGGGAGGG + Intergenic
1018681087 6:166265944-166265966 CTTGAGGAGGACAGGGAGGTTGG + Intergenic
1018844703 6:167547495-167547517 GATGGGGTGAAGAGGGAGGAGGG - Intergenic
1018867734 6:167758941-167758963 GACGGGGGGCAGAGGGAGGAGGG - Intergenic
1018922353 6:168184116-168184138 CTCTGGGACCAGAAGGAGGAAGG + Intergenic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019430767 7:997908-997930 CTCGGGCCGCAGTGGGAGGACGG - Intronic
1019493737 7:1326675-1326697 CTAGGGGAGCATAGGAGGGACGG - Intergenic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019989416 7:4681705-4681727 CTTGTGAGGCAGAGGCAGGAGGG + Intergenic
1020170606 7:5841975-5841997 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1020416782 7:7955445-7955467 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1021486698 7:21175717-21175739 CTTGGGAAGCTGATGGAGAAGGG + Intergenic
1021685538 7:23182159-23182181 CTAGGGGTGCAGGAGGAGGACGG + Exonic
1021983116 7:26073927-26073949 CTTGGGAGGCAGAGGTGGGAAGG - Intergenic
1022175626 7:27869506-27869528 CATGGGGAGGAGAAGGGGGATGG - Intronic
1022241406 7:28516104-28516126 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1022921819 7:35023350-35023372 CTTGGGGAGGAGAAAGAGAAAGG - Intronic
1023646918 7:42327371-42327393 TTTGGGGAGCAGAGGGCTCATGG + Intergenic
1023687575 7:42752342-42752364 CATGGGGAGCAGATGGCGAAGGG - Intergenic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024242785 7:47448236-47448258 GAGGGGGAGCACAGGGAGGAGGG + Intronic
1024639576 7:51317775-51317797 GCAGGGGATCAGAGGGAGGAAGG - Intergenic
1025202109 7:56968803-56968825 CTTGGGAGGCTGAGGGGGGAGGG + Intergenic
1025669838 7:63608125-63608147 CTTGGGAGGCTGAGGGGGGAGGG - Intergenic
1025825548 7:65007726-65007748 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1025898554 7:65725538-65725560 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1025908680 7:65810088-65810110 CTTGGTGAGAAGACGGAGCAAGG + Intergenic
1025980216 7:66399145-66399167 CTTGTTGAGAAGAGGGAGCAAGG - Intronic
1026063437 7:67047286-67047308 CTTGGGTAGCTGAGGCGGGAGGG + Intronic
1026088261 7:67279995-67280017 CTTGTGGTGCTCAGGGAGGATGG - Intergenic
1026109201 7:67445424-67445446 TTTGGGAGGCTGAGGGAGGAGGG + Intergenic
1026287692 7:68977665-68977687 CTGGGGGAGAAGAGGGCAGAAGG + Intergenic
1026399819 7:69998287-69998309 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1026510896 7:71026744-71026766 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1026602597 7:71789043-71789065 TTTGGGAGGCAGAGGCAGGAGGG - Intronic
1026641023 7:72125755-72125777 CTTGGGGAGGACAGGAAGGTGGG - Intronic
1026725994 7:72870332-72870354 CTTGTGGTGCTCAGGGAGGATGG + Intergenic
1026780056 7:73260257-73260279 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1026909280 7:74083337-74083359 CTTGGGGAGGGGAGGGAGGCGGG - Intronic
1026966696 7:74444693-74444715 CTTGGGGGGCTGAGGGAGGATGG - Intergenic
1026976318 7:74501043-74501065 CTTGGGGAGAAGAGGAGGGGAGG + Intronic
1027020911 7:74813675-74813697 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1027067114 7:75132249-75132271 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1027117861 7:75495333-75495355 CTTGTGGTGCTCAGGGAGGATGG - Intergenic
1027205097 7:76091518-76091540 CTTGTTGAGAAGAGGGAGCAAGG - Intergenic
1027239227 7:76316506-76316528 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
1027273945 7:76540147-76540169 CTTGTGGTGCTCAGGGAGGATGG + Intergenic
1027327390 7:77059199-77059221 CTTGTGGTGCTCAGGGAGGATGG + Intergenic
1027540668 7:79460191-79460213 CATGGAGAGGAAAGGGAGGAAGG + Intergenic
1028159743 7:87472316-87472338 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1028394125 7:90348610-90348632 CTTGGGTGGCAGAGGCAGAAGGG + Intronic
1028406125 7:90475849-90475871 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1028424706 7:90673422-90673444 CCTGGGCAACAGAGGGAGGGAGG - Intronic
1028581361 7:92412930-92412952 CGTGCGGAGAAGAGGAAGGAGGG - Intergenic
1028686329 7:93592320-93592342 CTTGGTGAGCAGGAGGAAGATGG - Intronic
1028718399 7:94000892-94000914 CTTGGGAAGCTGAGGGAGGCAGG + Intronic
1028746322 7:94330899-94330921 ATTGCAGAGCAGAGGGAGAATGG - Intergenic
1028844419 7:95463273-95463295 TTTGGGAAGCAGAGGCAGGAGGG - Intergenic
1028905753 7:96152327-96152349 CCTAGGGAGCAGAGGGGAGAGGG + Intronic
1028947644 7:96599039-96599061 CTAGAGGGGCAGAGGGAGGGAGG + Intronic
1029111894 7:98217019-98217041 CTGGGGCAGCAGAGCCAGGATGG - Exonic
1029261680 7:99306927-99306949 GCTGGGGAGCAGGGGGAGTATGG - Intergenic
1029346311 7:99981118-99981140 CTTGGGGTGGAGAGCCAGGACGG + Intergenic
1029461010 7:100693951-100693973 CTCGGGGAGGAGACGGGGGAGGG + Intergenic
1029493960 7:100887292-100887314 GTTTGGGAACAGAGGAAGGAAGG - Intronic
1029526463 7:101097607-101097629 CTTAGGGACCAGATGGAAGAGGG + Intergenic
1029558861 7:101289398-101289420 CTTGGGGTGGAGAGCCAGGACGG - Intergenic
1029576858 7:101409121-101409143 CTTAGGTAGCAGAATGAGGAGGG + Intronic
1029626781 7:101724788-101724810 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1029719638 7:102354722-102354744 CTTGTGGTGCTCAGGGAGGATGG + Intergenic
1029752977 7:102554536-102554558 CTTGTGGTGCTCAGGGAGGATGG - Exonic
1029770927 7:102653628-102653650 CTTGTGGTGCTCAGGGAGGATGG - Exonic
1030236620 7:107270367-107270389 CTTGGGAAGCTGAGGCAGGAAGG - Intronic
1030266583 7:107628402-107628424 GTAGAGGAGGAGAGGGAGGAGGG + Intronic
1030287141 7:107838291-107838313 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1030655531 7:112163267-112163289 AATGGGGAGGGGAGGGAGGAGGG - Intronic
1030658176 7:112191196-112191218 CTTGGGAGGCGGAGGCAGGAGGG - Intronic
1031054026 7:116974397-116974419 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1031339424 7:120580430-120580452 CTTGTGGAGCAGAAGGTGGAAGG - Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031881015 7:127198780-127198802 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
1032066203 7:128773481-128773503 TTTGGTAAGCACAGGGAGGAAGG - Intronic
1032080636 7:128856846-128856868 GTTGGGGAGCAGAGCCAGGCTGG + Exonic
1032129273 7:129215464-129215486 CTTGGGAGGCCGAGGCAGGAGGG + Intergenic
1032516376 7:132509150-132509172 CTGGAGGAGAAGAGGGAGGGAGG + Intronic
1032547518 7:132756128-132756150 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1032610140 7:133403821-133403843 CTTGGGAGGCTGAGGTAGGAAGG + Intronic
1032811715 7:135426104-135426126 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1033052061 7:138014611-138014633 CTTGGGAAGCTGAAGCAGGAGGG - Intronic
1033195228 7:139321782-139321804 CTGGGGAAGCAGGGGAAGGAAGG - Intergenic
1033261504 7:139848061-139848083 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
1033316411 7:140301136-140301158 TTTGGGGGGCTGAGGCAGGAGGG - Intronic
1033582702 7:142751619-142751641 CATGGGCAGCAGAGGGATGTGGG - Intronic
1033665093 7:143433147-143433169 TTTGGGGAGCAAAGGAAAGAAGG + Intergenic
1033737413 7:144236520-144236542 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1033745643 7:144314427-144314449 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1033993620 7:147318332-147318354 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1034065830 7:148135958-148135980 CATTGGGAAGAGAGGGAGGAAGG + Intronic
1034163497 7:149009036-149009058 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1034280010 7:149846751-149846773 CTGTGGGAGAAGAGGGAGGTGGG + Intronic
1034422210 7:150995997-150996019 GGATGGGAGCAGAGGGAGGAGGG - Intronic
1034435140 7:151059792-151059814 CCAGGGCCGCAGAGGGAGGAAGG + Intronic
1034889753 7:154829451-154829473 GGTGGGGAGGGGAGGGAGGAGGG + Intronic
1034890921 7:154838601-154838623 CTTCGGGAGCAGAGATGGGATGG + Intronic
1035597352 8:869090-869112 CTCGAGGAGGAGAGGAAGGAAGG - Intergenic
1035879901 8:3234657-3234679 CTGGGAGAGCAGAGGAAGGCAGG + Intronic
1036111821 8:5911135-5911157 CATGGAGTGGAGAGGGAGGAAGG + Intergenic
1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG + Intergenic
1036519034 8:9473365-9473387 GTTAGGGAAGAGAGGGAGGATGG - Intergenic
1037454627 8:19051189-19051211 GATTGGGACCAGAGGGAGGAGGG - Intronic
1037709624 8:21345308-21345330 AGTGGGGACCAGGGGGAGGAAGG + Intergenic
1037769605 8:21790624-21790646 CTGGGGGAGAAGATGGAGGGAGG - Intronic
1037893461 8:22636447-22636469 CTTGGGGGGCTGAGAGAGGAGGG + Intronic
1037897923 8:22670434-22670456 CTTGAGCAGGAGAGGTAGGAGGG + Intergenic
1038067074 8:23974369-23974391 GTGGGGGAGGGGAGGGAGGAGGG + Intergenic
1038150271 8:24937219-24937241 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1038220171 8:25599750-25599772 CTTGGGGAGCTGTGCCAGGAAGG + Intergenic
1038271766 8:26081403-26081425 TTTGGGGACTGGAGGGAGGAGGG - Intergenic
1038314595 8:26473022-26473044 CTTGGGGGAAAGAGGCAGGAGGG + Intronic
1038428432 8:27480631-27480653 CTTGGAGAGCAGGGAGAAGAGGG + Intergenic
1038599602 8:28926673-28926695 CTTAGGAAGCTGAGGCAGGAGGG - Intronic
1038760179 8:30378654-30378676 CTTTGGGATCAGGTGGAGGATGG - Intergenic
1038821974 8:30960577-30960599 CTTGGGAGGTAGAGGAAGGATGG + Intergenic
1039047934 8:33466995-33467017 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1039130727 8:34261468-34261490 CTTTGGGAGCTTGGGGAGGAAGG - Intergenic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1039567049 8:38559310-38559332 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1040006834 8:42628132-42628154 CAGGGGGAGCAGAGGGACCAGGG - Intergenic
1040611316 8:48984973-48984995 CTTGGGAAGGAGAGTGGGGAAGG + Intergenic
1040626677 8:49157676-49157698 ATAGGGGAGCAGAGTAAGGAGGG + Intergenic
1040832391 8:51691814-51691836 CCCGGCCAGCAGAGGGAGGAAGG + Intronic
1040983556 8:53269523-53269545 CTCAGGGAGGAGAGGGTGGAAGG + Intergenic
1041249100 8:55917531-55917553 CTTGTGGAGTGGAGGGAGTAGGG + Intronic
1041527521 8:58823798-58823820 CTAGGGGCGAAGAGGGAAGAAGG + Intronic
1041731625 8:61068785-61068807 TGTGGGGAGCAGATGAAGGAAGG - Intronic
1041770291 8:61465767-61465789 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1041881895 8:62761330-62761352 CCTGGGGAGGTGGGGGAGGACGG + Intronic
1041893814 8:62901360-62901382 CATGGGAAGCTGAGGCAGGAGGG + Intronic
1041904156 8:63013301-63013323 CGTGGGGAGCCTGGGGAGGAGGG - Intergenic
1041991505 8:63998334-63998356 TTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1042011429 8:64249696-64249718 CTTCGGCAGCAGAGTGAGGGAGG - Intergenic
1042081151 8:65052927-65052949 CTTAGGGAGGGGAGGGAAGATGG - Intergenic
1042139721 8:65665729-65665751 CTCAGGAAGCTGAGGGAGGAGGG - Intronic
1042551485 8:69997586-69997608 TTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1042659408 8:71137115-71137137 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1042689586 8:71483262-71483284 CTTGAGGAGCTGAGAGAGGGAGG - Intronic
1042874761 8:73431042-73431064 CTTGGGGAGTTGTGGGAAGAAGG + Intronic
1044970468 8:97614848-97614870 TTTGGGGGGCTGAGGCAGGAGGG + Intergenic
1045108979 8:98921440-98921462 CATGGAGTGCTGAGGGAGGAAGG + Intronic
1045147583 8:99364538-99364560 CTTGGGAAGCTGAGGTGGGAGGG - Intronic
1045268132 8:100638060-100638082 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1045459365 8:102412616-102412638 CTAGGGGAGGTGAGGAAGGAGGG + Exonic
1045527153 8:102950804-102950826 CTTGGGAAGCTGAGGCAAGAGGG - Intronic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1045649830 8:104331187-104331209 CTTGGGGAGCAGAAGGACATAGG - Intronic
1046593088 8:116229008-116229030 CTTGGGAGGCAGAGGTGGGAAGG - Intergenic
1046654865 8:116882307-116882329 CTTGGGAGGCAGAGGTAGGAGGG - Intergenic
1047020635 8:120771975-120771997 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1047328661 8:123864965-123864987 TTTGAGGAGCTGAGAGAGGAAGG - Intronic
1047521815 8:125600757-125600779 CTTGGGGAGCAGAAGGGAGGAGG + Intergenic
1047529916 8:125665241-125665263 TTTGGGGAGCAGAGGGGTGGGGG - Intergenic
1048477094 8:134753262-134753284 TTGGGGGGGCAGAGGGAGGGTGG + Intergenic
1048529416 8:135234082-135234104 CTGGAGGAGGAGAGGAAGGAAGG - Intergenic
1049055376 8:140232351-140232373 CTTGGGGAGCAAGTGGAGGGAGG + Intronic
1049075997 8:140396551-140396573 GTAGGGGAGGAGAGGGAGGGAGG - Intronic
1049211010 8:141386373-141386395 CTTGGGGCGGACAGGGAGCACGG + Intergenic
1049367035 8:142244818-142244840 GCAGGGGAGCAGAGGGAGCAGGG + Intronic
1049424342 8:142531448-142531470 CGTGGGGTGCACAGGGAGCAGGG + Intronic
1049431584 8:142567673-142567695 CTCGAGGACCAGAGGGATGAGGG + Intergenic
1049512195 8:143034082-143034104 TTTGGGAGGCAGAGGTAGGAGGG + Intergenic
1049637103 8:143694922-143694944 CATGGGGTGCAGAGCCAGGAAGG - Exonic
1049654016 8:143789848-143789870 CTTCGGGAGCAGACGCAGGAGGG + Intergenic
1049672950 8:143877859-143877881 CGTGGGAGGCAGAGGCAGGAAGG - Intronic
1049721523 8:144117962-144117984 CTTGGGGAGAAAAAGGAGGGTGG + Exonic
1049738661 8:144223481-144223503 CTTGGGGGGCTGAGGCGGGAGGG - Intronic
1049802546 8:144524785-144524807 CGTGTGGAGCTGCGGGAGGACGG - Exonic
1049840385 8:144767317-144767339 CATGGGAAGCAGAGGTGGGAGGG - Intergenic
1049879115 8:145050075-145050097 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050297651 9:4222120-4222142 CTGGTGGAGAAGAGGGAGGGAGG - Intronic
1050308171 9:4327245-4327267 CTGAGAGAGCAGAGGGAGGTGGG + Intronic
1050900167 9:10938309-10938331 CTTGGGGGCCTGAGGCAGGAAGG - Intergenic
1051350152 9:16191414-16191436 ACTTGGGAGCAGAGGGAGGAAGG + Intergenic
1052072331 9:24096868-24096890 CTTGGGAAGAGGTGGGAGGATGG + Intergenic
1052361930 9:27571561-27571583 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1052703500 9:31966146-31966168 GTTGGGGGGCAGTGGGAGAAGGG + Intergenic
1052763912 9:32620818-32620840 CATGGGGAGAAGGGGGATGAAGG - Intergenic
1052970561 9:34374792-34374814 CTTGGGGGGCTGAGGTGGGAGGG + Intronic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053156418 9:35783466-35783488 GTTGGGAAGCATAGGCAGGAGGG - Intergenic
1053235705 9:36451971-36451993 CTTTGGGAGGCCAGGGAGGATGG + Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053423843 9:37998203-37998225 CTTGGAGGGAGGAGGGAGGAGGG + Intronic
1053444145 9:38138509-38138531 CTTGAGGACCTGGGGGAGGAGGG + Intergenic
1053662144 9:40291471-40291493 CTGGGGATGCAGAGAGAGGAGGG - Intronic
1053912590 9:42921639-42921661 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054374270 9:64437712-64437734 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054522466 9:66084813-66084835 CTGGGGATGCAGAGAGAGGAGGG + Intergenic
1055019878 9:71658455-71658477 TTTGGGAGGCAGAGGAAGGAGGG - Intergenic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1055442934 9:76354272-76354294 CAATGGGAGCAGAGGGAGGGGGG + Intronic
1055892110 9:81134541-81134563 TTGGGGAAGCTGAGGGAGGAGGG - Intergenic
1056450745 9:86714433-86714455 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1056707730 9:88966311-88966333 CTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1056754673 9:89374234-89374256 GTAGGGGAGCTGAGGGAGGAGGG - Intronic
1057182577 9:93037997-93038019 CTTGGGGAGAAAGGGGAGGGAGG - Intergenic
1057763225 9:97892875-97892897 CATGGGGTGCTGAGGGAGAAAGG - Intergenic
1057783376 9:98068569-98068591 TTTGGGAAGCTGAGGTAGGAGGG + Intronic
1057783397 9:98068703-98068725 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1057896091 9:98909779-98909801 TTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1058048902 9:100386937-100386959 CTTGGGGGAAACAGGGAGGAGGG + Intergenic
1058457000 9:105147088-105147110 TTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1058672416 9:107371153-107371175 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1058768920 9:108211600-108211622 GTTGGGGAACAGGGAGAGGAAGG - Intergenic
1058844629 9:108944678-108944700 CCAGGGGAGTAAAGGGAGGAAGG + Intronic
1059286556 9:113177538-113177560 CTTTGGGAGAACAGGGCGGAAGG + Intronic
1059341918 9:113602154-113602176 CCTGCGGGGCAGAGGGAGGGAGG + Intergenic
1059347522 9:113639712-113639734 CTTGGGGGGCTGAGGCAGGAGGG + Intergenic
1059438079 9:114288452-114288474 CAGGGGGAGCAGGGCGAGGACGG + Exonic
1059456254 9:114402178-114402200 CTGGGGGTGCAGAGGGAAGCTGG + Exonic
1059584838 9:115594989-115595011 GTTGGGGGTCAGAGGGAAGAGGG - Intergenic
1059672808 9:116507552-116507574 ATTGTGGTCCAGAGGGAGGATGG - Intronic
1060062766 9:120475833-120475855 CCTGGGGAGCAGAGACAGTAAGG + Intronic
1060295385 9:122339581-122339603 CTGGGGGAGGGGAGGCAGGAAGG - Intergenic
1060395888 9:123316233-123316255 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1060400039 9:123343197-123343219 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1060539985 9:124422869-124422891 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1060544274 9:124451154-124451176 CTTGGGGAGCAGGGGAAAGGTGG + Intergenic
1060624090 9:125094607-125094629 CTTGGGGAGCTGAGGCGGAAGGG - Intronic
1060680109 9:125554686-125554708 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1060864401 9:126983687-126983709 ATGAGGGAGGAGAGGGAGGATGG - Intronic
1060978205 9:127777554-127777576 CTGGGGCAGCAGAGGGATGGGGG - Intronic
1061090890 9:128425423-128425445 CTTGGGAAGCTGAGGCTGGAGGG + Intronic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061161205 9:128895469-128895491 CTCAGGGAGCAGAGAGAGCAAGG - Intronic
1061344768 9:130014357-130014379 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1061366903 9:130176947-130176969 CATGGGGAGGAGAAGGAGAAGGG - Intronic
1061449976 9:130662613-130662635 GTTGGGACGCAAAGGGAGGAAGG - Intergenic
1061471297 9:130828168-130828190 CTTGGGGGGCTGAGGCAGGTTGG - Intronic
1061481303 9:130898866-130898888 TTTGGGGGGCAGAGGAGGGAAGG - Intergenic
1061588636 9:131584125-131584147 ATTGGGGATCAGAGACAGGAAGG + Intronic
1061595005 9:131623219-131623241 TTTGGGAGGCTGAGGGAGGAGGG + Intronic
1061611794 9:131751566-131751588 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1061634918 9:131901527-131901549 CTTGAGGAACGGAGGGAGGAGGG + Intronic
1061745817 9:132739649-132739671 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1061860834 9:133468061-133468083 TTCGGGGGGCGGAGGGAGGAAGG - Intronic
1062146726 9:134993568-134993590 CTTTGGGAGCAGAGGGACTCTGG + Intergenic
1062255728 9:135619864-135619886 ATTGGGGAGAAGGGGGAGAAGGG - Intergenic
1062291631 9:135797858-135797880 CTTGGGAAGCAGAGGAAAGAGGG - Intergenic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1062367530 9:136218382-136218404 CCTGGAGAGTAGATGGAGGAGGG - Intronic
1062447879 9:136603288-136603310 CCTGGGGGGCAGAGGGAGGTTGG + Intergenic
1062464649 9:136675670-136675692 CTGGGAGAGCAGAGGGGAGACGG - Intronic
1062572095 9:137190447-137190469 CCTTGGGAGAGGAGGGAGGAGGG + Intergenic
1062583994 9:137240851-137240873 CTGGGGGCGCCGAGGGAGGGCGG - Intergenic
1062596766 9:137303025-137303047 CGTGGGCAGCAGAGGGAGGCAGG - Intergenic
1062632380 9:137470132-137470154 CTTGGGAGGCGGAGGCAGGAGGG - Intronic
1062731547 9:138112947-138112969 CTTGGAGAGGTGAGGGAGCATGG + Intronic
1185448591 X:271334-271356 CCTGGGGCACAGCGGGAGGAAGG + Intergenic
1185511620 X:668215-668237 AAAGGGGAGGAGAGGGAGGAGGG - Intergenic
1185553369 X:1001657-1001679 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1185595090 X:1301489-1301511 CCAGTGGAGCAGAGGGAGGTGGG - Intronic
1185603620 X:1355037-1355059 GAAGGGGAGCAGATGGAGGAAGG + Intronic
1185666319 X:1768199-1768221 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1185734857 X:2488911-2488933 CTTGGGCAGCAGGGGGAAGAGGG + Exonic
1185834360 X:3331147-3331169 CTTTGGGAGCCCAGGCAGGAGGG - Intronic
1185967175 X:4619795-4619817 CTTGGGAAGCTGATGCAGGAGGG + Intergenic
1186061917 X:5718180-5718202 CGAGGGGGGAAGAGGGAGGAGGG + Intergenic
1186386586 X:9116208-9116230 CTTGGGCAGCAGGTGGAGAAAGG - Intronic
1186426825 X:9469061-9469083 CTTGGGGAGGTCAAGGAGGAAGG - Intronic
1186779836 X:12901448-12901470 TTTGGGAAGCTGAGGCAGGAAGG + Intergenic
1186934767 X:14436333-14436355 ATTGGGGAGGGAAGGGAGGATGG - Intergenic
1187048072 X:15667824-15667846 CTCTGGGAGCTGAGGCAGGAGGG - Intergenic
1187318198 X:18217996-18218018 CTTGGGAGGCTGAGGTAGGATGG + Intronic
1187435993 X:19269676-19269698 CTTTGGGAGGCGAGGGAGGGTGG - Intergenic
1187547414 X:20267150-20267172 GTTGGGGCGCAGAAGGAGGGGGG - Intergenic
1187827648 X:23347900-23347922 CTTGGGAAGCTGAGACAGGAGGG + Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189347066 X:40249888-40249910 CTTGGGAAGCTGAGGAGGGAGGG - Intergenic
1189470963 X:41313827-41313849 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1189642878 X:43092934-43092956 CTTGGGGGGCTGAGGGTGGGAGG - Intergenic
1190265710 X:48826418-48826440 CCTGAGGAGCCGAGGGAGGGCGG + Intergenic
1190331982 X:49241887-49241909 CTTGGGGAGCTGGGGGAGGTTGG + Intronic
1190427193 X:50345011-50345033 TTTGGGGAGGAGAGGAAGGCAGG - Intronic
1190700691 X:52987381-52987403 TTTGGGAAGCCGAGGCAGGATGG + Intronic
1190913296 X:54791084-54791106 CCTGGGCAGGAAAGGGAGGATGG + Exonic
1191699756 X:64028048-64028070 CTTGGGCAGCTGAGGCAGCAGGG + Intergenic
1191741828 X:64444418-64444440 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1192177487 X:68895035-68895057 CTCGGGGAGGAGGGAGAGGAGGG - Intergenic
1192359924 X:70433012-70433034 CCTGGGGAGGAGGGGGAGGGTGG - Exonic
1192435247 X:71139358-71139380 CATGGGGACCAGAATGAGGATGG + Intronic
1192568414 X:72182297-72182319 TTTGGGAGGCCGAGGGAGGATGG + Intronic
1193123656 X:77849182-77849204 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1193846540 X:86479030-86479052 GTTGGGGAGCAGAAGGGGGATGG + Intronic
1193879801 X:86908176-86908198 CTAGTGGAGCAGTGGGAGTAAGG - Intergenic
1194908992 X:99615545-99615567 CTTGGGGTGAAGAGAGAGTATGG + Intergenic
1195164898 X:102209702-102209724 CTTGGGAGGCTGAGGAAGGAGGG + Intergenic
1195193960 X:102477389-102477411 CTTGGGAGGCTGAGGAAGGAGGG - Intergenic
1195365849 X:104124644-104124666 CTTGGGGAGCTGAGGCAGGAGGG + Intronic
1195446417 X:104957455-104957477 CTGGGGGTTCAGAGGGAGGGAGG + Intronic
1195612712 X:106887068-106887090 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1195664433 X:107416042-107416064 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1195728565 X:107941932-107941954 CTTTGGGAGCTGGAGGAGGAAGG - Intergenic
1195778992 X:108439912-108439934 TTTGGGGAGGGGAGGGGGGAAGG + Exonic
1195903206 X:109819529-109819551 CTGAGGGAGCACAGGGAAGATGG + Intergenic
1195917733 X:109952360-109952382 TTTGGGCAGGAGAGGAAGGAGGG - Intergenic
1196016233 X:110943673-110943695 CTTGGGGATCAGAGGGTTGAAGG - Intergenic
1196752821 X:119132876-119132898 TTTGGGAGGCAGAGGCAGGAGGG - Intronic
1197112109 X:122788809-122788831 CTCGGGAGGCAGAGGCAGGAGGG - Intergenic
1197154518 X:123255983-123256005 ATTGGGTAGCATAGGGAGAATGG - Intronic
1197365846 X:125563621-125563643 TCTTGGGAGCAGGGGGAGGAGGG + Intergenic
1197755665 X:129992342-129992364 CTTGGGAAGCTGAGGTGGGAGGG + Intronic
1197843447 X:130775270-130775292 CTTGGGGTGCTGGGGCAGGAGGG + Intronic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1198165416 X:134050480-134050502 CCTGGGGGGCGGTGGGAGGAAGG - Intergenic
1198223383 X:134623310-134623332 CTTGGACACAAGAGGGAGGATGG + Intronic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1199080569 X:143572133-143572155 CTTGTGGACCAGAAGAAGGAAGG - Intergenic
1199404220 X:147437191-147437213 CTTGTGGGGAAGAGGGAGAAAGG - Intergenic
1199858110 X:151776911-151776933 CTGTGGGAGCAGAGGGTGGGTGG - Intergenic
1200094199 X:153649707-153649729 CTTGGGGAGGACAGGAGGGAAGG - Intronic
1200105699 X:153710865-153710887 ATCGGGGAGCAGAAGGAAGAGGG - Intronic
1200232201 X:154449667-154449689 CCTGCGGACCTGAGGGAGGAAGG - Exonic
1200419563 Y:2950157-2950179 CTTGGGAAGCTGAGGTAGGAAGG - Intronic
1200427733 Y:3040015-3040037 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1200886149 Y:8272560-8272582 CTTGGGGAGGATAGGGTGGGTGG - Intergenic
1201269310 Y:12239108-12239130 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1201290701 Y:12419663-12419685 CTAGGGAAGCTGAGGTAGGAGGG - Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic