ID: 1077221089

View in Genome Browser
Species Human (GRCh38)
Location 11:1416780-1416802
Sequence GGGCTCACTGAACCTCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077221089_1077221098 14 Left 1077221089 11:1416780-1416802 CCTGCTTGAGGTTCAGTGAGCCC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1077221098 11:1416817-1416839 CTGATGTATTTAGTACATTTGGG 0: 1
1: 0
2: 1
3: 17
4: 235
1077221089_1077221092 -9 Left 1077221089 11:1416780-1416802 CCTGCTTGAGGTTCAGTGAGCCC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1077221092 11:1416794-1416816 AGTGAGCCCCGTGGATCCACGGG 0: 1
1: 0
2: 0
3: 8
4: 110
1077221089_1077221097 13 Left 1077221089 11:1416780-1416802 CCTGCTTGAGGTTCAGTGAGCCC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1077221097 11:1416816-1416838 GCTGATGTATTTAGTACATTTGG 0: 1
1: 0
2: 2
3: 25
4: 166
1077221089_1077221091 -10 Left 1077221089 11:1416780-1416802 CCTGCTTGAGGTTCAGTGAGCCC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1077221091 11:1416793-1416815 CAGTGAGCCCCGTGGATCCACGG 0: 1
1: 1
2: 0
3: 12
4: 179
1077221089_1077221099 15 Left 1077221089 11:1416780-1416802 CCTGCTTGAGGTTCAGTGAGCCC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1077221099 11:1416818-1416840 TGATGTATTTAGTACATTTGGGG 0: 1
1: 0
2: 1
3: 29
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077221089 Original CRISPR GGGCTCACTGAACCTCAAGC AGG (reversed) Intronic
900267850 1:1768456-1768478 GGGCTCATTGATCCTCTTGCCGG - Intronic
901750779 1:11406506-11406528 AAGCTCAATGAATCTCAAGCAGG - Intergenic
904453426 1:30631825-30631847 GGCATGACTGAACCTCAAGGTGG + Intergenic
904559143 1:31385245-31385267 GTGCTCTCTGGGCCTCAAGCAGG + Intergenic
904789260 1:33006299-33006321 GGGCTGCTTTAACCTCAAGCAGG - Intergenic
905534762 1:38712552-38712574 GGGACCACTGGACCTCAAGAGGG - Intergenic
905836591 1:41128651-41128673 AAGCTCAATGAACCCCAAGCAGG - Intronic
906885927 1:49648511-49648533 AGGCTCACAGAACACCAAGCAGG + Intronic
908383358 1:63617339-63617361 GGGCTCACTGAACCCTAATTGGG - Intronic
916385850 1:164268012-164268034 GAGGTCACTTAACCTCAATCTGG - Intergenic
916563004 1:165949399-165949421 GGGCTCTCTGATCCACAGGCAGG - Intergenic
918378974 1:183935979-183936001 GGCCTGAATGAACCGCAAGCGGG + Exonic
919612967 1:199769231-199769253 AATCTCAATGAACCTCAAGCAGG + Intergenic
922674116 1:227540677-227540699 CAGCTCACTGAACCCCAAGTGGG - Intergenic
922736685 1:227987398-227987420 AAGCTCAATGAACTTCAAGCAGG + Intergenic
922985606 1:229863957-229863979 CTGCTCACTGAAAGTCAAGCAGG + Intergenic
1062760476 10:13195-13217 CGGCTCACTGAACCCCAAGTGGG + Intergenic
1063991556 10:11570186-11570208 AAGCTCATGGAACCTCAAGCGGG - Intronic
1068548273 10:58377273-58377295 AAGCTCTGTGAACCTCAAGCAGG - Intergenic
1068720257 10:60237341-60237363 GAGCTCACTGAGCCCCAAGTGGG + Intronic
1068959983 10:62857651-62857673 GTGCTCACTGAACCTGAAGAGGG - Intronic
1069812052 10:71168806-71168828 GATCTCACTCAACCTCAGGCAGG + Intergenic
1073002945 10:100298809-100298831 GGGCAAACTGAACCACAAGCTGG + Exonic
1075292143 10:121240036-121240058 GTGGTCACTGACCCTCAGGCAGG + Intergenic
1077221089 11:1416780-1416802 GGGCTCACTGAACCTCAAGCAGG - Intronic
1083237363 11:61360046-61360068 GGGCTCACTGTTGCTCAGGCTGG - Intronic
1087470990 11:98574159-98574181 AGGCTTAAAGAACCTCAAGCAGG - Intergenic
1089480858 11:118803957-118803979 GGCCTCACTGTGGCTCAAGCTGG + Intergenic
1090796521 11:130140301-130140323 GGGCTCACTGGCCCTCAGGAGGG + Intronic
1094808077 12:34109765-34109787 CGACTCACTGAACCCCAAGTGGG + Intergenic
1099720558 12:86356840-86356862 GAGCCCACTGAAGCTCAAGGAGG + Intronic
1099819434 12:87691623-87691645 GTGCTCAGTGAACCTAAAGATGG - Intergenic
1100689195 12:97021432-97021454 TGGCTCACTGAAGCTCAAACTGG - Intergenic
1101860547 12:108478975-108478997 GTGCTCACGTAACCTCAAGTGGG - Intergenic
1103848968 12:123918675-123918697 GGTCTCAGAGAAACTCAAGCTGG + Exonic
1103909965 12:124346695-124346717 GGGCCCCCTGAAGCTGAAGCCGG - Exonic
1104950561 12:132437960-132437982 GGGTTCTCTGAAGCTCAGGCTGG + Intergenic
1105902166 13:24764562-24764584 GGCCTCACCGACCCTCCAGCCGG + Intronic
1107605278 13:42049439-42049461 GGGCTCACTGCAGCGCAGGCTGG - Intronic
1108667258 13:52645136-52645158 CAGCTCACTGAACCTCGACCTGG + Intergenic
1108995226 13:56723121-56723143 AAACTCAGTGAACCTCAAGCAGG + Intergenic
1110068598 13:71143286-71143308 GTGCCCTCTGAACCTCATGCGGG + Intergenic
1112912285 13:104501832-104501854 GGGCTCAGTGAAGCTCAACTTGG + Intergenic
1117680400 14:58197819-58197841 TGGCTCACTGAACCCCAGACTGG - Intronic
1122475412 14:102005044-102005066 GGGCTGACAAAACCACAAGCTGG - Exonic
1123016965 14:105380340-105380362 GGGCGCCCTGACCCTGAAGCTGG - Intronic
1123698435 15:22896328-22896350 AAGCTCAATAAACCTCAAGCAGG - Intronic
1131072116 15:89472563-89472585 GTGCCCACTGCACCTCAGGCAGG + Intronic
1132523659 16:403130-403152 GGGCGCACTGAGGCTGAAGCAGG - Intronic
1134029502 16:10980424-10980446 GGACTCTCAGAATCTCAAGCAGG - Intronic
1134133547 16:11665725-11665747 GGGCTCACTGTCACCCAAGCTGG + Intergenic
1136574022 16:31112614-31112636 GGGCTCAGTGAACCTGAATGGGG - Intronic
1137025141 16:35466524-35466546 AGGCACACAGAACCTGAAGCAGG + Intergenic
1138729518 16:59179202-59179224 TGAACCACTGAACCTCAAGCAGG - Intergenic
1139590178 16:67928985-67929007 GGTCCCACTGAGCCTCAAGCTGG + Exonic
1140377764 16:74458601-74458623 TAGCTCACTGGACCTCAAACTGG - Intronic
1141092089 16:81137370-81137392 GGGCTCACTGAGCCTCATCAGGG + Intergenic
1141992044 16:87616026-87616048 GGGCTCTCTGAACACCAAGCAGG - Intronic
1142139591 16:88466942-88466964 GGGCTCAGTGAACCCCAAAACGG + Intronic
1142932411 17:3298305-3298327 GGGCAGCCTGAGCCTCAAGCTGG - Intergenic
1146445522 17:32929664-32929686 GAGCTCACTGGACCACAAGAAGG - Intronic
1147057212 17:37843919-37843941 GAGCTCACTGAGCCTCCACCTGG - Intergenic
1147689945 17:42308864-42308886 GGTCTCAGTGACCCTCAGGCAGG + Intronic
1149561073 17:57608360-57608382 TGGCTCTCTGAAGCTCACGCAGG + Intronic
1149667908 17:58378839-58378861 GAGCTCACTGAAACTCCAGTCGG + Intronic
1151357458 17:73568754-73568776 AGGCTCAATGAACCCCAAGCAGG + Intronic
1152953383 18:13549-13571 CGGCTCACTGAACCCCAAGTGGG + Intergenic
1157018670 18:43751835-43751857 TGGCTCAGTAAACCTCAAGCAGG + Intergenic
1157399641 18:47376784-47376806 AGAGTCACAGAACCTCAAGCTGG - Intergenic
1160724112 19:610105-610127 GGGCTGTCTGACCCACAAGCAGG + Intronic
1164752432 19:30666560-30666582 GGGCTTTCTGAGCCTCAAGGTGG + Intronic
1165070771 19:33253758-33253780 GGGCTCACTGAAGCCCAGGCTGG + Intergenic
1166178780 19:41092637-41092659 GGTCTCTCTGAGCCTAAAGCTGG + Intronic
1166296372 19:41892051-41892073 GGGCTCACTGGGCCCCAAGGAGG + Exonic
1166341466 19:42140029-42140051 GAGCTCACTGCTCCTCAACCTGG + Intronic
930373429 2:50533719-50533741 GAGCTCACTGAACAAGAAGCGGG - Intronic
932117231 2:69063184-69063206 AAGCTCAAAGAACCTCAAGCAGG + Intronic
932389167 2:71369588-71369610 GGGCTCACTGAACAACAGGAGGG - Intronic
933443064 2:82338722-82338744 CGGCTCACTGTACCTCCTGCCGG - Intergenic
933826231 2:86163574-86163596 GGGCTCATTGAACTTGAAGGAGG - Intronic
935012520 2:99149097-99149119 CGGCTCACTGGACCTCCACCCGG - Intronic
939986957 2:148839009-148839031 AAGTTCAATGAACCTCAAGCAGG - Intergenic
940882740 2:158962717-158962739 GAGCTCACTGAGCCTCAGCCTGG + Intergenic
941176121 2:162199407-162199429 GGGCTCATGGAAGCTCAGGCTGG + Intronic
945227485 2:207546699-207546721 GGTCTCACTGTCCCCCAAGCTGG - Intronic
1169316949 20:4600645-4600667 TGGCTCACTGAACTCCAAGCTGG - Intergenic
1169476777 20:5938965-5938987 GGTCTCACTGTTCCTCAGGCTGG + Intronic
1171102411 20:22397675-22397697 GGACTCACTGAAACTGAGGCTGG + Intergenic
1172278543 20:33694449-33694471 GGGCTCACTGGAGATGAAGCCGG - Intergenic
1173867351 20:46321135-46321157 GGGCCCCCTGCAACTCAAGCTGG + Intergenic
1175254892 20:57635726-57635748 GAGTTCACAGAACATCAAGCAGG + Intergenic
1176181284 20:63750955-63750977 AGCCACACTGAACCTCAAACAGG + Intronic
1181393285 22:22599483-22599505 GGGCTCAGGGAACCTCCTGCAGG - Intergenic
1181518232 22:23429862-23429884 GAGCTCAATGAACCATAAGCAGG - Intergenic
1181584389 22:23845127-23845149 GGGCTCACTGTCCCCCAAGCTGG - Intergenic
1183830712 22:40417216-40417238 GGCCTCTCTGACCCTGAAGCTGG + Intronic
1183882185 22:40842704-40842726 ATGCTCACTGAATCCCAAGCAGG + Intronic
1185240560 22:49741696-49741718 GAGCAAACTAAACCTCAAGCAGG - Intergenic
950675447 3:14551545-14551567 GGGCTCACTCAGCCTGGAGCAGG + Intergenic
957726565 3:84073685-84073707 GGGGGCACTGAACCACAGGCAGG + Intergenic
961183155 3:124891887-124891909 GGCCTCACTGTCCCCCAAGCTGG - Intronic
962229388 3:133648013-133648035 AGGCACAGTGAATCTCAAGCAGG + Intronic
962260334 3:133898031-133898053 GGGGCCACTGAACCTCAGCCTGG + Intergenic
962699241 3:137980348-137980370 GAGCTCACTGCAGCTCAAGGAGG + Intergenic
963032046 3:140988075-140988097 GGGCCCACTGCAGCTCAAGGAGG + Intergenic
965723428 3:171686684-171686706 GGACTCACTAGACCTCATGCTGG - Exonic
966494144 3:180560411-180560433 GAGCTCACTGCAGCTCAAGGAGG + Intergenic
967448790 3:189598479-189598501 AAGCTCCCTGAACTTCAAGCAGG + Intergenic
968342799 3:197971765-197971787 AAGTTCACTAAACCTCAAGCAGG - Intronic
973201206 4:47504509-47504531 GGGCTCACTGTGCTTCAGGCAGG + Intronic
974287826 4:59892467-59892489 GAGCCCACTGCAGCTCAAGCAGG + Intergenic
985186525 4:187322828-187322850 TGCCTCACTGAACCTCCAGCTGG - Intergenic
988917757 5:35912229-35912251 GAGCTCACTGCAGCTCAAGGAGG + Intronic
990590472 5:57257648-57257670 GGTCTCACTGTATCTCAGGCTGG + Intronic
991923783 5:71683927-71683949 GAGCTCACTAGTCCTCAAGCAGG + Intergenic
997168515 5:131688983-131689005 AGGCTCACAGAACACCAAGCAGG + Intronic
998396845 5:141824166-141824188 GGGAGCAATGAACCTGAAGCCGG - Intergenic
1000399750 5:160813502-160813524 GAGCTCACTGCAGCTCAAGGAGG + Intronic
1005141062 6:22632032-22632054 GGGCTCACAGAATCTACAGCCGG - Intergenic
1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG + Exonic
1015035295 6:128645970-128645992 GGGCTCCCTGAAACTCTCGCTGG - Intergenic
1017250849 6:152278115-152278137 GGGCTCTCTGCAGCTCCAGCAGG + Exonic
1017983556 6:159423127-159423149 TGGCTTAATGAACCTCAATCAGG - Intergenic
1018009306 6:159655307-159655329 GAGCTCACTGGCCCCCAAGCAGG + Intergenic
1018746923 6:166769525-166769547 GGGCACACAGAATCTCAAGCTGG - Intronic
1025868438 7:65407428-65407450 GGGCCCACTGCAACTCAAGGAGG - Intergenic
1027582589 7:80017317-80017339 GAGCTCACTGAACTTCAGGATGG - Intergenic
1028369065 7:90070450-90070472 GAGCCCACTGAAGCTCAAGGAGG + Intergenic
1029921125 7:104265352-104265374 TGGCTCACAGAACATCAGGCAGG - Intergenic
1035971686 8:4256606-4256628 GGTCTCACTGATTCTCAAGGTGG - Intronic
1039154582 8:34540737-34540759 GGGCCCACTGCAGCTCAAGGAGG + Intergenic
1039409995 8:37345490-37345512 GAGCTCAATGAACCCAAAGCAGG + Intergenic
1039892464 8:41694657-41694679 GGGCTCCCTGAAGAGCAAGCTGG - Exonic
1039901327 8:41754832-41754854 GGGTTCCCTGAACCTCATTCTGG - Intronic
1041070117 8:54120093-54120115 GAGATCAATGAACCCCAAGCAGG - Intergenic
1041812014 8:61922107-61922129 GGGATCACTCAACATCAAGATGG + Intergenic
1041873751 8:62664291-62664313 GTGCTGGCTGAACCTCAAACTGG - Intronic
1042113766 8:65409384-65409406 AATCTCACTGAACATCAAGCTGG + Intergenic
1047215561 8:122873235-122873257 GGGAGCACTGAACCTGGAGCTGG + Intronic
1047435565 8:124832986-124833008 TGGCTCACAGAATCTCCAGCAGG - Intergenic
1051230311 9:14948911-14948933 GGCCTCTCTGAACTTCAAGTTGG - Intergenic
1056682885 9:88734880-88734902 AGGTTCAGTGAACCACAAGCAGG - Intergenic
1203790599 EBV:149547-149569 GGGCCCGCTGAACGTCAAGGTGG - Intergenic
1187897265 X:23993974-23993996 TGGCTCACGCAACCTCAACCTGG - Intronic
1190554864 X:51623636-51623658 GAGCCCACTGAAGCTCAAGGAGG + Intergenic
1192674904 X:73185351-73185373 GAGCCCACTGAAGCTCAAGGAGG + Intergenic
1196623170 X:117847532-117847554 TGGCTCACTGAAGTTCAAGTTGG - Intergenic
1197400602 X:125984387-125984409 GGGCTCCTTGAATCTCTAGCTGG + Intergenic
1197678051 X:129352322-129352344 GGGCCCACTGCAGCTCAAGGAGG + Intergenic
1197708643 X:129651194-129651216 GAGCTGACTGAACCCCCAGCCGG + Intronic
1197832447 X:130658532-130658554 GAGCTCAGTGAACCCCAAGCAGG + Intronic
1200212848 X:154354559-154354581 GGGCTCACAGAACACCCAGCTGG + Intronic
1201244275 Y:11987275-11987297 GGGATCACTGACCATCCAGCAGG + Intergenic
1201784295 Y:17757453-17757475 GGTCTCCCTGGACTTCAAGCAGG - Intergenic
1201817258 Y:18148534-18148556 GGTCTCCCTGGACTTCAAGCAGG + Intergenic
1201969869 Y:19780167-19780189 GAGCCCACTGCACCTCAAGGAGG + Intergenic
1202137619 Y:21683365-21683387 GGGCTGACTCAACCTTAATCTGG + Intergenic