ID: 1077223470

View in Genome Browser
Species Human (GRCh38)
Location 11:1427435-1427457
Sequence GCAGACTAGCACGTTAACAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 231}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077223470_1077223478 13 Left 1077223470 11:1427435-1427457 CCCGTGTTAACGTGCTAGTCTGC 0: 1
1: 0
2: 0
3: 3
4: 231
Right 1077223478 11:1427471-1427493 GCATCCTCGTGGCATACCCGTGG 0: 1
1: 0
2: 0
3: 2
4: 31
1077223470_1077223475 2 Left 1077223470 11:1427435-1427457 CCCGTGTTAACGTGCTAGTCTGC 0: 1
1: 0
2: 0
3: 3
4: 231
Right 1077223475 11:1427460-1427482 CCTGAGGCCCAGCATCCTCGTGG 0: 1
1: 0
2: 0
3: 24
4: 207
1077223470_1077223481 23 Left 1077223470 11:1427435-1427457 CCCGTGTTAACGTGCTAGTCTGC 0: 1
1: 0
2: 0
3: 3
4: 231
Right 1077223481 11:1427481-1427503 GGCATACCCGTGGCTTCCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 75
1077223470_1077223480 22 Left 1077223470 11:1427435-1427457 CCCGTGTTAACGTGCTAGTCTGC 0: 1
1: 0
2: 0
3: 3
4: 231
Right 1077223480 11:1427480-1427502 TGGCATACCCGTGGCTTCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077223470 Original CRISPR GCAGACTAGCACGTTAACAC GGG (reversed) Intronic
900201667 1:1410505-1410527 GCAGACAAACACGTGAACAAAGG - Intergenic
904272567 1:29360025-29360047 GCAGACAAACACGTGAACAAAGG - Intergenic
906404218 1:45528800-45528822 GCAGACAAACACGTGAACAAAGG - Intergenic
907120868 1:52006943-52006965 GCAGACAAACACGTGAACAAAGG - Intergenic
909413230 1:75377785-75377807 GCAGACAAACACGTGAACAAAGG - Intronic
909413881 1:75383190-75383212 GCAGACAAACACGTGAACAAAGG - Intronic
910604336 1:89067109-89067131 GCAGACAAACACGTGAACAAAGG + Intergenic
911010609 1:93277028-93277050 GCAGACAAACACGTGAACAAAGG + Intronic
915401756 1:155626912-155626934 GCAGACAAACACGTGAACAAAGG + Intergenic
915402661 1:155635124-155635146 GCAGACAAACACGTGAACAAAGG + Intergenic
915480281 1:156179922-156179944 GCAGACAAACACGTGAACAAAGG - Intergenic
915890456 1:159768495-159768517 GCAGACAAACACGTGAACAAAGG - Intergenic
916009433 1:160691485-160691507 GCAGACAAACACGTGAACAAAGG - Intronic
916010322 1:160699748-160699770 GCAGACAAACACGTGAACAAAGG - Intronic
917566217 1:176214734-176214756 GCAGCCTAGCAAATTAATACAGG + Intergenic
920796431 1:209141905-209141927 GCAGACAAACACGTGAACAAAGG - Intergenic
922305456 1:224340530-224340552 GCAGACAAACACGTGAACAAAGG - Intergenic
922715479 1:227868586-227868608 GCAGACAAACACGTGAACAAAGG + Intergenic
1065553787 10:26894169-26894191 GCAGACAAACACGTGAACAAAGG - Intergenic
1066927306 10:41713885-41713907 GCAGACAAACACGTGAACAAAGG - Intergenic
1067101483 10:43337902-43337924 GCAGACAAACACGTGAACAAAGG - Intergenic
1069452127 10:68526368-68526390 GCAGACAAACACGTGAACAAAGG - Intronic
1077223470 11:1427435-1427457 GCAGACTAGCACGTTAACACGGG - Intronic
1078327364 11:10391555-10391577 GCAGACAAACACGTGAACAAAGG + Intronic
1079770021 11:24446785-24446807 GCAGACAAACACGTGAACAAAGG - Intergenic
1081202675 11:40236715-40236737 GCAGATTAGCCCCTTGACACAGG + Intronic
1083372836 11:62195360-62195382 GCAGACAAACACGTGAACAAAGG - Intergenic
1083467559 11:62858762-62858784 GCAGACAAACACGTGAACAAAGG + Intronic
1083543374 11:63530560-63530582 GCAGACAAACACGTGAACAAAGG + Intergenic
1084207365 11:67603600-67603622 GCAGACAAACACGTGAACAAAGG + Exonic
1084247354 11:67868210-67868232 GCAGACAAACACGTGAACAAAGG + Intergenic
1084880135 11:72165073-72165095 GCAGACAAACACGTGAACAAAGG - Intergenic
1087723769 11:101695762-101695784 GCAGACAAACACGTGAACAAAGG - Intronic
1087724700 11:101704260-101704282 GCAGACAAACACGTGAACAAAGG - Intronic
1089471176 11:118721261-118721283 GCAGACAAACACGTGAACAAAGG + Intergenic
1089472071 11:118729453-118729475 GCAGACAAACACGTGAACAAAGG + Intergenic
1091984251 12:4895156-4895178 GAAGCCTAGCACTTTAATACGGG + Intergenic
1092249647 12:6886100-6886122 GCAGACAAACACGTGAACAAAGG + Intronic
1092559869 12:9601165-9601187 GCAGACAAACACGTGAACAAAGG - Intronic
1094389318 12:29932300-29932322 GCAGACAAACACGTGAACAAAGG + Intergenic
1094623255 12:32100210-32100232 GCAGACAAACACGTGAACAAAGG - Intergenic
1096420649 12:51454533-51454555 GCAGACAAACACGTGAACAAAGG + Intronic
1096940091 12:55334130-55334152 GCAGACAAACACGTGAACAAAGG - Intergenic
1097076757 12:56400607-56400629 GCAGACAAACACGTGAACAAAGG + Intergenic
1097913980 12:65000684-65000706 GCAGATAAGCACGTGAACAAAGG + Intergenic
1100276339 12:93075101-93075123 GCAGACAAACACGTGAACAAAGG - Intergenic
1101170570 12:102088804-102088826 GCAGATTAACACGTGAACAAAGG + Intronic
1101520609 12:105478805-105478827 GCAGACAAACACGTGAACAAAGG + Intergenic
1102135494 12:110570737-110570759 GCAGACAAACACGTGAACAAAGG - Intronic
1103092408 12:118106675-118106697 GCAGACAAACACGTGAACAAAGG - Intronic
1103794359 12:123493305-123493327 GCAGACAAACACGTGAACAAAGG - Intronic
1107700318 13:43040786-43040808 GCAGATAAGCACGTGAACAAAGG + Intronic
1108352468 13:49599722-49599744 GCAGACAAACACGTGAACAAAGG - Intergenic
1109789115 13:67225329-67225351 ACATACTGGCACGTTAATACTGG + Intronic
1114438104 14:22724931-22724953 GCAGACAAACACGTGAACAAAGG + Intergenic
1117365670 14:55025235-55025257 GCAGACAAACACGTGAACAAAGG - Intronic
1118351997 14:64978834-64978856 GCAGACAAACACGTGAACAAAGG + Intronic
1119841278 14:77794920-77794942 GCAGACAAACACGTGAACAAAGG + Intergenic
1128130969 15:65226788-65226810 GCAGACAAACACGTGAACAAAGG + Intergenic
1128193997 15:65734353-65734375 GCAGACAAACACGTGAACAAAGG - Intronic
1129485824 15:75871100-75871122 GCAGACAAACACGTGAACAAAGG + Intronic
1130944554 15:88541251-88541273 GCAGACAAACACGTGAACAAAGG - Intronic
1130968621 15:88715619-88715641 GCAGACTGGGAGTTTAACACAGG + Intergenic
1132440550 15:101860223-101860245 GCAGACAAACACGTGAACAAAGG + Intergenic
1133432960 16:5754634-5754656 GCAGACAAACACGTGAACAAAGG + Intergenic
1135486195 16:22867270-22867292 GCAGACTTGCACCTTAAAAATGG + Intronic
1135577900 16:23600175-23600197 GCAGACAAACACGTGAACAAAGG - Intergenic
1136930326 16:34412303-34412325 GCAGACAAACACGTGAACAAAGG + Intergenic
1136974248 16:34999503-34999525 GCAGACAAACACGTGAACAAAGG - Intergenic
1137366633 16:47865158-47865180 GCAGACAAACACGTGAACAAAGG - Intergenic
1140418846 16:74799639-74799661 GCAGACAAACACGTGAACAAAGG + Intergenic
1141279010 16:82613904-82613926 TCAGCCTAGCACCCTAACACAGG + Intergenic
1143195728 17:5074926-5074948 GCAGACAAACACGTGAACAAAGG + Intergenic
1144745461 17:17611174-17611196 GCAGACAAACACGTGAACAAAGG + Intergenic
1146181384 17:30700287-30700309 GCAGACAAACACGTGAACAAAGG + Intergenic
1150840878 17:68604238-68604260 GCAGACAAACACGTTAACAAAGG + Intergenic
1152480864 17:80551454-80551476 GCAGACAAACACGTGAACAAGGG + Intronic
1152612785 17:81323770-81323792 GCAGCCCAGCACGTGAACCCGGG + Intronic
1153143419 18:2001060-2001082 GCAGACAAACACGTGAACAAAGG + Intergenic
1153422046 18:4917525-4917547 GCAGACAAACACGTGAACAAAGG + Intergenic
1155472078 18:26202081-26202103 GCAGACAAACACGTGAACAGAGG + Intergenic
1157977616 18:52343393-52343415 GGAGACTAGCACAATAGCACTGG + Intronic
1159968661 18:74621902-74621924 GAGGACTAGCACATAAACACTGG - Intronic
1160675224 19:387369-387391 GCAGACAAACACGTGAACAAAGG - Intergenic
1160741090 19:686174-686196 GCAGACTCGAATGTTCACACAGG - Intronic
1162992816 19:14314377-14314399 GCAGACTCACACATTCACACAGG + Intergenic
1164122888 19:22284235-22284257 GCAGACAAACACGTGAACAAAGG - Intergenic
1164273328 19:23693318-23693340 GCAGACAAACACGTGAACAAAGG - Intergenic
1164370313 19:27637836-27637858 GCAGACAAACACGTGAACAAAGG + Intergenic
1164488980 19:28689558-28689580 GCAGACAAACACGTGAACAAAGG + Intergenic
1165508041 19:36247211-36247233 GCAGACAAACACGTGAACAAAGG + Intergenic
1165595137 19:37006858-37006880 GCAGACAAACACGTGAACAAAGG - Intergenic
1165634854 19:37332104-37332126 GCAGACAAACACGTGAACAAAGG - Intronic
1165666166 19:37630191-37630213 GCAGACAAACACGTGAACAAAGG + Intronic
1165691451 19:37866876-37866898 GCAGACAAACACGTGAACAAAGG - Intergenic
1166653687 19:44594795-44594817 GCAGACAAACACGTGAACAAAGG - Intergenic
1167336621 19:48890335-48890357 GCAGACAAACACGTGAACAAAGG - Intronic
1167818920 19:51908437-51908459 GCAGACAAACACGTGAACAAAGG + Intronic
1167833167 19:52043832-52043854 GCAGACAAACACGTGAACAAAGG - Intronic
1168052407 19:53839325-53839347 GCAGATAAACACGTTAACAAAGG - Intergenic
1168219534 19:54950528-54950550 GCAGATAAACACGTTAACAAAGG + Intronic
927992882 2:27460678-27460700 GCAGACAAACACGTGAACAAAGG - Intronic
928990281 2:37226017-37226039 GCAGACAAACACGTGAACAAAGG - Intronic
929208147 2:39321861-39321883 GCAGACAAACACGTGAACAGTGG - Intronic
932039100 2:68280061-68280083 TCAGACTAGCACATTAGGACTGG + Intergenic
933838095 2:86261999-86262021 GCAGACAAACACGTGAACAAAGG - Intronic
937037399 2:118793406-118793428 GGAGACTAGCTCATTAACACTGG + Intergenic
938270066 2:129962211-129962233 GCAGACAAACACGTGAACAAAGG + Intergenic
945175256 2:207037525-207037547 GCAGACAAACACGTGAACAAAGG - Intergenic
945832434 2:214803584-214803606 GCAGACAAACACGTGAACAAAGG - Intronic
947273369 2:228363888-228363910 GCAGACAAACACGTGAACAAAGG + Intergenic
947520701 2:230843883-230843905 GCAGACAAACACGTGAACAAAGG + Intergenic
947619127 2:231577475-231577497 GCAGACAAACACGTGAACAAAGG - Intergenic
1172479458 20:35262370-35262392 GCAGACAAACACGTGAACAAAGG + Intronic
1173319109 20:41971595-41971617 GCAGACAAACACGTGAACAAAGG - Intergenic
1174026395 20:47580157-47580179 GAAGACCAGCACTATAACACTGG + Intronic
1176424391 21:6539061-6539083 GCAGACAAACACGTGAACAAAGG + Intergenic
1177249071 21:18568923-18568945 GCAGACAAACACGTGAACAAAGG + Intergenic
1179444412 21:41421115-41421137 GCAGACAAACACGTGAACAAAGG + Intronic
1179699884 21:43147376-43147398 GCAGACAAACACGTGAACAAAGG + Intergenic
1180837775 22:18939373-18939395 GCAGACAAACACGTGAACAAAGG - Intergenic
1180838684 22:18947580-18947602 GCAGACAAACACGTGAACAAAGG - Intergenic
1181642565 22:24211134-24211156 GCAGACAAACACGTGAACAAAGG + Intergenic
1203287866 22_KI270734v1_random:164672-164694 GCAGACAAACACGTGAACAAAGG - Intergenic
950607072 3:14091431-14091453 GCAGACAAACACGTGAACAAAGG + Intergenic
951514610 3:23544909-23544931 GCAGACAAACACGTGAACAAAGG + Intronic
953960128 3:47260233-47260255 GCAGACAAACACGTGAACAAAGG - Intronic
954440712 3:50520580-50520602 GCAGACAAACACGTGAACAAAGG - Intergenic
959069914 3:101692599-101692621 GCAGACAAACACGTGAACAAAGG - Intergenic
959070819 3:101700747-101700769 GCAGACAAACACGTGAACAAAGG - Intergenic
959071258 3:101704079-101704101 GCAGACAAACACGTGAACAAAGG + Intergenic
960027391 3:113024523-113024545 GCAGACAAACACGTGAACAAAGG + Intergenic
960028304 3:113032722-113032744 GCAGACAAACACGTGAACAAAGG + Intergenic
961296784 3:125891150-125891172 GCAGACAAACACGTGAACAAAGG - Intergenic
961297600 3:125899484-125899506 GCAGACAAACACGTGAACAAAGG - Intergenic
961512551 3:127411899-127411921 GCAGACAAACACGTGAACAAAGG + Intergenic
961833986 3:129641341-129641363 GCAGACAAACACGTGAACAAAGG + Intergenic
962410144 3:135134089-135134111 GCAGCCTTGCACGGTAACCCCGG - Intronic
967025820 3:185562794-185562816 GCAGACAAACACGTGAACAAAGG + Intergenic
967026731 3:185571006-185571028 GCAGACAAACACGTGAACAAAGG + Intergenic
967179059 3:186887120-186887142 GCAGACAAACACGTGAACAAAGG + Intergenic
967179775 3:186893918-186893940 GCAGACAAACACGTGAACAAAGG - Intergenic
968095567 3:195927771-195927793 GCAGACAAACACGTGAACAAAGG + Intergenic
968387200 4:151988-152010 GCAGACAAACACGTGAACAAAGG + Intronic
971336046 4:25725022-25725044 GCAGACTAGCATGTGCACAGGGG - Intergenic
974518003 4:62941577-62941599 GCAGACAAACACGTGAACAAAGG - Intergenic
975246792 4:72129470-72129492 GCAGACAAACACGTGAACAAAGG + Intronic
978057120 4:104284041-104284063 GCTCACTAGATCGTTAACACTGG + Intergenic
979322691 4:119342780-119342802 GCAGACAAACACGTGAACAAAGG + Intergenic
982512808 4:156305008-156305030 GCAGACAAACACGTGAACAAAGG + Intergenic
982876637 4:160659485-160659507 GCAGACAAACACGTGAACAAAGG - Intergenic
983205413 4:164905760-164905782 GCAGACAAACACGTGAACAAAGG + Intergenic
985738038 5:1596223-1596245 GCAGACAAACACGTGAACAAAGG + Intergenic
986549666 5:8938440-8938462 GCAGACAAACACGTGAACAAAGG - Intergenic
987490898 5:18579154-18579176 GCAGACAAACACGTGAACAAAGG - Intergenic
988379946 5:30486899-30486921 GCAGACAAACACGTGAACAAAGG + Intergenic
988380870 5:30495395-30495417 GCAGACAAACACGTGAACAAAGG + Intergenic
988850644 5:35177085-35177107 GCAGACAAACACGTGAACAAAGG - Intronic
989737879 5:44730733-44730755 GCAGACAAACACGTGAACAAAGG + Intergenic
990205472 5:53424438-53424460 GCAGACTTGCACGCTAATCCTGG - Intergenic
990414332 5:55571771-55571793 GCAGACAAACACGTGAACAAAGG - Intergenic
990789789 5:59464486-59464508 GCAGACAAACACGTGAACAAAGG - Intronic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
992320164 5:75606079-75606101 GCAGACAAACACGTGAACAAAGG + Intergenic
995878896 5:116821830-116821852 GCAGACAAACACGTGAACAAAGG - Intergenic
996163371 5:120194930-120194952 GCAGACAAACACGTGAACAAAGG + Intergenic
998796585 5:145826257-145826279 GCAGACAAGCAGGTTCACATGGG + Intronic
999951664 5:156657952-156657974 GCAGACAAACACGTGAACAAAGG + Intronic
999952567 5:156666164-156666186 GCAGACAAACACGTGAACAAAGG + Intronic
1001232065 5:169997121-169997143 GCAGACCAACACGTGAACAAAGG + Intronic
1002666285 5:180827964-180827986 GCAGACAAACACGTGAACAAAGG - Intergenic
1003066633 6:2909362-2909384 GCAGACAAACACGTGAACAAAGG - Intergenic
1005638708 6:27774706-27774728 GCAGACAAACACGTGAACAAAGG + Intergenic
1006250370 6:32778314-32778336 GCAGACAAACACGTGAACAAAGG + Intergenic
1006399738 6:33810206-33810228 GCAGACAAACACGTGAACAAAGG + Intergenic
1006538418 6:34719706-34719728 GCAGACAAACACGTGAACAAAGG + Intergenic
1007793488 6:44328294-44328316 GCAGACAAACACGTGAACAAAGG + Intronic
1008583028 6:52923372-52923394 GCAGACAAACACGTGAACAAAGG - Intergenic
1010591418 6:77717191-77717213 GCAGACAAACACGTGAACAAAGG + Intronic
1010686456 6:78859487-78859509 GCAGACAAACACGTGAACAAAGG - Intergenic
1011536595 6:88382287-88382309 GCAGACAAACACGTGAACAAAGG - Intergenic
1011967214 6:93174062-93174084 GCAGACAAACACGTGAACAAAGG - Intergenic
1012458182 6:99430070-99430092 GCAGACAAACACGTGAACAAAGG - Intergenic
1013555747 6:111255344-111255366 GCAGACAAACACGTGAACAAAGG + Intergenic
1015574741 6:134659356-134659378 GCAGACAAACACGTGAACAAAGG + Intergenic
1016890968 6:149006351-149006373 GCAAACTAACAAATTAACACAGG - Intronic
1017171072 6:151455456-151455478 GCAGACAAACACGTGAACAAAGG + Intronic
1019071202 6:169346531-169346553 GCAGACAAACACGTGAACAAAGG + Intergenic
1021067825 7:16198421-16198443 GCAGACAAACACGTGAACAAAGG - Intronic
1021671632 7:23040555-23040577 GCAGACAAACACGTGAACAAAGG - Intergenic
1022164267 7:27741900-27741922 GCAGACAAACACGTGAACAAAGG + Intronic
1029534723 7:101150099-101150121 GCAGACAAACACGTGAACAAAGG + Intergenic
1029966761 7:104748620-104748642 GCAGACAAACACGTGAACAAAGG - Intronic
1030760261 7:113341764-113341786 GCAGACAAACACGTGAACAAAGG + Intergenic
1031607027 7:123781336-123781358 GCAGACAAACACGTGAACAAAGG - Intergenic
1033349844 7:140553230-140553252 GCAGACAAACACGTGAACAAAGG + Intronic
1034097169 7:148420108-148420130 GCAGACTAACCTGTCAACACTGG + Exonic
1036291640 8:7498121-7498143 GCAGACAAACACGTGAACAAAGG + Intronic
1036292572 8:7506624-7506646 GCAGACAAACACGTGAACAAAGG + Intronic
1037429490 8:18794648-18794670 GCAGACAAACACGTGAACAAAGG - Intronic
1039392603 8:37193614-37193636 GCAGACAAACACGTGAACAAAGG + Intergenic
1040027582 8:42795940-42795962 GCAGACAAACACGTGAACAAAGG + Intronic
1040126119 8:43739785-43739807 GCAGACAAACACGTGAACAAAGG + Intergenic
1040413262 8:47176279-47176301 GCAGACAAACACGTGAACAAAGG + Intergenic
1041060704 8:54031927-54031949 GCAGACAAACACGTGAACAAAGG + Intergenic
1041374506 8:57199849-57199871 GCAGACAAACACGTGAACAAAGG + Intergenic
1044310216 8:90684731-90684753 GCAGACAAACACGTGAACAAAGG - Intronic
1044310348 8:90685578-90685600 GCAGACAAACACGTGAACAAAGG - Intronic
1048947171 8:139460152-139460174 GCAGACAAACACGTGAACAAAGG + Intergenic
1049556975 8:143287530-143287552 GCAGACAAACACGTGAACAAAGG + Intergenic
1049663673 8:143832688-143832710 GCAGACAAACACGTGAACAAAGG - Intergenic
1049667072 8:143849949-143849971 GCAGACAAACACGTGAACAAAGG + Intergenic
1049845065 8:144796593-144796615 GCAGACAAACACGTTAACAAAGG - Intergenic
1051471326 9:17446060-17446082 GCAGACAAACACGTGAACAAAGG - Intronic
1052676539 9:31633125-31633147 GCAGACAAACACGTGAACAAAGG + Intergenic
1054322198 9:63681855-63681877 GCAGACAAACACGTGAACAAAGG + Intergenic
1054843071 9:69763383-69763405 GCAGACAAACACGTGAACAAAGG + Intergenic
1055157909 9:73087453-73087475 GCAGACAAACACGTGAACAAAGG + Intergenic
1056748089 9:89322544-89322566 GAAGAATAGCACGTTAATTCTGG - Intronic
1056756945 9:89387626-89387648 GGACACGAGCACGTTAACAGCGG - Intronic
1058806295 9:108595304-108595326 GCAGACAAACACGTGAACAAAGG - Intergenic
1060167406 9:121429805-121429827 GCAGACAAACACGTGAACAAAGG - Intergenic
1203456817 Un_GL000219v1:175910-175932 GCAGACAAACACGTGAACAAAGG - Intergenic
1187530486 X:20092114-20092136 GGAGTTTAGCAGGTTAACACTGG - Intronic
1191033287 X:55998016-55998038 GCAGACAAACACGTGAACAAAGG + Intergenic
1194200805 X:90951315-90951337 GCAGACAAACACGTGAACAAAGG - Intergenic
1197383893 X:125780210-125780232 GCAGACAAACACGTGAACAAAGG - Intergenic
1198602218 X:138296027-138296049 GCAGACAAACACGTGAACAAAGG + Intergenic
1199256175 X:145721087-145721109 GCAGACAAACACGTGAACAAAGG + Intergenic
1200731689 Y:6749587-6749609 GCAGACAAACACGTGAACAAAGG - Intergenic
1201643776 Y:16205182-16205204 GCAGAAAAGAACGTTAACTCTGG - Intergenic
1201659039 Y:16380139-16380161 GCAGAAAAGAACGTTAACTCTGG + Intergenic
1202253111 Y:22893285-22893307 GCAGACAAACACGTGAACAAAGG + Intergenic
1202406101 Y:24527034-24527056 GCAGACAAACACGTGAACAAAGG + Intergenic
1202464681 Y:25143047-25143069 GCAGACAAACACGTGAACAAAGG - Intergenic