ID: 1077220297

View in Genome Browser
Species Human (GRCh38)
Location 11:1412774-1412796
Sequence CTGGCTGCACAGATCAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 136}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077220281_1077220297 27 Left 1077220281 11:1412724-1412746 CCCCAGCCCAGAGGGGATCCTCC 0: 1
1: 0
2: 0
3: 25
4: 307
Right 1077220297 11:1412774-1412796 CTGGCTGCACAGATCAACCCAGG 0: 1
1: 0
2: 1
3: 27
4: 136
1077220291_1077220297 6 Left 1077220291 11:1412745-1412767 CCTGCCTGCTGGGAGTGGGCAAC 0: 1
1: 0
2: 1
3: 27
4: 195
Right 1077220297 11:1412774-1412796 CTGGCTGCACAGATCAACCCAGG 0: 1
1: 0
2: 1
3: 27
4: 136
1077220284_1077220297 21 Left 1077220284 11:1412730-1412752 CCCAGAGGGGATCCTCCTGCCTG 0: 1
1: 0
2: 1
3: 21
4: 300
Right 1077220297 11:1412774-1412796 CTGGCTGCACAGATCAACCCAGG 0: 1
1: 0
2: 1
3: 27
4: 136
1077220283_1077220297 25 Left 1077220283 11:1412726-1412748 CCAGCCCAGAGGGGATCCTCCTG 0: 1
1: 0
2: 6
3: 98
4: 2746
Right 1077220297 11:1412774-1412796 CTGGCTGCACAGATCAACCCAGG 0: 1
1: 0
2: 1
3: 27
4: 136
1077220290_1077220297 9 Left 1077220290 11:1412742-1412764 CCTCCTGCCTGCTGGGAGTGGGC 0: 2
1: 0
2: 2
3: 43
4: 404
Right 1077220297 11:1412774-1412796 CTGGCTGCACAGATCAACCCAGG 0: 1
1: 0
2: 1
3: 27
4: 136
1077220282_1077220297 26 Left 1077220282 11:1412725-1412747 CCCAGCCCAGAGGGGATCCTCCT 0: 1
1: 0
2: 0
3: 28
4: 282
Right 1077220297 11:1412774-1412796 CTGGCTGCACAGATCAACCCAGG 0: 1
1: 0
2: 1
3: 27
4: 136
1077220293_1077220297 2 Left 1077220293 11:1412749-1412771 CCTGCTGGGAGTGGGCAACGGTG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1077220297 11:1412774-1412796 CTGGCTGCACAGATCAACCCAGG 0: 1
1: 0
2: 1
3: 27
4: 136
1077220285_1077220297 20 Left 1077220285 11:1412731-1412753 CCAGAGGGGATCCTCCTGCCTGC 0: 1
1: 1
2: 9
3: 209
4: 3722
Right 1077220297 11:1412774-1412796 CTGGCTGCACAGATCAACCCAGG 0: 1
1: 0
2: 1
3: 27
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077220297 Original CRISPR CTGGCTGCACAGATCAACCC AGG Intronic
900313905 1:2047826-2047848 CTGGCAGCACAGATCTCCCCAGG + Intergenic
902783794 1:18720426-18720448 CTGGCATGACAGCTCAACCCTGG + Intronic
903662809 1:24989009-24989031 CTGCCTTCACAGAGCAACACTGG + Intergenic
905103533 1:35546525-35546547 CTGACTGCAAAGATCAAGTCAGG + Intronic
905314920 1:37076265-37076287 CTTGCAGCAAAGACCAACCCAGG - Intergenic
908433028 1:64077593-64077615 CTGGCTGCTCGGGGCAACCCTGG + Intronic
912756189 1:112326466-112326488 CTGGATGCACAGTTCTGCCCTGG + Intergenic
914903983 1:151729067-151729089 CTGACATGACAGATCAACCCTGG - Intronic
916171052 1:162002050-162002072 CTGGCTGAACAGACCAACACAGG - Intronic
917518077 1:175724762-175724784 CTGGCTCCCCAGACCAAGCCAGG - Intronic
918103411 1:181396281-181396303 TTGGTTACACAGACCAACCCTGG + Intergenic
919081650 1:192874342-192874364 CTGGCTACTCAGAGCCACCCTGG + Intergenic
919670215 1:200331346-200331368 CTAGGTGCCCACATCAACCCCGG + Intergenic
922005710 1:221528685-221528707 TTAGCTACACAGATCAACCCTGG + Intergenic
922182685 1:223247711-223247733 CTGGCTGCACAGAATCACCTGGG + Intronic
922718686 1:227889487-227889509 CCTGCTGCACAGAGCCACCCAGG + Intergenic
923419391 1:233797668-233797690 TTTGCTGCACCTATCAACCCAGG + Intergenic
1063941495 10:11134574-11134596 GTGGCTCCACAGAACAGCCCTGG - Intronic
1065105186 10:22376731-22376753 CTGGCCACACAGACCAGCCCTGG - Intronic
1066232842 10:33454521-33454543 CTGGCTGCACAGAACAAAATGGG - Intergenic
1066509260 10:36077683-36077705 TTTGCTGCACAGATCGTCCCAGG + Intergenic
1067163067 10:43843296-43843318 CTGACAGCACAGATCAATCCAGG - Intergenic
1069891485 10:71655248-71655270 CAGGCTGCAGAGGCCAACCCAGG - Intronic
1075604095 10:123791929-123791951 CTTGCTGCGCAGCTGAACCCAGG + Intronic
1076837573 10:133028822-133028844 ATGGCTGCATAGAGCACCCCTGG + Intergenic
1076882670 10:133247270-133247292 GGGGCTGCAGAGATCAACCCAGG + Intergenic
1077220297 11:1412774-1412796 CTGGCTGCACAGATCAACCCAGG + Intronic
1077343261 11:2035414-2035436 CTGGCTGCAGAGATAAATCGAGG + Intergenic
1077479828 11:2808317-2808339 CTGGCATCACAGAGCTACCCCGG + Intronic
1078430033 11:11281476-11281498 CTGGCTGCTCAGCTCATCCTTGG + Intronic
1078857895 11:15221347-15221369 CTGGCTTCCCAGAACAGCCCAGG - Intronic
1081347367 11:42006729-42006751 ATGGCTGCAGAGATCAAAACAGG - Intergenic
1081493486 11:43583961-43583983 CTAGCTCCACAGATAACCCCTGG - Intronic
1081758495 11:45560917-45560939 CTGGCTCCACAGCTCAGGCCTGG + Intergenic
1082760110 11:57119148-57119170 TTGGCTGCTCAGATCCAGCCTGG - Intergenic
1086268358 11:85028798-85028820 GTGGCTGCACAGTTGCACCCAGG + Intronic
1087963437 11:104381024-104381046 CTGGCTGGACAGATCAAGAAAGG - Intergenic
1089414319 11:118274387-118274409 CTGGCTGCTTAAATCAGCCCTGG + Intergenic
1202826247 11_KI270721v1_random:90603-90625 CTGGCTGCAGAGATAAATCGAGG + Intergenic
1098268351 12:68746237-68746259 TGGCATGCACAGATCAACCCCGG - Exonic
1099656384 12:85497719-85497741 ATGGAGGCACAGATCAACACAGG - Intergenic
1101409630 12:104457667-104457689 CTGGCTGCCCAGATCTACCCGGG + Intronic
1103074686 12:117972596-117972618 CTGGCTGCACAGACAGAACCTGG + Intergenic
1103469119 12:121165878-121165900 TTGGTCACACAGATCAACCCTGG + Intronic
1104482015 12:129115819-129115841 CTGGCTGCAGAGGTCAACGCAGG + Intronic
1104673240 12:130694770-130694792 CTGGCTGCTCAGGACAGCCCTGG + Intronic
1105779994 13:23697071-23697093 CTGGCTGCATAGAGCAAACCTGG + Intergenic
1108764094 13:53605490-53605512 CTGCCTGCCCAGATCAACAAGGG - Intergenic
1114844712 14:26307630-26307652 CTGGCTGCCCAGATCTCCCTTGG + Intergenic
1119873951 14:78040818-78040840 CTGGTCACACAGACCAACCCTGG - Intergenic
1119970988 14:78970444-78970466 CTTGCAGCACACCTCAACCCAGG + Intronic
1121267566 14:92614213-92614235 ATGGCTGCACAGCTCACCCAAGG - Intronic
1121467595 14:94126095-94126117 CTGCCTGCACAGCTGAACCCAGG - Intergenic
1122820097 14:104338532-104338554 CTGGCTGCACACTTCGTCCCGGG + Intergenic
1123162579 14:106293650-106293672 GTTGCTGCCCACATCAACCCTGG + Intergenic
1123470655 15:20549839-20549861 CCCCCTGCACAGATCTACCCGGG + Intergenic
1123647405 15:22450864-22450886 CCCCCTGCACAGATCTACCCGGG - Intergenic
1123730956 15:23144816-23144838 CCCCCTGCACAGATCTACCCGGG + Intergenic
1123749095 15:23342242-23342264 CCCCCTGCACAGATCTACCCGGG + Intergenic
1124023231 15:25942811-25942833 CTGCCTGGACATACCAACCCTGG + Intergenic
1124281468 15:28366124-28366146 CCCCCTGCACAGATCTACCCGGG + Intergenic
1124301236 15:28545495-28545517 CCCCCTGCACAGATCTACCCGGG - Intergenic
1125527915 15:40389985-40390007 CATGCTGCCAAGATCAACCCCGG - Intronic
1127966225 15:63924743-63924765 CTGGCTGCCCAGGCCAACCCTGG + Intronic
1128533383 15:68470591-68470613 CTGGCTGACCAGAAAAACCCAGG - Intergenic
1134839385 16:17389531-17389553 CTGGCTAAACAGATCCACTCCGG - Intronic
1137775893 16:51054057-51054079 CTGTCTGCACAGATAAAACTTGG + Intergenic
1139163063 16:64534725-64534747 CTGGCAGCACAGTTCTTCCCAGG - Intergenic
1139876668 16:70151537-70151559 CTGCCTGCACAGGCCAACCATGG - Intronic
1140260310 16:73372656-73372678 CTGGCTGCTCAGAATAACCATGG + Intergenic
1141484049 16:84326984-84327006 CTGGCTGCCCACATTTACCCTGG - Intronic
1142201225 16:88762011-88762033 ATGGCTGCCCAGATAAGCCCTGG - Intronic
1142411436 16:89919068-89919090 CTGGCTGGACAGGTCAGCCCAGG - Exonic
1146375014 17:32288005-32288027 CTGGCTGCAGAGCTCCACCTGGG - Intronic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1147773888 17:42886897-42886919 CTGGCTGCACGGGTCAAGCCAGG + Intergenic
1147962456 17:44176501-44176523 TTGGCTGCACAAATCACTCCTGG + Intronic
1151600653 17:75104203-75104225 CTGGTCACACAGATGAACCCTGG - Intronic
1152468142 17:80476988-80477010 CTGGCTGCACTGAACACCCTTGG + Intronic
1155872308 18:31043050-31043072 CTGGCAGCCCAGATCGTCCCAGG + Intergenic
1156987913 18:43371024-43371046 GTCTCTGCACAAATCAACCCTGG - Intergenic
1157410579 18:47459686-47459708 CTGTCTTCACAGGTCAGCCCAGG - Intergenic
1159318307 18:66810348-66810370 CTGGCTGTACAAATTAACCAAGG + Intergenic
1159879253 18:73843012-73843034 CTGGCTCCAGAGAACAACCCGGG - Intergenic
1161012510 19:1967495-1967517 CTGTCTGCACAGATCCTGCCGGG - Intronic
1161358377 19:3832255-3832277 CTGGCTGCTCAGATGGGCCCTGG - Intronic
1163060257 19:14755578-14755600 CTTGCTGCTCAGCTCAGCCCTGG - Intronic
1163311539 19:16517811-16517833 CAGGCTGCACAGCTCAAACCAGG + Intronic
1163474107 19:17515135-17515157 CAGGCTGCATAGATTAACACAGG + Intronic
1164830633 19:31317417-31317439 CTGGCTGCACCATACAACCCAGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1168110564 19:54189458-54189480 CGGGCTGCGCAGATCAGGCCGGG + Exonic
928138963 2:28711069-28711091 CTTGCTGCAGAGAGCAACACTGG - Intergenic
929047965 2:37808871-37808893 GTGGTTGCACAGATGAGCCCAGG + Intergenic
931768144 2:65475031-65475053 CTGATTACATAGATCAACCCTGG + Intergenic
932307949 2:70717085-70717107 CTCTCTGCACAGAGGAACCCAGG + Intronic
933817603 2:86080700-86080722 CCAGCTGCACAGAACATCCCAGG + Intronic
934033589 2:88069232-88069254 CTGGCTGCACTGACCACCCTGGG + Intronic
939789559 2:146555019-146555041 CTGGCTTCACTGGACAACCCTGG - Intergenic
940768573 2:157816720-157816742 GAGGCTGCACAGACCAACCCTGG + Intronic
941895040 2:170620677-170620699 CTGTGTGCACAGATCTACCCGGG - Intronic
948310609 2:236982928-236982950 CAGGCTGCACAATTCAACACAGG - Intergenic
948780655 2:240319738-240319760 CTAGCAGCACAGCCCAACCCTGG + Intergenic
1171779295 20:29404888-29404910 CATGCTGCAGAGATCAACTCTGG + Intergenic
1179933005 21:44583363-44583385 CTGGCTGCCCAGCACAACTCTGG + Intronic
1180024464 21:45151846-45151868 CTGGCTGTGCTGATCAAGCCAGG + Intronic
1180207381 21:46269600-46269622 CTGGAGCCACAGATCAACCAAGG + Intronic
1181766743 22:25097866-25097888 CTGGATGCATAGATCCACCCAGG + Intronic
1182422290 22:30254400-30254422 CTGGCTGCTCAGACCACACCTGG - Intergenic
949165716 3:938404-938426 TTGGCTGCACATAGCAGCCCTGG - Intergenic
953184941 3:40629206-40629228 AAGGCTGCACAGAGCAGCCCTGG - Intergenic
957085850 3:75675767-75675789 CATGCTGCAGAGATCAACTCTGG - Intergenic
960648115 3:119912724-119912746 GTGGCTCCAAAGATCAACTCTGG + Exonic
961397373 3:126604984-126605006 CTGGCCACACAGACCAGCCCTGG + Intronic
964419075 3:156482192-156482214 CAGGCTGAATAGATTAACCCTGG - Intronic
965947220 3:174257868-174257890 GTTGCTGCGCAGATCATCCCAGG - Intronic
968466965 4:757224-757246 AGGGCTGCACAGATGAACGCGGG - Intronic
969533861 4:7744044-7744066 ATGACTGCACAGCTCAACCAGGG + Intergenic
972907213 4:43765745-43765767 CTGGCAGATCAGATCAACCCAGG - Intergenic
973711057 4:53630963-53630985 CTGGTTGCAGAGGTCAACCTGGG + Intronic
975389879 4:73803255-73803277 CAGGCTGCACACCACAACCCTGG - Intergenic
982600498 4:157443411-157443433 CTAGCTGTACAGAGCAGCCCTGG + Intergenic
983198773 4:164838076-164838098 TTGGTTACACAGACCAACCCTGG - Intergenic
984974652 4:185219691-185219713 CTGGCTGCTGGGATCAAGCCAGG + Intronic
985525921 5:401581-401603 CTGGCTTCACAGCTTCACCCTGG - Intronic
989099960 5:37814086-37814108 CTGGCTGCCCAGTGCAGCCCGGG - Intronic
991913500 5:71584188-71584210 CAGGCTGCAGAGATCAGCCCTGG + Intergenic
1003918697 6:10811530-10811552 CTGACAGCATAAATCAACCCAGG + Intronic
1004083631 6:12421959-12421981 CTGGTCCCACAGATCAACTCTGG + Intergenic
1005430044 6:25746807-25746829 TTGGTTGCACAGGCCAACCCTGG - Intergenic
1005841215 6:29745668-29745690 CTGACTGCACAGATCCATCCTGG + Intergenic
1005870691 6:29972404-29972426 CTGACTGCACAGATCCATCCCGG + Intergenic
1006072095 6:31505654-31505676 CTGACTGCACAGATCCATCCTGG - Exonic
1015785526 6:136919058-136919080 TTAGCTACACAGACCAACCCTGG + Intergenic
1017169362 6:151441668-151441690 ATGGATGCATTGATCAACCCAGG - Intronic
1019947850 7:4344270-4344292 CTGGCGTCCCAGAACAACCCTGG - Intergenic
1024935947 7:54712475-54712497 ATGGGTGCAAACATCAACCCTGG + Intergenic
1025204651 7:56985276-56985298 CTGTCTGCATCGATCCACCCTGG + Intergenic
1025667286 7:63591659-63591681 CTGTCTGCATCGATCCACCCTGG - Intergenic
1028463922 7:91127504-91127526 TAGGCTGCACATATCAAACCAGG + Intronic
1032137622 7:129295244-129295266 CTGGCTTCACAGAACCAGCCTGG - Intronic
1032474671 7:132203800-132203822 CTGGCTGCCCAGGGAAACCCTGG + Intronic
1034200163 7:149279206-149279228 CTGGCTGGAAAGAGAAACCCAGG - Intronic
1037443663 8:18943134-18943156 GTGGCTGCAAAGATCAACAAAGG + Intronic
1037795328 8:21988713-21988735 CTTGCTGCAGAAATCAGCCCTGG + Intronic
1039014494 8:33130845-33130867 CTAGGAGCACAGATGAACCCAGG + Intergenic
1039489808 8:37938929-37938951 CTGTCTGCAGAGCTCAGCCCTGG - Intronic
1041745777 8:61207764-61207786 CTGGCTGCACAGTACATCTCGGG + Intronic
1045113946 8:98961981-98962003 CTAGCTTCACACATCAACCAAGG - Intergenic
1045825636 8:106394772-106394794 GAGGCTGCACAGATGAACTCTGG + Intronic
1048219172 8:132525811-132525833 CTGGCGACACAGATAAAGCCAGG + Intergenic
1050066761 9:1768096-1768118 TTGACTGCACAGACCAGCCCTGG + Intergenic
1054763618 9:69024874-69024896 CTGGTCACACAGACCAACCCTGG + Intergenic
1055785213 9:79863748-79863770 CTGGCTGCAGGGAGCAGCCCGGG - Intergenic
1057803243 9:98202663-98202685 CTGGCTTCAGTTATCAACCCAGG - Intronic
1059779009 9:117507489-117507511 CTGGCTGCACACAGCATCCCTGG + Intergenic
1060724545 9:125998259-125998281 CTTGCTGCTCAGAGCAACACTGG - Intergenic
1185836935 X:3353384-3353406 CTAGCTGCACAGAACAAGCATGG - Intergenic
1189443610 X:41060057-41060079 CTGGTCTCACAGATCAACCCTGG - Intergenic
1189443938 X:41063235-41063257 CTGGTCTCACAGATCAACCCTGG - Intergenic
1189565531 X:42237373-42237395 CAAGCTGCAGAAATCAACCCTGG - Intergenic
1193440470 X:81534892-81534914 CAGGCTGCACATTTCAGCCCTGG + Intergenic
1194406668 X:93504543-93504565 TTTGCTGCAAAGATCAACCCAGG + Intergenic
1196223594 X:113139530-113139552 GAGGCTGCACAGAGCAACACTGG + Intergenic
1198655032 X:138904547-138904569 CTGGCTGCACAAATAAACTCTGG + Intronic